Permalink
Browse files

Added, test data for split_fasta_on_sample_ids

  • Loading branch information...
1 parent adcb97b commit a664df57272a50ca89f5b479e2c836711eaa26f3 @ElDeveloper ElDeveloper committed Oct 16, 2012
View
2 split_fasta_on_sample_ids/out/S1.fasta
@@ -0,0 +1,2 @@
+>S1
+ATACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCG
View
2 split_fasta_on_sample_ids/out/S2.fasta
@@ -0,0 +1,2 @@
+>S2
+ATACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCG
View
2 split_fasta_on_sample_ids/out/S3.fasta
@@ -0,0 +1,2 @@
+>S3
+ATACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCG
View
2 split_fasta_on_sample_ids/out/S4.fasta
@@ -0,0 +1,2 @@
+>S4
+CGTTGAGAGAGAGGGGGGCGAGCGTTATCCGGATTCAG
View
2 split_fasta_on_sample_ids/out/S5.fasta
@@ -0,0 +1,2 @@
+>S5
+AACGACGACGACGAGGGGCGAGCGTTATCCGGATTCAC
View
2 split_fasta_on_sample_ids/out/S6.fasta
@@ -0,0 +1,2 @@
+>S6
+TGGGGGGTAGAGAGGGTCACGTCTGCTGTGGAAACGCA
View
12 split_fasta_on_sample_ids/seqs.fna
@@ -0,0 +1,12 @@
+>S1
+ATACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCG
+>S2
+ATACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCG
+>S3
+ATACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCG
+>S4
+CGTTGAGAGAGAGGGGGGCGAGCGTTATCCGGATTCAG
+>S5
+AACGACGACGACGAGGGGCGAGCGTTATCCGGATTCAC
+>S6
+TGGGGGGTAGAGAGGGTCACGTCTGCTGTGGAAACGCA

0 comments on commit a664df5

Please sign in to comment.