notebooks/qiime2-protocol-CLI.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# QIIME 2 enables comprehensive end-to-end analysis of diverse microbiome data and comparative studies with publicly available data\n",
    "\n",
    "this is a QIIME 2 Artifact CLI notebook which replicated analyses in the QIIME 2 protocol\n",
    "\n",
    "**environment:** qiime2-2019.10"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## How to use this notebook:"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "1. Activate the `qiime2-2019.10` conda environment.\n",
    "    ```\n",
    "    conda activate qiime2-2019.10\n",
    "    ```\n",
    "      \n",
    "2. Install additional dependencies:\n",
    "    ```\n",
    "    conda install songbird -c conda-forge\n",
    "    conda install -c conda-forge redbiom\n",
    "    conda install -c bioconda bowtie2\n",
    "    pip install https://github.com/knights-lab/SHOGUN/archive/master.zip\n",
    "    pip install https://github.com/qiime2/q2-shogun/archive/master.zip\n",
    "    conda install cytoolz\n",
    "    qiime dev refresh-cache\n",
    "    ```  \n",
    "\n",
    "3. Restart and run the notebook"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "## Hide excessive warnings (optional):\n",
    "import warnings\n",
    "warnings.filterwarnings('ignore')"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Acquire data from ECAM study "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [],
   "source": [
    "!mkdir qiime2-ecam-tutorial"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [],
   "source": [
    "!cd qiime2-ecam-tutorial"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 14:21:06--  https://qiita.ucsd.edu/public_artifact_download/?artifact_id=81253\n",
      "Resolving qiita.ucsd.edu... 169.228.46.38\n",
      "Connecting to qiita.ucsd.edu|169.228.46.38|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 1116152564 (1.0G) [application/zip]\n",
      "Saving to: ‘81253.zip’\n",
      "\n",
      "81253.zip           100%[===================>]   1.04G  3.47MB/s    in 5m 6s   \n",
      "\n",
      "2020-01-14 14:26:13 (3.47 MB/s) - ‘81253.zip’ saved [1116152564/1116152564]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!wget -O 81253.zip \"https://qiita.ucsd.edu/public_artifact_download/?artifact_id=81253\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Archive:  81253.zip\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.01SS.r.fastq.gz   bad CRC 408b78ca  (should be 82882250)\n",
      " extracting: per_sample_FASTQ/81253/10249.C030.01SS.r.fastq.gz   bad CRC 2746113c  (should be 58903356)\n",
      " extracting: per_sample_FASTQ/81253/10249.C031.01SS.r.fastq.gz   bad CRC 32768cb1  (should be 46630065)\n",
      " extracting: per_sample_FASTQ/81253/10249.C022.01SS.r.fastq.gz   bad CRC c9d8e76c  (should be 86435436)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.01SS.r.fastq.gz   bad CRC 56f95c51  (should be 59182673)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.01SS.r.fastq.gz   bad CRC 549966a6  (should be 19339430)\n",
      " extracting: per_sample_FASTQ/81253/10249.C043.01SS.r.fastq.gz   bad CRC 7da85b6d  (should be 08185453)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.01SS.r.fastq.gz   bad CRC 045eb75a  (should be 73316186)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.01SS.r.fastq.gz   bad CRC 4dff8d5c  (should be 08593500)\n",
      " extracting: per_sample_FASTQ/81253/10249.C023.01SS.r.fastq.gz   bad CRC bcb0f106  (should be 65712646)\n",
      " extracting: per_sample_FASTQ/81253/10249.C005.01SS.r.fastq.gz   bad CRC db14f17f  (should be 75582847)\n",
      " extracting: per_sample_FASTQ/81253/10249.C042.01SS.r.fastq.gz   bad CRC f2396ac3  (should be 63849155)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.01SS.r.fastq.gz   bad CRC fd89dfab  (should be 53671339)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.01SS.r.fastq.gz   bad CRC 31e1259e  (should be 36838814)\n",
      " extracting: per_sample_FASTQ/81253/10249.C041.01SS.r.fastq.gz   bad CRC 568c3c6d  (should be 52031085)\n",
      " extracting: per_sample_FASTQ/81253/10249.C027.01SS.r.fastq.gz   bad CRC 523c1166  (should be 79668326)\n",
      " extracting: per_sample_FASTQ/81253/10249.C033.01SS.r.fastq.gz   bad CRC 379d6a18  (should be 33063192)\n",
      " extracting: per_sample_FASTQ/81253/10249.C017.01SS.r.fastq.gz   bad CRC 1ffc1cc3  (should be 36616131)\n",
      " extracting: per_sample_FASTQ/81253/10249.C038.01SS.r.fastq.gz   bad CRC c245f596  (should be 59364758)\n",
      " extracting: per_sample_FASTQ/81253/10249.C037.01SS.r.fastq.gz   bad CRC 1bd8e503  (should be 67199235)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.01SS.r.fastq.gz   bad CRC 2723be5e  (should be 56653918)\n",
      " extracting: per_sample_FASTQ/81253/10249.C036.01SS.r.fastq.gz   bad CRC 0efa3d37  (should be 51280695)\n",
      " extracting: per_sample_FASTQ/81253/10249.C024.01SS.r.fastq.gz   bad CRC 189c7ae9  (should be 12908265)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.20SS.fastq.gz   bad CRC d26bb69d  (should be 30274461)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.02SS.fastq.gz   bad CRC 12e7be28  (should be 17177384)\n",
      " extracting: per_sample_FASTQ/81253/10249.C005.14SS.fastq.gz   bad CRC 3a1edd74  (should be 75101300)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.12SS.fastq.gz   bad CRC c7b4abe9  (should be 50506473)\n",
      " extracting: per_sample_FASTQ/81253/10249.C033.06SS.fastq.gz   bad CRC 0370c0b3  (should be 57721011)\n",
      " extracting: per_sample_FASTQ/81253/10249.C052.08SS.fastq.gz   bad CRC 14d2b973  (should be 49354355)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.01SS.fastq.gz   bad CRC 710e4eb3  (should be 96763059)\n",
      " extracting: per_sample_FASTQ/81253/10249.C047.08SS.fastq.gz   bad CRC e8312b25  (should be 95536421)\n",
      " extracting: per_sample_FASTQ/81253/10249.C011.01SS.fastq.gz   bad CRC 66f3186a  (should be 27207530)\n",
      " extracting: per_sample_FASTQ/81253/10249.M027.01SS.fastq.gz   bad CRC 59f4896e  (should be 09198190)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.22SD.fastq.gz   bad CRC 13361fb9  (should be 22314169)\n",
      " extracting: per_sample_FASTQ/81253/10249.C011.06SS.fastq.gz   bad CRC 05f28f58  (should be 99782488)\n",
      " extracting: per_sample_FASTQ/81253/10249.C027.01SS.fastq.gz   bad CRC c7adf6c4  (should be 50066884)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.01SS.fastq.gz   bad CRC 670c4b90  (should be 28859024)\n",
      " extracting: per_sample_FASTQ/81253/10249.C005.20SS.fastq.gz   bad CRC 260bb174  (should be 38300532)\n",
      " extracting: per_sample_FASTQ/81253/10249.C022.19SS.fastq.gz   bad CRC b8282835  (should be 89639477)\n",
      " extracting: per_sample_FASTQ/81253/10249.C024.15SS.fastq.gz   bad CRC 1c9d362c  (should be 80065068)\n",
      " extracting: per_sample_FASTQ/81253/10249.C030.08SS.fastq.gz   bad CRC 9a8d41d7  (should be 92948695)\n",
      " extracting: per_sample_FASTQ/81253/10249.C033.14SS.fastq.gz   bad CRC e0643941  (should be 64664641)\n",
      " extracting: per_sample_FASTQ/81253/10249.C049.01SS.fastq.gz   bad CRC 9adad036  (should be 98031414)\n",
      " extracting: per_sample_FASTQ/81253/10249.C041.01SS.fastq.gz   bad CRC 9c8cd115  (should be 26474261)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.20SS.fastq.gz   bad CRC fd6e1b5c  (should be 51851612)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.01SS.fastq.gz   bad CRC f5a21178  (should be 21039224)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.07SD.fastq.gz   bad CRC 4c359daf  (should be 78582191)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.01SS.fastq.gz   bad CRC 5fc29354  (should be 06587220)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.01SS.fastq.gz   bad CRC b27f74ce  (should be 94697422)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.02SS.fastq.gz   bad CRC 8fa5756e  (should be 09985390)\n",
      " extracting: per_sample_FASTQ/81253/10249.C022.01SS.fastq.gz   bad CRC 3cb2ccbe  (should be 18350782)\n",
