Permalink
Switch branches/tags
Nothing to show
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
64 lines (47 sloc) 4.88 KB

Python 5 - Dictionaries and Sets - Problem Set

  1. Write a script in which you construct a dictionary of your favorite things.

Some of my favorites:

Type Favorite
book Jitterbug Perfume
song Tom Petty - I Won't Back Down
tree Cedar
  1. Print out your favorite book.
print(fav_dict['book'])
  1. Print out your favorite book but use a variable in the key.
fav_thing = 'book'
print(fav_dict[fav_thing])
  1. Now print your favorite tree.

  2. Add your favorite 'organism' to the dictionary. Make organism the new value of fav_thing

fav_thing = 'organism'
print(fav_dict[fav_thing])
  1. Take a value from the command line for fav_thing and print the value of that item from the dictionary. Maybe you want to print out all the keys to the user so that they know what to pick from. Check out input(). Here is a link.

  2. Change the value of your favorite organism.

  3. Get the fav_thing from the command line and a new value for that key. Change the value with the user inputted value.

  4. Use a for loop to print out each key and value of the dictionary.

  5. Write a script to find the intersection, difference, union, and symetrical difference between these two sets.

Set A = 3 14 15 9 26 5 35 9
Set B = 60 22 14 0 9
  1. If you create a set using a DNA sequence, what will you get back? Try it with this sequence:
GATGGGATTGGGGTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTGGATTGGCAGCCAGACTGCCTTCCGGGTCACTGCCATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATTCGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGTGGGGTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTGGATTGGCAGCCAGACTGCCTTCCGGGTCACTGCCATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATTCGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGAC
  1. Nucleotide Composition. Write a script that:
  • determines the unique characters in this sequence
GAACTCCAAAAATGAAAACATAGTAGCAATCAAAGCATCCCACTATTTTTTGTCTCTCGTTTCATTAGCGTTGTAAATTACTGATACCCTACTATACCTCTACAAGGCCTTTGTCATCTTTTTACTCAAGTGTGAAATCATCACTTATTGTATGAAGGATGAGCTTTCCGTTCGCTAGTTTGCTGAAAAGGCCTTCTGCAATAAGCTCTCTATTATCTTTAAAAAAACCTGGTTCCTGGTCTTCCATTCTGCTAAAAGCTGTAGGGGTTTTATCACGAGATTCCCGTTGGCATTCTGACTTATTAAAAATGCTTACAGAAGAAATGGATTCTTTAAATGGTCAAATTAATACGTGGACAGATAATAATCCTTTATTAGATGAAATTACGAAGCCATACAGAAAATCTTCAACTCGTTTTTTTCATCCGCTTCTTGTACTTCTAATGTCTAGAGCATCAGTAAATGGGGATCCACCGAGTCAGCAACTATTTCAAAGGTACAAACAACTTGCCCGTGTAACAGAATTGATTCATGCTGCCAATATAATTCATATTAATATTGGAGAAGAACAAAGCAACGAACAGATTAAACTTGCAACGTTGGTTGGAGATTATTTACTCGGAAAGGCGTCTGTTGATTTAGCACATTTAGAAAACAACGCTATTACAGAAATTATGGCTTCTGTTATTGCAAACTTAGTTGAAGGGCACTTCGGAAGCCGACAAAATGGCTCTGTTGGTTTGTCAAACGAACGAACCATCCTTCTGCAATCAGCCTTTATGCCAGCAAAGGCATGTTTATGCGCAAGCATATTGAATAACTCATCACAATACATTAATGATGCGTGTTTCAATTATGGAAAATTTCTAGGCTTATCGCTGCAACTGGCCCATAAGCCTGTATCTCCTGACGCCCAAGTTTTGCAAAAGAATAATGACATTTTGAAAACATATGTTGAGAATGCCAAGAGCTCATTGTCTGTTTTCCCCGATATAGAGGCTAAGCAAGCTCTCATGGAAATCGCTAATAGTGTTTCGAAGTAATCGACAGGTATTGTATCCTGGATTAATATTAGGGTGGCTCATGCATGCTCGTGCAATCGTAACAAATATGTCTTTCTTTTACGAATTTTAACGCTTCAATATAAATCATATTTTTCCTCA
  • iterate over each unique character and count the number found in the sequence
  • store each count in a dictionary. example: nt_comp['A']=2
  • when you are done counting each character calculate and report the nucleotide composition and the GC content.
  1. Are you still committing your work?