Skip to content
Switch branches/tags
Go to file
Cannot retrieve contributors at this time

Python 10 - Functions - Problem Set

  1. Create a function to format a string of DNA so that each line is no more than 60 nt long. Your function will:
    • INPUT: a string of DNA without newlines
    • OUTPUT: a string of DNA with lines no more than 60 nucleoties long

  1. Modify your function so that it will work whether the DNA string does or does not have newlines.

  1. Modify your function so that it takes two arguments, the DNA string and the max length of each line.
width = 80

  1. Modify your script so that it can take two command line arguments:

    1. FASTA file name
    2. Max length of each line

    The script should reformat every sequence in the file to the specified max line length. Make sure your output is in proper FASTA format.

  2. Create a new function that calculates the GC content of a DNA sequence.

    • it will take a DNA sequence without spaces and no header as an argument and return the percentage of nucleotides that are a G or C.
    • example percentGC = gc_conent('CGTGCTTTCCACGACGGTGACACGCTTCCCTGGA') or percentGC = gc_content(dna)
  3. Create a new function that computes and returns the reverse complement of a sequence

    • it will take a DNA sequence without spaces and no header as an argument and return the reverse complement, with no spaces and no header.
    • example revComp_sequence = get_reverse_complement(dna)
  4. Pipelines:
    a. Create a script that runs a command with
    b. Check the exit status
    c. If exit status is good, run a second command.