      " extracting: per_sample_FASTQ/81253/10249.C032.22SS.fastq.gz   bad CRC e2ba4414  (should be 03857940)\n",
      " extracting: per_sample_FASTQ/81253/10249.M045.02SS.fastq.gz   bad CRC f0530612  (should be 31972882)\n",
      " extracting: per_sample_FASTQ/81253/10249.C008.12SS.fastq.gz   bad CRC f29b479a  (should be 70262682)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.01SD.fastq.gz   bad CRC 955f7d67  (should be 06063207)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.01SS.fastq.gz   bad CRC 85b0db4f  (should be 42960207)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.01SS.fastq.gz   bad CRC f76ac911  (should be 50970641)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.02SS.fastq.gz   bad CRC e29a1ebb  (should be 01751227)\n",
      " extracting: per_sample_FASTQ/81253/10249.C011.12SS.fastq.gz   bad CRC 86686472  (should be 54988402)\n",
      " extracting: per_sample_FASTQ/81253/10249.M050.01SS.fastq.gz   bad CRC e4a1a81e  (should be 35799582)\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.12SD.fastq.gz   bad CRC 4b52a318  (should be 63706904)\n",
      " extracting: per_sample_FASTQ/81253/10249.C009.01SS.fastq.gz   bad CRC a001036d  (should be 84420973)\n",
      " extracting: per_sample_FASTQ/81253/10249.C022.13SS.fastq.gz   bad CRC a89cf0c9  (should be 28857545)\n",
      " extracting: per_sample_FASTQ/81253/10249.C038.14SS.fastq.gz   bad CRC 53162008  (should be 93958920)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.07SS.fastq.gz   bad CRC 30592a01  (should be 11149825)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.01SD.fastq.gz   bad CRC adac587c  (should be 13753212)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.20SD.fastq.gz   bad CRC 251b5359  (should be 22547801)\n",
      " extracting: per_sample_FASTQ/81253/10249.C008.07SS.fastq.gz   bad CRC 845d2d4e  (should be 20698958)\n",
      " extracting: per_sample_FASTQ/81253/10249.C049.02SD.fastq.gz   bad CRC 87b51589  (should be 76791689)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.08SS.fastq.gz   bad CRC 45e219b5  (should be 72445621)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.18SS.fastq.gz   bad CRC d8dbac28  (should be 38275112)\n",
      " extracting: per_sample_FASTQ/81253/10249.C009.19SS.fastq.gz   bad CRC fcaf672c  (should be 39353644)\n",
      " extracting: per_sample_FASTQ/81253/10249.C021.10SS.fastq.gz   bad CRC f3a47af5  (should be 87642869)\n",
      " extracting: per_sample_FASTQ/81253/10249.C049.02SS.fastq.gz   bad CRC 0eac2ad1  (should be 46164177)\n",
      " extracting: per_sample_FASTQ/81253/10249.C055.01SS.fastq.gz   bad CRC 0c37eaf1  (should be 04991217)\n",
      " extracting: per_sample_FASTQ/81253/10249.C041.08SS.fastq.gz   bad CRC d99ba828  (should be 50857000)\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.06SS.fastq.gz   bad CRC f670ac45  (should be 34579269)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.13SS.fastq.gz   bad CRC 28acbbb4  (should be 82408884)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.01SS.fastq.gz   bad CRC de8e957b  (should be 33886331)\n",
      " extracting: per_sample_FASTQ/81253/10249.C056.01SS.fastq.gz   bad CRC 3f3a4f06  (should be 60785926)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.01SS.fastq.gz   bad CRC da0acf02  (should be 58141442)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      " extracting: per_sample_FASTQ/81253/10249.C032.15SS.fastq.gz   bad CRC 3ce7b59f  (should be 21818271)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.01SS.fastq.gz   bad CRC 84748e24  (should be 22231076)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.01SS.fastq.gz   bad CRC 2c4f52b3  (should be 43396019)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.09SS.fastq.gz   bad CRC 0abe65e5  (should be 80250085)\n",
      " extracting: per_sample_FASTQ/81253/10249.C044.01SS.fastq.gz   bad CRC d1cd7637  (should be 19903287)\n",
      " extracting: per_sample_FASTQ/81253/10249.C007.23SD.fastq.gz   bad CRC 73c8d981  (should be 42542721)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.20SD.fastq.gz   bad CRC 09912103  (should be 60506115)\n",
      " extracting: per_sample_FASTQ/81253/10249.C049.09SS.fastq.gz   bad CRC 804ee66f  (should be 52654447)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.01SS.fastq.gz   bad CRC 46ceef24  (should be 87966756)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.01SS.fastq.gz   bad CRC ac09ef79  (should be 86332281)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.01SS.fastq.gz   bad CRC e9a5064c  (should be 19906380)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.13SS.fastq.gz   bad CRC d4443743  (should be 61240387)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.14SD.fastq.gz   bad CRC 271e1ffd  (should be 56285693)\n",
      " extracting: per_sample_FASTQ/81253/10249.C004.15SS.fastq.gz   bad CRC 6949e92f  (should be 66451503)\n",
      " extracting: per_sample_FASTQ/81253/10249.C024.21SS.fastq.gz   bad CRC e57b8648  (should be 50077768)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.20SS.fastq.gz   bad CRC a0942601  (should be 94063617)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.01SS.fastq.gz   bad CRC 0d42475c  (should be 22447452)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.01SD.fastq.gz   bad CRC 905d22f4  (should be 22022900)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.21SS.fastq.gz   bad CRC a2e65061  (should be 33002849)\n",
      " extracting: per_sample_FASTQ/81253/10249.C007.01SS.fastq.gz   bad CRC 2e93e2d8  (should be 81443800)\n",
      " extracting: per_sample_FASTQ/81253/10249.C036.12SS.fastq.gz   bad CRC 697524e6  (should be 69284838)\n",
      " extracting: per_sample_FASTQ/81253/10249.C007.17SS.fastq.gz   bad CRC 34a6cbd5  (should be 83346389)\n",
      " extracting: per_sample_FASTQ/81253/10249.M002.01SS.fastq.gz   bad CRC 87e16f95  (should be 79698325)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.22SS.fastq.gz   bad CRC 9b62a401  (should be 06932993)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.22SS.fastq.gz   bad CRC a8f469d0  (should be 34590160)\n",
      " extracting: per_sample_FASTQ/81253/10249.C042.01SS.fastq.gz   bad CRC 4e082f8b  (should be 09159307)\n",
      " extracting: per_sample_FASTQ/81253/10249.C004.01SS.fastq.gz   bad CRC f833bfdd  (should be 64141021)\n",
      " extracting: per_sample_FASTQ/81253/10249.C011.19SS.fastq.gz   bad CRC 14c8c267  (should be 48701287)\n",
      " extracting: per_sample_FASTQ/81253/10249.C031.08SS.fastq.gz   bad CRC 5d56d086  (should be 65970566)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.01SS.fastq.gz   bad CRC 5b857092  (should be 35471762)\n",
      " extracting: per_sample_FASTQ/81253/10249.C030.01SS.fastq.gz   bad CRC b3abdf9a  (should be 14385562)\n",
      " extracting: per_sample_FASTQ/81253/10249.M020.01SS.fastq.gz   bad CRC 6e81f2b0  (should be 54010032)\n",
      " extracting: per_sample_FASTQ/81253/10249.C042.07SS.fastq.gz   bad CRC a2d10c08  (should be 31609096)\n",
      " extracting: per_sample_FASTQ/81253/10249.C008.01SS.fastq.gz   bad CRC e7f236b3  (should be 91410611)\n",
      " extracting: per_sample_FASTQ/81253/10249.C024.01SS.fastq.gz   bad CRC c8f9ccd7  (should be 71814103)\n",
      " extracting: per_sample_FASTQ/81253/10249.C008.06SS.fastq.gz   bad CRC 381ca4aa  (should be 41401258)\n",
      " extracting: per_sample_FASTQ/81253/10249.C053.08SS.fastq.gz   bad CRC a655dcbc  (should be 90644924)\n",
      " extracting: per_sample_FASTQ/81253/10249.C027.15SS.fastq.gz   bad CRC 77f98ee6  (should be 12843750)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.15SS.fastq.gz   bad CRC e152f095  (should be 80309141)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.09SS.fastq.gz   bad CRC 8845ff2f  (should be 86288687)\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.12SS.fastq.gz   bad CRC 2d5e974b  (should be 61173835)\n",
      " extracting: per_sample_FASTQ/81253/10249.C022.07SS.fastq.gz   bad CRC a52ae227  (should be 71051047)\n",
