Permalink
Browse files

Updating dependencies

Introducing new test for failing WormBase gff3
  • Loading branch information...
1 parent e3ca87f commit dedcbeaf5798f60231a6d1627bcf21d8d014a2d5 @pjotrp committed Aug 10, 2012
View
@@ -8,9 +8,9 @@ gem "bio-logger", "> 0.8.0"
# Add dependencies to develop your gem here.
# Include everything needed to run rake, tests, features, etc.
group :development do
- gem "rake"
gem "shoulda", ">= 0"
- gem "bundler", "~> 1.0.0"
- gem "jeweler", "~> 1.5.2"
- gem "rspec", ">= 2.3.0"
+ gem "bundler", "~> 1.1.5"
+ gem "jeweler", "~> 1.8.3"
+ gem "rspec", ">= 2.10.0"
+ gem "regressiontest"
end
View
@@ -1,36 +1,51 @@
GEM
remote: http://rubygems.org/
specs:
- bio (1.4.1)
+ activesupport (3.2.7)
+ i18n (~> 0.6)
+ multi_json (~> 1.0)
+ bio (1.4.2)
bio-logger (1.0.0)
log4r (>= 1.1.9)
- diff-lcs (1.1.2)
+ diff-lcs (1.1.3)
git (1.2.5)
- jeweler (1.5.2)
- bundler (~> 1.0.0)
+ i18n (0.6.0)
+ jeweler (1.8.4)
+ bundler (~> 1.0)
git (>= 1.2.5)
rake
- log4r (1.1.9)
- rake (0.9.2)
- rspec (2.6.0)
- rspec-core (~> 2.6.0)
- rspec-expectations (~> 2.6.0)
- rspec-mocks (~> 2.6.0)
- rspec-core (2.6.4)
- rspec-expectations (2.6.0)
- diff-lcs (~> 1.1.2)
- rspec-mocks (2.6.0)
- shoulda (2.11.3)
+ rdoc
+ json (1.7.4)
+ log4r (1.1.10)
+ multi_json (1.3.6)
+ rake (0.9.2.2)
+ rdoc (3.12)
+ json (~> 1.4)
+ regressiontest (0.0.1)
+ rspec (2.10.0)
+ rspec-core (~> 2.10.0)
+ rspec-expectations (~> 2.10.0)
+ rspec-mocks (~> 2.10.0)
+ rspec-core (2.10.1)
+ rspec-expectations (2.10.0)
+ diff-lcs (~> 1.1.3)
+ rspec-mocks (2.10.1)
+ shoulda (3.1.1)
+ shoulda-context (~> 1.0)
+ shoulda-matchers (~> 1.2)
+ shoulda-context (1.0.0)
+ shoulda-matchers (1.2.0)
+ activesupport (>= 3.0.0)
PLATFORMS
ruby
DEPENDENCIES
bio (>= 1.3.1)
bio-logger (> 0.8.0)
- bundler (~> 1.0.0)
- jeweler (~> 1.5.2)
+ bundler (~> 1.1.5)
+ jeweler (~> 1.8.3)
log4r (> 1.1.6)
- rake
- rspec (>= 2.3.0)
+ regressiontest
+ rspec (>= 2.10.0)
shoulda
View
@@ -5,11 +5,11 @@
Gem::Specification.new do |s|
s.name = "bio-gff3"
- s.version = "0.8.8"
+ s.version = "0.8.9"
s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version=
s.authors = ["Pjotr Prins"]
- s.date = "2012-02-24"
+ s.date = "2012-08-10"
s.description = "GFF3 (genome browser) information and digest mRNA and CDS sequences.\nOptions for low memory use and caching of records.\nSupport for external FASTA files.\n"
s.email = "pjotr.prins@thebird.nl"
s.executables = ["gff3-fetch"]
@@ -57,6 +57,8 @@ Gem::Specification.new do |s|
"test/data/gff/MhA1_Contig1133.gff3",
"test/data/gff/MhA1_Contig125.fa",
"test/data/gff/MhA1_Contig125.gff3",
+ "test/data/gff/m_hapla.WS232.annotations.part.gff3",
+ "test/data/gff/m_hapla.WS232.genomic.part.fa",
"test/data/gff/standard.gff3",
"test/data/gff/test-cds.gff3",
"test/data/gff/test-ext-fasta.fa",
@@ -77,17 +79,6 @@ Gem::Specification.new do |s|
s.require_paths = ["lib"]
s.rubygems_version = "1.8.10"
s.summary = "GFF3 parser for big data"
- s.test_files = [
- "spec/gff3_assemble2_spec.rb",
- "spec/gff3_assemble3_spec.rb",
- "spec/gff3_assemble_spec.rb",
- "spec/gff3_fileiterator_spec.rb",
- "spec/gffdb_spec.rb",
- "spec/gffparserec.rb",
- "test/helper.rb",
- "test/regressiontest.rb",
- "test/test_bio-gff3.rb"
- ]
if s.respond_to? :specification_version then
s.specification_version = 3
@@ -96,29 +87,26 @@ Gem::Specification.new do |s|
s.add_runtime_dependency(%q<bio>, [">= 1.3.1"])
s.add_runtime_dependency(%q<log4r>, ["> 1.1.6"])
