Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

Fixed regression

  • Loading branch information...
commit 00bde4805e45b8b48089a382cfb0134f6f180ff2 1 parent 05e722c
@pjotrp authored
View
4 test/data/regression/test_latest_wormbase_ext_gff3.ref
@@ -1,4 +1,3 @@
- INFO bio-gff3: Memory used BaseLine RAM 24M, VMEM 73M
INFO bio-gff3: ---- Digest DB and store data in mRNA Hash <>
WARN bio-gff3: Container <Contig> has no ID, so using sequence name instead <MhA1_Contig0 1 237641>
INFO bio-gff3: Added feature <Contig> with component ID <MhA1_Contig0 1 237641>
@@ -7176,8 +7175,6 @@
INFO bio-gff3: Adding CDS (validate) <MhA1_Contig18 86152 86382>
INFO bio-gff3: Adding CDS (validate) <MhA1_Contig18 86669 86825>
INFO bio-gff3: Adding CDS (validate) <MhA1_Contig18 87441 87496>
- INFO bio-gff3: Memory used After reading GFF RAM 25M, VMEM 73M
- INFO bio-gff3: Memory used After reading FASTA RAM 26M, VMEM 74M
INFO bio-gff3: find_component: Matched column 0 and location <MhA1_Contig0 1 237641>
>MhA1_Contig0 4027 4090 Sequence:MhA1_Contig0_1:237641 (4027:4090)
ATGTATAATGGTGACTCTGATTTACAATTAGAACGAATTAATGTCTATTACAACGAGGCTAGC
@@ -7886,4 +7883,3 @@ ATGAAACAAGGAGAAAAAAGGAAAAGCAATAATAATATTATTTTTTCTGCAACTGAGCATTCTGCTAATACATCACTAAA
WARN bio-gff3: No sequence information for <MhA1_Contig18 86669 86825>
INFO bio-gff3: find_component: Matched column 0 and location <MhA1_Contig18 1 90699>
WARN bio-gff3: No sequence information for <MhA1_Contig18 87441 87496>
- INFO bio-gff3: Memory used Done RAM 25M, VMEM 74M
View
2  test/test_bio-gff3.rb
@@ -42,7 +42,7 @@ def test_latest_wormbase
bin = File.expand_path(BIN)
cmd = "#{bin} --logger stdout #{opts}"
- assert_equal(true,RegressionTest::CliExec::exec(cmd,arg1))
+ assert_equal(true,RegressionTest::CliExec::exec(cmd,arg1,:ignore => 'Memory used'))
end
private
Please sign in to comment.
Something went wrong with that request. Please try again.