      " extracting: per_sample_FASTQ/81253/10249.C027.21SS.fastq.gz   bad CRC dc27f191  (should be 93605265)\n",
      " extracting: per_sample_FASTQ/81253/10249.C031.21SS.fastq.gz   bad CRC bcf15456  (should be 69932374)\n",
      " extracting: per_sample_FASTQ/81253/10249.C044.08SS.fastq.gz   bad CRC a6b8f578  (should be 97139320)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.01SS.fastq.gz   bad CRC 3b4941ee  (should be 94656750)\n",
      " extracting: per_sample_FASTQ/81253/10249.C038.01SS.fastq.gz   bad CRC 24494ddb  (should be 08783835)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.09SS.fastq.gz   bad CRC f789f045  (should be 53012293)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.01SS.fastq.gz   bad CRC 328ba464  (should be 48012388)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.01SD.fastq.gz   bad CRC 145e5940  (should be 41727552)\n",
      " extracting: per_sample_FASTQ/81253/10249.C043.07SS.fastq.gz   bad CRC 095e3260  (should be 57168224)\n",
      " extracting: per_sample_FASTQ/81253/10249.C031.14SS.fastq.gz   bad CRC ac8620ac  (should be 94471340)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.01SS.fastq.gz   bad CRC 6b58e468  (should be 00987752)\n",
      " extracting: per_sample_FASTQ/81253/10249.C034.08SS.fastq.gz   bad CRC 5040426d  (should be 46388589)\n",
      " extracting: per_sample_FASTQ/81253/10249.C045.13SS.fastq.gz   bad CRC dd1b4e06  (should be 09554182)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.19SS.fastq.gz   bad CRC e9cf0269  (should be 22657897)\n",
      " extracting: per_sample_FASTQ/81253/10249.C017.02SS.fastq.gz   bad CRC 623c738f  (should be 48128911)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.01SS.fastq.gz   bad CRC f2099d7a  (should be 60716410)\n",
      " extracting: per_sample_FASTQ/81253/10249.C038.08SS.fastq.gz   bad CRC ddda2816  (should be 22061846)\n",
      " extracting: per_sample_FASTQ/81253/10249.C046.13SS.fastq.gz   bad CRC 87faa9c8  (should be 81351624)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.01SS.fastq.gz   bad CRC 897e5d88  (should be 06760072)\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.17SS.fastq.gz   bad CRC 446fe96b  (should be 48184939)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.19SS.fastq.gz   bad CRC 27d2102b  (should be 68078123)\n",
      " extracting: per_sample_FASTQ/81253/10249.C030.14SS.fastq.gz   bad CRC 2de86e8b  (should be 70207371)\n",
      " extracting: per_sample_FASTQ/81253/10249.C037.13SD.fastq.gz   bad CRC c3009c21  (should be 71597089)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.01SS.fastq.gz   bad CRC 32df0638  (should be 53476920)\n",
      " extracting: per_sample_FASTQ/81253/10249.C005.08SS.fastq.gz   bad CRC a38d026b  (should be 43927403)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.01SS.fastq.gz   bad CRC 34c8149e  (should be 85527710)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.19SD.fastq.gz   bad CRC d51aadb7  (should be 75295415)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.01SS.fastq.gz   bad CRC 26423087  (should be 41872007)\n",
      " extracting: per_sample_FASTQ/81253/10249.M032.01SS.fastq.gz   bad CRC 51bab958  (should be 71191640)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.10SS.fastq.gz   bad CRC 434de708  (should be 29178888)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.03SS.fastq.gz   bad CRC 37b6a068  (should be 34715496)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.03SS.fastq.gz   bad CRC 0a20b810  (should be 69916432)\n",
      " extracting: per_sample_FASTQ/81253/10249.C007.08SS.fastq.gz   bad CRC 8320cb15  (should be 99964437)\n",
      " extracting: per_sample_FASTQ/81253/10249.C042.13SS.fastq.gz   bad CRC ffa7ea5f  (should be 89194591)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.01SS.fastq.gz   bad CRC 23c8bf10  (should be 00358672)\n",
      " extracting: per_sample_FASTQ/81253/10249.C018.01SS.fastq.gz   bad CRC c29390c6  (should be 64450758)\n",
      " extracting: per_sample_FASTQ/81253/10249.C046.01SS.fastq.gz   bad CRC 32e08e65  (should be 53577317)\n",
      " extracting: per_sample_FASTQ/81253/10249.C017.01SS.fastq.gz   bad CRC 1af1fa34  (should be 52065844)\n",
      " extracting: per_sample_FASTQ/81253/10249.C043.14SS.fastq.gz   bad CRC a5f79811  (should be 84466961)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.01SS.fastq.gz   bad CRC 5bd97fab  (should be 40980651)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      " extracting: per_sample_FASTQ/81253/10249.C046.07SS.fastq.gz   bad CRC a5b95e82  (should be 80388994)\n",
      " extracting: per_sample_FASTQ/81253/10249.C037.01SS.fastq.gz   bad CRC fd345391  (should be 48064913)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.01SS.fastq.gz   bad CRC 51be6d84  (should be 71434372)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.34SD.fastq.gz   bad CRC 4691b47c  (should be 83954044)\n",
      " extracting: per_sample_FASTQ/81253/10249.M022.01SS.fastq.gz   bad CRC 0519cb82  (should be 85576578)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.01SS.fastq.gz   bad CRC 6f57a5bb  (should be 68015035)\n",
      " extracting: per_sample_FASTQ/81253/10249.C034.14SS.fastq.gz   bad CRC 62d2673d  (should be 57956157)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.01SS.fastq.gz   bad CRC 1c50bc17  (should be 75053079)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.08SS.fastq.gz   bad CRC b4b3fce0  (should be 31694560)\n",
      " extracting: per_sample_FASTQ/81253/10249.C043.01SS.fastq.gz   bad CRC 7561fe2e  (should be 69356334)\n",
      " extracting: per_sample_FASTQ/81253/10249.C037.13SS.fastq.gz   bad CRC 41b63665  (should be 02460517)\n",
      " extracting: per_sample_FASTQ/81253/10249.C012.21SD.fastq.gz   bad CRC 7ab72eba  (should be 58825402)\n",
      " extracting: per_sample_FASTQ/81253/10249.C021.02SS.fastq.gz   bad CRC ec961c10  (should be 69260560)\n",
      " extracting: per_sample_FASTQ/81253/10249.C033.01SS.fastq.gz   bad CRC a8782561  (should be 26446177)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.01SS.fastq.gz   bad CRC 532e1543  (should be 95529027)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.20SS.fastq.gz   bad CRC 68ea0cc6  (should be 60169158)\n",
      " extracting: per_sample_FASTQ/81253/10249.C056.09SS.fastq.gz   bad CRC 0f953dab  (should be 61438891)\n",
      " extracting: per_sample_FASTQ/81253/10249.C017.10SS.fastq.gz   bad CRC 725a5a15  (should be 18523925)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.05SS.fastq.gz   bad CRC a038aa66  (should be 88068198)\n",
      " extracting: per_sample_FASTQ/81253/10249.C027.07SS.fastq.gz   bad CRC e13d2bcb  (should be 78882507)\n",
      " extracting: per_sample_FASTQ/81253/10249.C046.07SD.fastq.gz   bad CRC 191b8ac3  (should be 21235395)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.07SS.fastq.gz   bad CRC 019a5c93  (should be 26893459)\n",
      " extracting: per_sample_FASTQ/81253/10249.C021.06SS.fastq.gz   bad CRC b3244ecf  (should be 05501135)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.15SS.fastq.gz   bad CRC 58239fa7  (should be 78729639)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.01SS.fastq.gz   bad CRC 35219a84  (should be 91394692)\n",
      " extracting: per_sample_FASTQ/81253/10249.C010.15SS.fastq.gz   bad CRC dabb361d  (should be 69702173)\n",
      " extracting: per_sample_FASTQ/81253/10249.C014.13SS.fastq.gz   bad CRC bb912880  (should be 46852480)\n",
      " extracting: per_sample_FASTQ/81253/10249.C032.01SS.fastq.gz   bad CRC e024761b  (should be 60485915)\n",
      " extracting: per_sample_FASTQ/81253/10249.M001.03SS.fastq.gz   bad CRC 86532048  (should be 53594696)\n",
      " extracting: per_sample_FASTQ/81253/10249.C024.09SS.fastq.gz   bad CRC 3a4e0b44  (should be 78193220)\n",
      " extracting: per_sample_FASTQ/81253/10249.C017.03SS.fastq.gz   bad CRC 638c61f9  (should be 70144505)\n",
      " extracting: per_sample_FASTQ/81253/10249.C055.08SS.fastq.gz   bad CRC 82be51f6  (should be 93510902)\n",