s.add_runtime_dependency(%q<bio-logger>, ["> 0.8.0"])
- s.add_development_dependency(%q<rake>, [">= 0"])
s.add_development_dependency(%q<shoulda>, [">= 0"])
- s.add_development_dependency(%q<bundler>, ["~> 1.0.0"])
- s.add_development_dependency(%q<jeweler>, ["~> 1.5.2"])
+ s.add_development_dependency(%q<bundler>, ["~> 1.1.5"])
+ s.add_development_dependency(%q<jeweler>, ["~> 1.8.3"])
s.add_development_dependency(%q<rspec>, [">= 2.3.0"])
else
s.add_dependency(%q<bio>, [">= 1.3.1"])
s.add_dependency(%q<log4r>, ["> 1.1.6"])
s.add_dependency(%q<bio-logger>, ["> 0.8.0"])
- s.add_dependency(%q<rake>, [">= 0"])
s.add_dependency(%q<shoulda>, [">= 0"])
- s.add_dependency(%q<bundler>, ["~> 1.0.0"])
- s.add_dependency(%q<jeweler>, ["~> 1.5.2"])
+ s.add_dependency(%q<bundler>, ["~> 1.1.5"])
+ s.add_dependency(%q<jeweler>, ["~> 1.8.3"])
s.add_dependency(%q<rspec>, [">= 2.3.0"])
end
else
s.add_dependency(%q<bio>, [">= 1.3.1"])
s.add_dependency(%q<log4r>, ["> 1.1.6"])
s.add_dependency(%q<bio-logger>, ["> 0.8.0"])
- s.add_dependency(%q<rake>, [">= 0"])
s.add_dependency(%q<shoulda>, [">= 0"])
- s.add_dependency(%q<bundler>, ["~> 1.0.0"])
- s.add_dependency(%q<jeweler>, ["~> 1.5.2"])
+ s.add_dependency(%q<bundler>, ["~> 1.1.5"])
+ s.add_dependency(%q<jeweler>, ["~> 1.8.3"])
s.add_dependency(%q<rspec>, [">= 2.3.0"])
end
end
@@ -131,7 +131,7 @@ def each_mRNA_seq
def each_CDS_seq
each_CDS do | id, reclist, component |
if component
- p id,reclist,component
+ # p id,reclist,component
sequence = @sequencelist[component.seqname]
# p sequence
if sequence
@@ -41,16 +41,16 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing2>
INFO bio-gff3: find_component: Matched seqname <test01>
->mrna01a Sequence:test01_1:400 (101:280)
-TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
- INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01short Sequence:test01_1:400 (3:14)
GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>mrna01 Sequence:test01_1:400 (101:230)
TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTC
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
+ INFO bio-gff3: find_component: Matched seqname <test01>
+>mrna01a Sequence:test01_1:400 (101:280)
+TATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
@@ -43,9 +43,10 @@
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds1> <>
INFO bio-gff3: Adding CDS <cds2> <>
- INFO bio-gff3: find_component: Matched seqname <test01>
->cds2 Sequence:test01_1:400 (192:200)
-TTCATGGGC
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
+ WARN bio-gff3: No sequence information for <Transcript:trans-1>
+ INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
+ WARN bio-gff3: No sequence information for <mRNA:trans-8>
INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
WARN bio-gff3: No sequence information for <Misc:thing3>
INFO bio-gff3: find_component: Matched seqname <test01>
@@ -54,7 +55,6 @@ GAAGATTTGTAT
INFO bio-gff3: find_component: Matched seqname <test01>
>cds1 Sequence:test01_1:400 (164:190, 192:200)
TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
- WARN bio-gff3: No sequence information for <mRNA:trans-8>
- INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
- WARN bio-gff3: No sequence information for <Transcript:trans-1>
+ INFO bio-gff3: find_component: Matched seqname <test01>
+>cds2 Sequence:test01_1:400 (192:200)
+TTCATGGGC
Oops, something went wrong.

0 comments on commit dedcbea

Please sign in to comment.