Permalink
Browse files

Merge branch 'release_candidate' of git@github.com:pjotrp/biolib into…

… test
  • Loading branch information...
2 parents 6f677ce + 8e81e5b commit 1181cee1c60ebcac9558f85cd1af7f182e58fa85 @pjotrp committed Aug 14, 2009
Showing with 109 additions and 0 deletions.
  1. +109 −0 src/test/data/fasta/example.fasta
View
109 src/test/data/fasta/example.fasta
@@ -0,0 +1,109 @@
+
+>At1g02580 mRNA (2291 bp) UTR's and CDS
+aggcgagtggttaatggagaaggaaaaccatgaggacgatggtgagggtttgccacccgaactaaatcagataaaa
+gagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactc
+atgcttcacaccatcaatcgtttgacttaaaccagcccgctgcagaggatgataatggaggagacaacaaatcact
+tttgtcgagaatgcaaaacccacttcgtcatttcagtgcctcatctgattataattcttacgaagatcaaggttat
+gttcttgatgaggatcaagattatgctcttgaagaagatgtaccattatttcttgatgaagatgtaccattattac
+caagtgtcaagcttccaattgttgagaagctaccacgatccattacatgggtcttcaccaaaagtagccagctgat
+ggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtgaggcactagaattgagcagtgaa
+gaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagacc
+gatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcga
+agtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtgaggcttct
+gatttgacatccaagacaataactactgctttccaggattttgctgatagacgtcattgccgtcgttgcatgatat
+tcgattgtcatatgcatgagaagtatgagcccgagtctagatccagcgaagacaaatctagtttgtttgaggatga
+agatagacaaccatgcagtgagcattgttacctcaaggtgaggagtgtgacagaagctgatcatgtgatggataat
+gataactctatatcaaacaagattgtggtctcagatccaaacaacactatgtggacgcctgtagagaaggatcttt
+acttgaaaggaattgagatatttgggagaaacagttgtgatgttgcattaaacatacttcgggggcttaagacgtg
+cctagagatttacaattacatgcgcgaacaagatcaatgtactatgtcattagaccttaacaaaactacacaaaga
+cacaatcaggttaccaaaaaagtatctcgaaaaagtagtaggtcggtccgcaaaaaatcgagactccgaaaatatg
+ctcgttatccgcctgctttaaagaaaacaactagtggagaagctaagttttataagcactacacaccatgcacttg
+caagtcaaaatgtggacagcaatgcccttgtttaactcacgaaaattgctgcgagaaatattgcgggtgctcaaag
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaattcctccttcaaaccaataaaaagattctcattggaaagtctgatgtt
+catggatggggtgcatttacatgggactctct taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+gctcgaaatcgatgctcgccgtaaaggaaacgagttcaaatttctcaatcactcagcaagacctaactgctacgcc
+aagttgatgattgtgagaggagatcagaggattggtctatttgcggagagagcaatcgaagaaggtgaggagcttt
+tcttcgactactgctatggaccagaacatgcggattggtcgcgtggtcgagaacctagaaagactggtgcttctaa
+aaggtctaaggaagcccgtccagctcgttagtttttgatctgaggagaagcagcaattcaagcagtccttttttta
+tgttatggtatatcaattaataatgtaatgctattttgtgttactaaaccaaaacttaagtttctgttttatttgt
+tttagggtgttttgtttgtatcatatgtgtcttaactttcaaagttttctttttgtatttcaatttaaaaacaatg
+tttatgttgtt
+
+>At1g02580 mRNA (2291 bp) UTR's and CDS (duplicate)
+aggcgagtggttaatggagaaggaaaaccatgaggacgatggtgagggtttgccacccgaactaaatcagataaaa
+gagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactc
+atgcttcacaccatcaatcgtttgacttaaaccagcccgctgcagaggatgataatggaggagacaacaaatcact
+tttgtcgagaatgcaaaacccacttcgtcatttcagtgcctcatctgattataattcttacgaagatcaaggttat
+gttcttgatgaggatcaagattatgctcttgaagaagatgtaccattatttcttgatgaagatgtaccattattac
+caagtgtcaagcttccaattgttgagaagctaccacgatccattacatgggtcttcaccaaaagtagccagctgat
+ggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtgaggcactagaattgagcagtgaa
+gaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagacc
+gatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcga
+agtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtgaggcttct
+gatttgacatccaagacaataactactgctttccaggattttgctgatagacgtcattgccgtcgttgcatgatat
+tcgattgtcatatgcatgagaagtatgagcccgagtctagatccagcgaagacaaatctagtttgtttgaggatga
+agatagacaaccatgcagtgagcattgttacctcaaggtgaggagtgtgacagaagctgatcatgtgatggataat
+gataactctatatcaaacaagattgtggtctcagatccaaacaacactatgtggacgcctgtagagaaggatcttt
+acttgaaaggaattgagatatttgggagaaacagttgtgatgttgcattaaacatacttcgggggcttaagacgtg
+cctagagatttacaattacatgcgcgaacaagatcaatgtactatgtcattagaccttaacaaaactacacaaaga
+cacaatcaggttaccaaaaaagtatctcgaaaaagtagtaggtcggtccgcaaaaaatcgagactccgaaaatatg
+ctcgttatccgcctgctttaaagaaaacaactagtggagaagctaagttttataagcactacacaccatgcacttg
+caagtcaaaatgtggacagcaatgcccttgtttaactcacgaaaattgctgcgagaaatattgcgggtgctcaaag
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaattcctccttcaaaccaataaaaagattctcattggaaagtctgatgtt
+catggatggggtgcatttacatgggactctct taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+gctcgaaatcgatgctcgccgtaaaggaaacgagttcaaatttctcaatcactcagcaagacctaactgctacgcc
+aagttgatgattgtgagaggagatcagaggattggtctatttgcggagagagcaatcgaagaaggtgaggagcttt
+tcttcgactactgctatggaccagaacatgcggattggtcgcgtggtcgagaacctagaaagactggtgcttctaa
+aaggtctaaggaagcccgtccagctcgttagtttttgatctgaggagaagcagcaattcaagcagtccttttttta
+tgttatggtatatcaattaataatgtaatgctattttgtgttactaaaccaaaacttaagtttctgttttatttgt
+tttagggtgttttgtttgtatcatatgtgtcttaactttcaaagttttctttttgtatttcaatttaaaaacaatg
+tttatgttgtt
+
+>At1g65300: mRNA 837bp
+atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaag
+ggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaa
+ctcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttg
+gaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcaga
+agctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgta
+taatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggatt
+ga gatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcagattccaaagaaaattcatggttt taatatgaatatgaataaggattcgaatcaaagtatg
+gttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccacc
+ccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctcta
+g
+
+>At1g65300: mRNA 837bp (shortened at end)
+atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaag
+ggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaa
+ctcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttg
+gaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcaga
+agctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgta
+taatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggatt
+gagatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcag
+
+
+>At1g65300: mRNA 837bp (shortened from start)
+ttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcagattccaaagaaaattcatggttttaatatgaatatgaataaggattcgaatcaaagtatg
+gttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccacc
+ccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctcta
+g
+
+
+>At1g02580 - shortened for test - inserted cutpoint
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaataataaaaagattctcattggaaagtctgatgttcatggattcatggt
+tttaattggggtgcatttacatgggactctct taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+

0 comments on commit 1181cee

Please sign in to comment.