      " extracting: per_sample_FASTQ/81253/10249.C004.07SS.fastq.gz   bad CRC bae0c7e2  (should be 35293410)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.01SD.fastq.gz   bad CRC b9f13982  (should be 19593858)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.01SS.fastq.gz   bad CRC f32d5b01  (should be 79835905)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.01SS.fastq.gz   bad CRC 2fa26612  (should be 99172114)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.01SS.fastq.gz   bad CRC 912a9237  (should be 35486263)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.18SS.fastq.gz   bad CRC 19f3cded  (should be 35408365)\n",
      " extracting: per_sample_FASTQ/81253/10249.C035.13SD.fastq.gz   bad CRC 334adfec  (should be 60545004)\n",
      " extracting: per_sample_FASTQ/81253/10249.C011.19SD.fastq.gz   bad CRC 3575b629  (should be 96906793)\n",
      " extracting: per_sample_FASTQ/81253/10249.C049.09SD.fastq.gz   bad CRC b9443a5e  (should be 08256350)\n",
      " extracting: per_sample_FASTQ/81253/10249.C034.01SS.fastq.gz   bad CRC fcd17b53  (should be 41587027)\n",
      " extracting: per_sample_FASTQ/81253/10249.C031.01SS.fastq.gz   bad CRC 6255d2ae  (should be 49791662)\n",
      " extracting: per_sample_FASTQ/81253/10249.C036.01SS.fastq.gz   bad CRC e2428fb1  (should be 96012977)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.04SS.fastq.gz   bad CRC d9876ce5  (should be 49531109)\n",
      " extracting: per_sample_FASTQ/81253/10249.C034.07SS.fastq.gz   bad CRC 128902e4  (should be 10969060)\n",
      " extracting: per_sample_FASTQ/81253/10249.C023.01SS.fastq.gz   bad CRC 994b1625  (should be 71834917)\n",
      " extracting: per_sample_FASTQ/81253/10249.C009.07SS.fastq.gz   bad CRC 5fa0709d  (should be 04350109)\n",
      " extracting: per_sample_FASTQ/81253/10249.C007.23SS.fastq.gz   bad CRC bf17f18c  (should be 06017420)\n",
      " extracting: per_sample_FASTQ/81253/10249.C009.13SS.fastq.gz   bad CRC 7e538d08  (should be 19404808)\n",
      " extracting: per_sample_FASTQ/81253/10249.C016.22SD.fastq.gz   bad CRC e2d14920  (should be 05366560)\n",
      " extracting: per_sample_FASTQ/81253/10249.C002.01SS.fastq.gz   bad CRC 6820120e  (should be 46932238)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.01SS.fastq.gz   bad CRC e32f2f1d  (should be 11520285)\n",
      " extracting: per_sample_FASTQ/81253/10249.C020.04SS.fastq.gz   bad CRC 941eccdc  (should be 85046492)\n",
      " extracting: per_sample_FASTQ/81253/10249.C001.34SS.fastq.gz   bad CRC cdb0d6f7  (should be 50918647)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.01SS.fastq.gz   bad CRC c9bd9acb  (should be 84646347)\n",
      " extracting: per_sample_FASTQ/81253/10249.C045.01SS.fastq.gz   bad CRC c7d8a8be  (should be 52864958)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.01SS.fastq.gz   bad CRC 26f11185  (should be 53332869)\n",
      " extracting: per_sample_FASTQ/81253/10249.C025.14SS.fastq.gz   bad CRC 7e884173  (should be 22858867)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.01SS.fastq.gz   bad CRC 42bec520  (should be 19798560)\n",
      " extracting: per_sample_FASTQ/81253/10249.C021.01SS.fastq.gz   bad CRC 48e51010  (should be 22971408)\n",
      " extracting: per_sample_FASTQ/81253/10249.C052.02SS.fastq.gz   bad CRC cce57b96  (should be 37591446)\n",
      " extracting: per_sample_FASTQ/81253/10249.M045.01SS.fastq.gz   bad CRC ee476daf  (should be 97658543)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.01SS.fastq.gz   bad CRC 11ad9f1f  (should be 96591135)\n",
      " extracting: per_sample_FASTQ/81253/10249.C047.08SD.fastq.gz   bad CRC 0109cd46  (should be 17419590)\n",
      " extracting: per_sample_FASTQ/81253/10249.C056.02SS.fastq.gz   bad CRC 2cbf34c9  (should be 50728393)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.02SS.fastq.gz   bad CRC 8aef3574  (should be 30932596)\n",
      " extracting: per_sample_FASTQ/81253/10249.C005.01SS.fastq.gz   bad CRC 0daa4c01  (should be 29264385)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.02V.fastq.gz   bad CRC 79acd304  (should be 41369348)\n",
      " extracting: per_sample_FASTQ/81253/10249.M006.01R.fastq.gz   bad CRC d8e6232c  (should be 38960940)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.03R.fastq.gz   bad CRC a6f1500f  (should be 00832527)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.03V.fastq.gz   bad CRC 6d2f49fb  (should be 31815675)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.02V.fastq.gz   bad CRC 06ae0ba6  (should be 12069542)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.01V.fastq.gz   bad CRC 350aec70  (should be 89908336)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.03R.fastq.gz   bad CRC 1d569ee8  (should be 92216040)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.03R.fastq.gz   bad CRC 5ec21cac  (should be 89779628)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.01V.fastq.gz   bad CRC 79822f02  (should be 38574850)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.03V.fastq.gz   bad CRC 3f0015e1  (should be 56970209)\n",
      " extracting: per_sample_FASTQ/81253/10249.M026.01R.fastq.gz   bad CRC 470d5eac  (should be 92058540)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.01R.fastq.gz   bad CRC b010e7e2  (should be 53897954)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.03R.fastq.gz   bad CRC b9bf7015  (should be 16331029)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.02R.fastq.gz   bad CRC ff2f6f58  (should be 81298776)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      " extracting: per_sample_FASTQ/81253/10249.M001.03R.fastq.gz   bad CRC 15859c19  (should be 61077785)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.03V.fastq.gz   bad CRC 5e2b2c4d  (should be 79887693)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.03R.fastq.gz   bad CRC 515cc2f1  (should be 65033713)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.03V.fastq.gz   bad CRC 27ac7c08  (should be 65615368)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.03V.fastq.gz   bad CRC 6ff40f29  (should be 78265641)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.02V.fastq.gz   bad CRC 4c6c16ce  (should be 82152142)\n",
      " extracting: per_sample_FASTQ/81253/10249.M050.01V.fastq.gz   bad CRC 88668210  (should be 88419344)\n",
      " extracting: per_sample_FASTQ/81253/10249.M019.02V.fastq.gz   bad CRC 329e2b45  (should be 49226565)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.02V.fastq.gz   bad CRC c84e0bf6  (should be 60558070)\n",
      " extracting: per_sample_FASTQ/81253/10249.M001.04V.fastq.gz   bad CRC b5485300  (should be 41415936)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.01R.fastq.gz   bad CRC f920e693  (should be 79682963)\n",
      " extracting: per_sample_FASTQ/81253/10249.M022.02R.fastq.gz   bad CRC 797a8783  (should be 38073219)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.01R.fastq.gz   bad CRC 49571e41  (should be 30446145)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.02R.fastq.gz   bad CRC a7bccd78  (should be 14168440)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.03R.fastq.gz   bad CRC 8ef45b2a  (should be 98378794)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.02V.fastq.gz   bad CRC 0fc2d4d5  (should be 64426709)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.02R.fastq.gz   bad CRC 38f536bc  (should be 55594428)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.01R.fastq.gz   bad CRC 01e2899a  (should be 31623578)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.02R.fastq.gz   bad CRC b25a39a6  (should be 92257446)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.03V.fastq.gz   bad CRC 4357a2c7  (should be 29816775)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.03R.fastq.gz   bad CRC 9521e675  (should be 02026869)\n",
      " extracting: per_sample_FASTQ/81253/10249.M020.02V.fastq.gz   bad CRC 67437b88  (should be 32475784)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.03V.fastq.gz   bad CRC 53cf1e48  (should be 06082632)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.01V.fastq.gz   bad CRC b895e9ea  (should be 96832490)\n",
