Permalink
Browse files

Fixes on 1.8.7

  • Loading branch information...
1 parent 1ccb846 commit c853511ac19c16363ca44a4f61a8cd966b8ec238 @pjotrp committed Feb 27, 2012
View
10 test/data/regression/test_ext_gff3.rtest
@@ -41,16 +41,16 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing2>
INFO bio-gff3: find_component: Matched seqname <test01>
+>mrna01a Sequence:test01_1:400 (101:280)
+TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+ INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01short Sequence:test01_1:400 (3:14)
GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01 Sequence:test01_1:400 (101:230)
TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTC
- INFO bio-gff3: find_component: Matched seqname <test01>
->mrna01a Sequence:test01_1:400 (101:280)
-TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
View
14 test/data/regression/test_gff3.rtest
@@ -43,10 +43,9 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
- WARN bio-gff3: No sequence information for <Transcript:trans-1>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched seqname <test01>
+>cds2 Sequence:test01_1:400 (192:200)
+TTCATGGGC
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing3>
INFO bio-gff3: find_component: Matched seqname <test01>
@@ -55,6 +54,7 @@ GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>cds1 Sequence:test01_1:400 (164:190, 192:200)
TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
- INFO bio-gff3: find_component: Matched seqname <test01>
->cds2 Sequence:test01_1:400 (192:200)
-TTCATGGGC
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
+ WARN bio-gff3: No sequence information for <Transcript:trans-1>
View
14 test/data/regression/test_lrucache_ext_gff3.rtest
@@ -44,19 +44,19 @@
INFO bio-gff3: Cache calls After reading files = 0 <>
INFO bio-gff3: Cache hits After reading files = 0 <>
INFO bio-gff3: Cache misses After reading files = 0 <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing2>
INFO bio-gff3: find_component: Matched seqname <test01>
+>mrna01a Sequence:test01_1:400 (101:280)
+TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+ INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01short Sequence:test01_1:400 (3:14)
GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01 Sequence:test01_1:400 (101:230)
TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTC
- INFO bio-gff3: find_component: Matched seqname <test01>
->mrna01a Sequence:test01_1:400 (101:280)
-TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
- INFO bio-gff3: Cache calls After iterating = 54 <>
- INFO bio-gff3: Cache hits After iterating = 37 <>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: Cache calls After iterating = 48 <>
+ INFO bio-gff3: Cache hits After iterating = 31 <>
INFO bio-gff3: Cache misses After iterating = 17 <>
View
18 test/data/regression/test_lrucache_gff3.rtest
@@ -46,10 +46,9 @@
INFO bio-gff3: Cache calls After reading files = 0 <>
INFO bio-gff3: Cache hits After reading files = 0 <>
INFO bio-gff3: Cache misses After reading files = 0 <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
- WARN bio-gff3: No sequence information for <Transcript:trans-1>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched seqname <test01>
+>cds2 Sequence:test01_1:400 (192:200)
+TTCATGGGC
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing3>
INFO bio-gff3: find_component: Matched seqname <test01>
@@ -58,9 +57,10 @@ GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>cds1 Sequence:test01_1:400 (164:190, 192:200)
TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
- INFO bio-gff3: find_component: Matched seqname <test01>
->cds2 Sequence:test01_1:400 (192:200)
-TTCATGGGC
- INFO bio-gff3: Cache calls After iterating = 76 <>
- INFO bio-gff3: Cache hits After iterating = 52 <>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
+ WARN bio-gff3: No sequence information for <Transcript:trans-1>
+ INFO bio-gff3: Cache calls After iterating = 84 <>
+ INFO bio-gff3: Cache hits After iterating = 60 <>
INFO bio-gff3: Cache misses After iterating = 24 <>
View
10 test/data/regression/test_nocache_ext_gff3.rtest
@@ -41,16 +41,16 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing2>
INFO bio-gff3: find_component: Matched seqname <test01>
+>mrna01a Sequence:test01_1:400 (101:280)
+TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+ INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01short Sequence:test01_1:400 (3:14)
GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01 Sequence:test01_1:400 (101:230)
TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTC
- INFO bio-gff3: find_component: Matched seqname <test01>
->mrna01a Sequence:test01_1:400 (101:280)
-TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
View
14 test/data/regression/test_nocache_gff3.rtest
@@ -43,10 +43,9 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
- WARN bio-gff3: No sequence information for <Transcript:trans-1>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched seqname <test01>
+>cds2 Sequence:test01_1:400 (192:200)
+TTCATGGGC
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing3>
INFO bio-gff3: find_component: Matched seqname <test01>
@@ -55,6 +54,7 @@ GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>cds1 Sequence:test01_1:400 (164:190, 192:200)
TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
- INFO bio-gff3: find_component: Matched seqname <test01>
->cds2 Sequence:test01_1:400 (192:200)
-TTCATGGGC
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
+ WARN bio-gff3: No sequence information for <Transcript:trans-1>

0 comments on commit c853511

Please sign in to comment.