Block or report user

Report or block pmenzel

Hide content and notifications from this user.

Contact Support about this user’s behavior.

Report abuse

Pinned repositories

  1. bioinformatics-centre/kaiju

    Fast taxonomic classification of metagenomic sequencing reads using a protein reference database

    C 73 24

  2. RILogo

    Visualising RNA-RNA interactions

    C++ 1

  3. packCircles

    C program for space-efficiently packing circles on a plane.

    C 5 1

  4. stranded-coverage

    Convert bam to two wig files with strand-specific coverage

    C 2

  5. jsearch


  6. ksearch

    K-mer counting and indexing in RNA-Seq data sets.


111 contributions in 2018

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Mon Wed Fri

Contribution activity

September 2018

Created an issue in pmenzel/ksearch that received 1 comment

need better json error handling upon querying non-existant k-mers

Currently the output is this { "query" : "TACCAGAAGTCTAGCGAAACTGGCCCCCATTA", "SRRlist" : [ K-mer TACCAGAAGTCTAGCGAAACTGGCCCCCATTA was not found in …

1 comment

Seeing something unexpected? Take a look at the GitHub profile guide.