      " extracting: per_sample_FASTQ/81253/10249.M022.01V.fastq.gz   bad CRC f9d0806b  (should be 91191147)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.02V.fastq.gz   bad CRC 65d32575  (should be 08336501)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.01V.fastq.gz   bad CRC c0677bd9  (should be 28007385)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.02V.fastq.gz   bad CRC 89f5f18c  (should be 14596748)\n",
      " extracting: per_sample_FASTQ/81253/10249.M026.02V.fastq.gz   bad CRC bf11a132  (should be 05603634)\n",
      " extracting: per_sample_FASTQ/81253/10249.M022.01R.fastq.gz   bad CRC c4de8926  (should be 02918438)\n",
      " extracting: per_sample_FASTQ/81253/10249.M032.01R.fastq.gz   bad CRC 0c9aced0  (should be 11472080)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.01V.fastq.gz   bad CRC 5954a401  (should be 98719233)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.02R.fastq.gz   bad CRC 970f7471  (should be 34372465)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.02V.fastq.gz   bad CRC 7eab47c8  (should be 25154248)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.03V.fastq.gz   bad CRC 2814b249  (should be 72445001)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.02R.fastq.gz   bad CRC 5e509196  (should be 82338454)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.02R.fastq.gz   bad CRC 1c5878fa  (should be 75560186)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.01V.fastq.gz   bad CRC 11851b72  (should be 93935986)\n",
      " extracting: per_sample_FASTQ/81253/10249.M045.02V.fastq.gz   bad CRC 4dab0b78  (should be 03055224)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.03V.fastq.gz   bad CRC 3e53378c  (should be 45641100)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.03V.fastq.gz   bad CRC 0718b4aa  (should be 19059626)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.01R.fastq.gz   bad CRC c426f210  (should be 90886672)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.03R.fastq.gz   bad CRC 3b48b140  (should be 94619712)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.03V.fastq.gz   bad CRC bd098acc  (should be 71519180)\n",
      " extracting: per_sample_FASTQ/81253/10249.M050.02R.fastq.gz   bad CRC b427c48a  (should be 22505098)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.01V.fastq.gz   bad CRC 7799b87b  (should be 06562939)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.02R.fastq.gz   bad CRC a7ddf295  (should be 16340629)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.03R.fastq.gz   bad CRC a4e4edc4  (should be 66466500)\n",
      " extracting: per_sample_FASTQ/81253/10249.M001.05R.fastq.gz   bad CRC 14ee1584  (should be 51147396)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.01V.fastq.gz   bad CRC 6f7e233a  (should be 70537530)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.03R.fastq.gz   bad CRC d319fb11  (should be 41695249)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.01V.fastq.gz   bad CRC 40cf3524  (should be 87321380)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.03V.fastq.gz   bad CRC b5b5be73  (should be 48586867)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.03R.fastq.gz   bad CRC 3fc4d86d  (should be 69865069)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.01R.fastq.gz   bad CRC 8aa24370  (should be 25889904)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.02V.fastq.gz   bad CRC 46ebd781  (should be 89861249)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.03R.fastq.gz   bad CRC 844b6010  (should be 19532304)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.02R.fastq.gz   bad CRC c489213e  (should be 97321278)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.01V.fastq.gz   bad CRC a8031f2f  (should be 18776879)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.02V.fastq.gz   bad CRC 92047933  (should be 49766707)\n",
      " extracting: per_sample_FASTQ/81253/10249.M029.01V.fastq.gz   bad CRC fac7ffb2  (should be 07411122)\n",
      " extracting: per_sample_FASTQ/81253/10249.M023.01V.fastq.gz   bad CRC 1012966a  (should be 69653610)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.01R.fastq.gz   bad CRC a7e49e58  (should be 16777816)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.01V.fastq.gz   bad CRC a902d958  (should be 35536216)\n",
      " extracting: per_sample_FASTQ/81253/10249.M026.01V.fastq.gz   bad CRC de3f1e73  (should be 28678515)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.03R.fastq.gz   bad CRC c78b5892  (should be 47798162)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.02R.fastq.gz   bad CRC 482bc083  (should be 10826883)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.01V.fastq.gz   bad CRC b39e0180  (should be 13476736)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.03V.fastq.gz   bad CRC d29238d2  (should be 32798162)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.01R.fastq.gz   bad CRC 12864de9  (should be 10791657)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.02V.fastq.gz   bad CRC 41d51f02  (should be 04486146)\n",
      " extracting: per_sample_FASTQ/81253/10249.M001.04R.fastq.gz   bad CRC 76170e89  (should be 81222537)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.02V.fastq.gz   bad CRC bb449cfc  (should be 41836028)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.03V.fastq.gz   bad CRC 3c8bb4fc  (should be 15788796)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.02V.fastq.gz   bad CRC b1587a81  (should be 75365761)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.01V.fastq.gz   bad CRC 51dd9595  (should be 73476245)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.01R.fastq.gz   bad CRC 828d9544  (should be 90316868)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.01R.fastq.gz   bad CRC a019eb7d  (should be 86053245)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.02R.fastq.gz   bad CRC bc25f4af  (should be 56604079)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.03V.fastq.gz   bad CRC c63e7be9  (should be 25983721)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.02R.fastq.gz   bad CRC 7229cfe3  (should be 15342819)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      " extracting: per_sample_FASTQ/81253/10249.M046.02V.fastq.gz   bad CRC dcc78032  (should be 04062002)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.01R.fastq.gz   bad CRC 0c70c9d9  (should be 08718297)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.03V.fastq.gz   bad CRC e06f4a1c  (should be 65389852)\n",
      " extracting: per_sample_FASTQ/81253/10249.M027.01R.fastq.gz   bad CRC 8c0b551c  (should be 49552924)\n",
      " extracting: per_sample_FASTQ/81253/10249.M027.03V.fastq.gz   bad CRC 99e5a6ec  (should be 81964524)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.03R.fastq.gz   bad CRC dec271bb  (should be 37285051)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.03R.fastq.gz   bad CRC ece8edba  (should be 74688186)\n",
      " extracting: per_sample_FASTQ/81253/10249.M027.03R.fastq.gz   bad CRC 375a07fc  (should be 28647164)\n",
      " extracting: per_sample_FASTQ/81253/10249.M046.03V.fastq.gz   bad CRC 90ca2ccb  (should be 29168843)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.01R.fastq.gz   bad CRC 62769629  (should be 51938857)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.02V.fastq.gz   bad CRC 3022289f  (should be 07544991)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.02R.fastq.gz   bad CRC edfbe23d  (should be 92707645)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.03V.fastq.gz   bad CRC 44c886c8  (should be 53992392)\n",
      " extracting: per_sample_FASTQ/81253/10249.M002.02R.fastq.gz   bad CRC 71bbfa08  (should be 08144648)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.01R.fastq.gz   bad CRC 53d1f33a  (should be 06268218)\n",
