Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with
or
.
Download ZIP
Big data bioinformatics repository
Ruby
Tag: v0.1.3

Fetching latest commit…

Cannot retrieve the latest commit at this time

Failed to load latest commit information.
bin
doc
lib
spec
test
.gitignore
Gemfile
Gemfile.lock
LICENSE
README.md
Rakefile
VERSION
bio-bigbio.gemspec

README.md

BIGBIO

BigBio = BIG DATA for Ruby

BigBio is an initiative to a create high performance libraries for big data computing in biology.

BigBio may use BioLib C/C++/D functions for increasing performance and reducing memory consumption.

This is an experimental project. If you wish to contribute subscribe to the BioRuby and/or BioLib mailing lists.

Overview

  • BigBio can translate nucleotide sequences to amino acid sequences using an EMBOSS C function, or BioRuby's translator.
  • BigBio has an ORF emitter which parses DNA/RNA sequences and emits ORFs between START_STOP or STOP_STOP codons.
  • BigBio has a FASTA file emitter, with iterates FASTA files and iterates sequences without loading everything in memory.

Examples

Iterate through a FASTA file

Read a file without loading the whole thing in memory

fasta = FastaReader.new(fn)
fasta.each do | rec |
  print rec.descr,rec.seq
end

Write a FASTA file. Any object can be passed in, as long as it responds to 'descr' and 'seq.to_s', or 'id' and 'seq.to_s'. E.g.

class StorageObject
  attr_accessor :descr, :seq
end

mysequence = StorageObject.new
mysequence.descr = 'Test'
mysequence.seq = "agtcta"

now we can write a FASTA file

fasta = FastaWriter.new(fn)
fasta.write(mysequence)

Fetch ORFs from a sequence

BigBio can parse a sequence for ORFs. Together with the FastaReader little memory gets used

predictorf = PredictORF.new(id,descr,"ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")
# get all ORFs between start and stop codons, longer than 30 bps
orfs = predictorf.startstop(30)
# get all sequences between stop codons
seqs = predictorf.stopstop(0)

Rapid DNA/RNA to amino acid translation

Translate with EMBOSS C library, if linked, otherwise use BioRuby

trn_table = Bio::Big::TranslationAdapter.translation_table(1)
translate = Nucleotide::Translate.new(trn_table)
aa_frames = translate.aa_6_frames("ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")

Install

The easy way

gem install bio-bigbio

in your code

require 'bigbio'

Copyright

Copyright (c) 2011-2012 Pjotr Prins. See LICENSE for further details.

Something went wrong with that request. Please try again.