      " extracting: per_sample_FASTQ/81253/10249.M019.02R.fastq.gz   bad CRC 711c57a5  (should be 97682853)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.02R.fastq.gz   bad CRC cfcb84ec  (should be 86221548)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.02R.fastq.gz   bad CRC 39dfdcfa  (should be 70972410)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.02R.fastq.gz   bad CRC 7c2cc520  (should be 83308832)\n",
      " extracting: per_sample_FASTQ/81253/10249.M020.01V.fastq.gz   bad CRC c658dd17  (should be 27712535)\n",
      " extracting: per_sample_FASTQ/81253/10249.M051.02R.fastq.gz   bad CRC bf21697e  (should be 06637950)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.03R.fastq.gz   bad CRC ebd2957d  (should be 56446589)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.01V.fastq.gz   bad CRC 3cff27d1  (should be 23354833)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.02V.fastq.gz   bad CRC 1115b840  (should be 86636096)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.02V.fastq.gz   bad CRC e656720f  (should be 64424975)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.02R.fastq.gz   bad CRC 8d9bd123  (should be 75799075)\n",
      " extracting: per_sample_FASTQ/81253/10249.M019.01R.fastq.gz   bad CRC ce3db9af  (should be 60151727)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.02R.fastq.gz   bad CRC 8622e84e  (should be 50434638)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.03V.fastq.gz   bad CRC 8bff45b1  (should be 48762545)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.02V.fastq.gz   bad CRC a6b012c7  (should be 96556999)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.03R.fastq.gz   bad CRC 4560b5ea  (should be 63965930)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.01R.fastq.gz   bad CRC 9fee2503  (should be 83184387)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.02V.fastq.gz   bad CRC f588bd1a  (should be 19379226)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.03R.fastq.gz   bad CRC 89b9a646  (should be 10645318)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.02R.fastq.gz   bad CRC c6a8a863  (should be 32941923)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.01R.fastq.gz   bad CRC 2c3922e0  (should be 41941984)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.03V.fastq.gz   bad CRC 1c4ae704  (should be 74670852)\n",
      " extracting: per_sample_FASTQ/81253/10249.M039.01V.fastq.gz   bad CRC 5156408e  (should be 64607118)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.02V.fastq.gz   bad CRC 0eeea6fa  (should be 50521338)\n",
      " extracting: per_sample_FASTQ/81253/10249.M029.02R.fastq.gz   bad CRC fd40e480  (should be 48888448)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.02V.fastq.gz   bad CRC 62303f51  (should be 47329105)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.02V.fastq.gz   bad CRC a0d8a52b  (should be 98552619)\n",
      " extracting: per_sample_FASTQ/81253/10249.M027.01V.fastq.gz   bad CRC 08253c37  (should be 36657975)\n",
      " extracting: per_sample_FASTQ/81253/10249.M022.02V.fastq.gz   bad CRC 2303d3d3  (should be 87453395)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.03V.fastq.gz   bad CRC e8668e18  (should be 99035160)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.03R.fastq.gz   bad CRC f4b5d4f7  (should be 05557239)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.01V.fastq.gz   bad CRC aa66b86c  (should be 58858604)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.01V.fastq.gz   bad CRC 6deaf297  (should be 44114071)\n",
      " extracting: per_sample_FASTQ/81253/10249.M038.01V.fastq.gz   bad CRC 234c5ff9  (should be 92207865)\n",
      " extracting: per_sample_FASTQ/81253/10249.M029.01R.fastq.gz   bad CRC 86742a36  (should be 55759926)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.01V.fastq.gz   bad CRC c7df9a67  (should be 53320039)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.02R.fastq.gz   bad CRC fd22f4d4  (should be 46926548)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.01V.fastq.gz   bad CRC 124006b9  (should be 06185913)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.03V.fastq.gz   bad CRC 74169a39  (should be 47638329)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.01V.fastq.gz   bad CRC 8de85023  (should be 80812323)\n",
      " extracting: per_sample_FASTQ/81253/10249.M010.01V.fastq.gz   bad CRC 47c6a7e2  (should be 04201442)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.03V.fastq.gz   bad CRC ee7d79e4  (should be 01200612)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.02R.fastq.gz   bad CRC bef9b6f0  (should be 04036336)\n",
      " extracting: per_sample_FASTQ/81253/10249.M029.02V.fastq.gz   bad CRC e81e590a  (should be 94302986)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.01V.fastq.gz   bad CRC 0c480033  (should be 06045235)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.03R.fastq.gz   bad CRC 7c938afe  (should be 90044158)\n",
      " extracting: per_sample_FASTQ/81253/10249.M034.02V.fastq.gz   bad CRC 5d5d0626  (should be 66377510)\n",
      " extracting: per_sample_FASTQ/81253/10249.M020.01R.fastq.gz   bad CRC bd47232c  (should be 75555884)\n",
      " extracting: per_sample_FASTQ/81253/10249.M026.02R.fastq.gz   bad CRC 8f13308e  (should be 00399502)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.01R.fastq.gz   bad CRC 9d51c008  (should be 39380488)\n",
      " extracting: per_sample_FASTQ/81253/10249.M023.01R.fastq.gz   bad CRC 7b0b6cea  (should be 64346346)\n",
      " extracting: per_sample_FASTQ/81253/10249.M032.01V.fastq.gz   bad CRC b84c9446  (should be 92026438)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.03R.fastq.gz   bad CRC 59094fb4  (should be 93782452)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.03R.fastq.gz   bad CRC 03e6cf2c  (should be 65457964)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.02V.fastq.gz   bad CRC 631ab70c  (should be 62695180)\n",
      " extracting: per_sample_FASTQ/81253/10249.M009.01V.fastq.gz   bad CRC 98c89940  (should be 63283264)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.02V.fastq.gz   bad CRC 4707f7d3  (should be 91704531)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.03R.fastq.gz   bad CRC fb3f61aa  (should be 15234986)\n",
      " extracting: per_sample_FASTQ/81253/10249.M006.01V.fastq.gz   bad CRC 7551bf7c  (should be 68291708)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.02R.fastq.gz   bad CRC a31cce22  (should be 36573986)\n",
      " extracting: per_sample_FASTQ/81253/10249.M002.02V.fastq.gz   bad CRC 302abb80  (should be 08106880)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.02V.fastq.gz   bad CRC 026f2667  (should be 40838759)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.01R.fastq.gz   bad CRC 5153a253  (should be 64435539)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.02R.fastq.gz   bad CRC 12b74feb  (should be 14003435)\n",
      " extracting: per_sample_FASTQ/81253/10249.M044.02V.fastq.gz   bad CRC c09c3763  (should be 31463267)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.01R.fastq.gz   bad CRC df0dd619  (should be 42225945)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.03V.fastq.gz   bad CRC b095978f  (should be 62593679)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.02R.fastq.gz   bad CRC f6e39d39  (should be 42112057)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      " extracting: per_sample_FASTQ/81253/10249.M051.01R.fastq.gz   bad CRC 2eb2e715  (should be 83476501)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.01R.fastq.gz   bad CRC 1bb9352e  (should be 65122606)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.02R.fastq.gz   bad CRC bbfa9af6  (should be 53763062)\n",
      " extracting: per_sample_FASTQ/81253/10249.M019.01V.fastq.gz   bad CRC 8c031782  (should be 49012866)\n",
      " extracting: per_sample_FASTQ/81253/10249.M015.01R.fastq.gz   bad CRC be59db03  (should be 93559811)\n",
      " extracting: per_sample_FASTQ/81253/10249.M043.01R.fastq.gz   bad CRC 0986a258  (should be 59818328)\n",
      " extracting: per_sample_FASTQ/81253/10249.M050.01R.fastq.gz   bad CRC 7817e683  (should be 14832259)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.01V.fastq.gz   bad CRC 6d869133  (should be 37535539)\n",
      " extracting: per_sample_FASTQ/81253/10249.M020.03V.fastq.gz   bad CRC 5e5d1198  (should be 83157656)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.01R.fastq.gz   bad CRC b11341d4  (should be 70829268)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.01V.fastq.gz   bad CRC 6a21caa9  (should be 80599465)\n",
      " extracting: per_sample_FASTQ/81253/10249.M052.02V.fastq.gz   bad CRC 8d5ce3fd  (should be 71675133)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.03V.fastq.gz   bad CRC 36806fd5  (should be 14386901)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.03V.fastq.gz   bad CRC a15220e0  (should be 06514144)\n",
      " extracting: per_sample_FASTQ/81253/10249.M051.02V.fastq.gz   bad CRC 26798f8d  (should be 45500813)\n",
      " extracting: per_sample_FASTQ/81253/10249.M007.01V.fastq.gz   bad CRC 5346eeb9  (should be 97157561)\n",
      " extracting: per_sample_FASTQ/81253/10249.M036.01V.fastq.gz   bad CRC 575677b9  (should be 65284537)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.03R.fastq.gz   bad CRC 57cc3d1c  (should be 73002780)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.02R.fastq.gz   bad CRC 78bcab19  (should be 25630489)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.01R.fastq.gz   bad CRC a9a31d44  (should be 46039364)\n",
      " extracting: per_sample_FASTQ/81253/10249.M053.01R.fastq.gz   bad CRC f182c9d0  (should be 51880400)\n",
      " extracting: per_sample_FASTQ/81253/10249.M018.03R.fastq.gz   bad CRC 039be28d  (should be 60547725)\n",
      " extracting: per_sample_FASTQ/81253/10249.M030.01R.fastq.gz   bad CRC 854c7119  (should be 36379417)\n",
      " extracting: per_sample_FASTQ/81253/10249.M050.02V.fastq.gz   bad CRC 32159d66  (should be 40277350)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.02R.fastq.gz   bad CRC 12000b31  (should be 01992753)\n",
      " extracting: per_sample_FASTQ/81253/10249.M031.02R.fastq.gz   bad CRC 516c663d  (should be 66058557)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.01R.fastq.gz   bad CRC e943697d  (should be 13509245)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.02R.fastq.gz   bad CRC 780201cb  (should be 13397451)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.01R.fastq.gz   bad CRC 03b56107  (should be 62218503)\n",
      " extracting: per_sample_FASTQ/81253/10249.M001.03V.fastq.gz   bad CRC d0e42c0e  (should be 04614414)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.03V.fastq.gz   bad CRC d1e10766  (should be 21185638)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.03R.fastq.gz   bad CRC ea6ca8ed  (should be 32989677)\n",
      " extracting: per_sample_FASTQ/81253/10249.M037.01V.fastq.gz   bad CRC 759b5bd9  (should be 73115865)\n",
      " extracting: per_sample_FASTQ/81253/10249.M021.01V.fastq.gz   bad CRC e0351391  (should be 61574801)\n",
      " extracting: per_sample_FASTQ/81253/10249.M032.02R.fastq.gz   bad CRC db183f2b  (should be 75799339)\n",
      " extracting: per_sample_FASTQ/81253/10249.M014.01V.fastq.gz   bad CRC 587c0d84  (should be 84524932)\n",
      " extracting: per_sample_FASTQ/81253/10249.M002.03R.fastq.gz   bad CRC 68033c3f  (should be 45042495)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.01R.fastq.gz   bad CRC a06b414b  (should be 91383627)\n",
      " extracting: per_sample_FASTQ/81253/10249.M039.01R.fastq.gz   bad CRC e77e82ad  (should be 83827885)\n",
      " extracting: per_sample_FASTQ/81253/10249.M033.02V.fastq.gz   bad CRC 33e51d4b  (should be 70653259)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.01V.fastq.gz   bad CRC 77d3311d  (should be 10329373)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.03V.fastq.gz   bad CRC cbd58eb9  (should be 19770553)\n",
      " extracting: per_sample_FASTQ/81253/10249.M008.03V.fastq.gz   bad CRC ed46dc54  (should be 80844116)\n",
      " extracting: per_sample_FASTQ/81253/10249.M004.02V.fastq.gz   bad CRC 57bca1c1  (should be 71979969)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.01R.fastq.gz   bad CRC a9bda930  (should be 47779120)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.03R.fastq.gz   bad CRC f1688c56  (should be 50160726)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.02V.fastq.gz   bad CRC 117e474b  (should be 93488459)\n",
      " extracting: per_sample_FASTQ/81253/10249.M012.01R.fastq.gz   bad CRC 33300000  (should be 58783744)\n",
      " extracting: per_sample_FASTQ/81253/10249.M035.02R.fastq.gz   bad CRC 1a85129e  (should be 44928670)\n",
      " extracting: per_sample_FASTQ/81253/10249.M047.02R.fastq.gz   bad CRC df3ea847  (should be 45425479)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.02V.fastq.gz   bad CRC 1c7fa104  (should be 78126340)\n",
      " extracting: per_sample_FASTQ/81253/10249.M051.01V.fastq.gz   bad CRC 267791ea  (should be 45370346)\n",
      " extracting: per_sample_FASTQ/81253/10249.M045.01V.fastq.gz   bad CRC d4dda8b4  (should be 71296436)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.01V.fastq.gz   bad CRC e41dde17  (should be 27162647)\n",
      " extracting: per_sample_FASTQ/81253/10249.M025.03R.fastq.gz   bad CRC 1b2dc5f7  (should be 55984631)\n",
      " extracting: per_sample_FASTQ/81253/10249.M057.01R.fastq.gz   bad CRC c4da9d66  (should be 02661478)\n",
      " extracting: per_sample_FASTQ/81253/10249.M016.01R.fastq.gz   bad CRC 81ab1c03  (should be 75474691)\n",
      " extracting: per_sample_FASTQ/81253/10249.M015.01V.fastq.gz   bad CRC 81b86e92  (should be 76347794)\n",
      " extracting: per_sample_FASTQ/81253/10249.M023.02R.fastq.gz   bad CRC ff37cee0  (should be 81847520)\n",
      " extracting: per_sample_FASTQ/81253/10249.M055.01R.fastq.gz   bad CRC d78e8499  (should be 16441497)\n",
      " extracting: per_sample_FASTQ/81253/10249.M005.01R.fastq.gz   bad CRC 745625e0  (should be 51802848)\n",
      " extracting: per_sample_FASTQ/81253/10249.M017.03R.fastq.gz   bad CRC 64cd32c9  (should be 91169481)\n",
      " extracting: per_sample_FASTQ/81253/10249.M023.02V.fastq.gz   bad CRC edeb7820  (should be 91631904)\n",
      " extracting: per_sample_FASTQ/81253/10249.M056.02R.fastq.gz   bad CRC a9ab1398  (should be 46561176)\n",
      " extracting: per_sample_FASTQ/81253/10249.M049.01R.fastq.gz   bad CRC b374fc3e  (should be 10788414)\n",
      " extracting: per_sample_FASTQ/81253/10249.M042.02V.fastq.gz   bad CRC 1c16c347  (should be 71253831)\n",
      " extracting: per_sample_FASTQ/81253/10249.M011.01V.fastq.gz   bad CRC c8641369  (should be 62001769)\n",
      " extracting: per_sample_FASTQ/81253/10249.M041.01R.fastq.gz   bad CRC c540f0f2  (should be 09367538)\n",
      " extracting: per_sample_FASTQ/81253/10249.M024.03R.fastq.gz   bad CRC cf473991  (should be 77551505)\n",
      " extracting: per_sample_FASTQ/81253/artifact_81253.html   bad CRC 8390899e  (should be 07287710)\n",
      " extracting: mapping_files/81253_mapping_file.txt  \n"
     ]
    }
   ],
   "source": [
    "!unzip 81253.zip"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [],
   "source": [
    "!mv mapping_files/81253_mapping_file.txt metadata.tsv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Importe DNA sequence data into QIIME 2 & create a visual summary"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Create the manifest file with the required column headers"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [],
   "source": [
    "!echo \"sample-id\\tabsolute-filepath\" > manifest.tsv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Use a loop function to insert the sample names into the sample-id column and add the full paths to the sequence files in the absolute-filepath column"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [],
   "source": [
    "!for f in `ls per_sample_FASTQ/81253/*.gz`; \\\n",
    "do n=`basename $f`; echo \"12802.${n%.fastq.gz}\\t$PWD/$f\"; done >> manifest.tsv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 3. Use the manifest file to import the sequences into QIIME 2"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mImported manifest.tsv as SingleEndFastqManifestPhred33V2 to se-demux.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime tools import \\\n",
    "  --input-path manifest.tsv \\\n",
    "  --type 'SampleData[SequencesWithQuality]' \\\n",
    "  --input-format SingleEndFastqManifestPhred33V2 \\\n",
    "  --output-path se-demux.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 4. Create a summary of the demultiplexed artifact"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: se-demux.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime demux summarize \\\n",
    "  --i-data se-demux.qza \\\n",
    "  --o-visualization se-demux.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Sequence quality control and feature table construction"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Apply intial quality filtering "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved SampleData[SequencesWithQuality] to: demux-filtered.qza\u001b[0m\n",
      "\u001b[32mSaved QualityFilterStats to: demux-filter-stats.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime quality-filter q-score \\\n",
    " --i-demux se-demux.qza \\\n",
    " --o-filtered-sequences demux-filtered.qza \\\n",
    " --o-filter-stats demux-filter-stats.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Apply Deblur workflow"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: table-deblur.qza\u001b[0m\n",
      "\u001b[32mSaved FeatureData[Sequence] to: rep-seqs-deblur.qza\u001b[0m\n",
      "\u001b[32mSaved DeblurStats to: deblur-stats.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime deblur denoise-16S \\\n",
    "  --i-demultiplexed-seqs demux-filtered.qza \\\n",
    "  --p-trim-length 150 \\\n",
    "  --p-sample-stats \\\n",
    "  --p-jobs-to-start 4 \\\n",
    "  --o-stats deblur-stats.qza \\\n",
    "  --o-representative-sequences rep-seqs-deblur.qza \\\n",
    "  --o-table table-deblur.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 3. Create a visualization summary of deblur statistics"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: deblur-stats.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime deblur visualize-stats \\\n",
    "  --i-deblur-stats deblur-stats.qza \\\n",
    "  --o-visualization deblur-stats.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 4. Visualize representative sequences"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: rep-seqs-deblur.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-table tabulate-seqs \\\n",
    "  --i-data rep-seqs-deblur.qza \\\n",
    "  --o-visualization rep-seqs-deblur.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 5. Visualize feature table"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: table-deblur.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-table summarize \\\n",
    "  --i-table table-deblur.qza \\\n",
    "  --m-sample-metadata-file metadata.tsv \\\n",
    "  --o-visualization table-deblur.qzv "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Generate a phylogenetic tree"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Download a backbone tree"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 17:18:12--  https://data.qiime2.org/2019.10/common/sepp-refs-gg-13-8.qza\n",
      "Resolving data.qiime2.org... 52.35.38.247\n",
      "Connecting to data.qiime2.org|52.35.38.247|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 FOUND\n",
      "Location: https://s3-us-west-2.amazonaws.com/qiime2-data/2019.10/common/sepp-refs-gg-13-8.qza [following]\n",
      "--2020-01-14 17:18:12--  https://s3-us-west-2.amazonaws.com/qiime2-data/2019.10/common/sepp-refs-gg-13-8.qza\n",
      "Resolving s3-us-west-2.amazonaws.com... 52.218.245.192\n",
      "Connecting to s3-us-west-2.amazonaws.com|52.218.245.192|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 50161069 (48M) [binary/octet-stream]\n",
      "Saving to: ‘sepp-refs-gg-13-8.qza’\n",
      "\n",
      "sepp-refs-gg-13-8.q 100%[===================>]  47.84M  4.27MB/s    in 11s     \n",
      "\n",
      "2020-01-14 17:18:24 (4.28 MB/s) - ‘sepp-refs-gg-13-8.qza’ saved [50161069/50161069]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!wget \\\n",
    "  -O \"sepp-refs-gg-13-8.qza\" \\\n",
    "  \"https://data.qiime2.org/2019.10/common/sepp-refs-gg-13-8.qza\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Create an insertion tree"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Phylogeny[Rooted] to: insertion-tree.qza\u001b[0m\n",
      "\u001b[32mSaved Placements to: insertion-placements.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime fragment-insertion sepp \\\n",
    "  --i-representative-sequences rep-seqs-deblur.qza \\\n",
    "  --i-reference-database sepp-refs-gg-13-8.qza \\\n",
    "  --p-threads 4 \\\n",
    "  --o-tree insertion-tree.qza \\\n",
    "  --o-placements insertion-placements.qza "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 3. Filter feature table"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: filtered-table-deblur.qza\u001b[0m\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: removed-table.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime fragment-insertion filter-features \\\n",
    "  --i-table table-deblur.qza \\\n",
    "  --i-tree insertion-tree.qza \\\n",
    "  --o-filtered-table filtered-table-deblur.qza \\\n",
    "  --o-removed-table removed-table.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Taxonomic classification"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Download required files"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 21:29:02--  https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/human-stool.qza\n",
      "Resolving github.com... 192.30.255.113\n",
      "Connecting to github.com|192.30.255.113|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/human-stool.qza [following]\n",
      "--2020-01-14 21:29:02--  https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/human-stool.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 209813 (205K) [application/octet-stream]\n",
      "Saving to: ‘human-stool.qza’\n",
      "\n",
      "human-stool.qza     100%[===================>] 204.90K  --.-KB/s    in 0.04s   \n",
      "\n",
      "2020-01-14 21:29:03 (5.20 MB/s) - ‘human-stool.qza’ saved [209813/209813]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!wget https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/human-stool.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 21:29:03--  https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/ref-seqs-v4.qza\n",
      "Resolving github.com... 192.30.255.113\n",
      "Connecting to github.com|192.30.255.113|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/ref-seqs-v4.qza [following]\n",
      "--2020-01-14 21:29:04--  https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/ref-seqs-v4.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 9319426 (8.9M) [application/octet-stream]\n",
      "Saving to: ‘ref-seqs-v4.qza’\n",
      "\n",
      "ref-seqs-v4.qza     100%[===================>]   8.89M  8.12MB/s    in 1.1s    \n",
      "\n",
      "2020-01-14 21:29:05 (8.12 MB/s) - ‘ref-seqs-v4.qza’ saved [9319426/9319426]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!wget https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/ref-seqs-v4.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 21:29:06--  https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/ref-tax.qza\n",
      "Resolving github.com... 192.30.255.113\n",
      "Connecting to github.com|192.30.255.113|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/ref-tax.qza [following]\n",
      "--2020-01-14 21:29:06--  https://raw.githubusercontent.com/BenKaehler/readytowear/master/data/gg_13_8/515f-806r/ref-tax.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 2604632 (2.5M) [application/octet-stream]\n",
      "Saving to: ‘ref-tax.qza’\n",
      "\n",
      "ref-tax.qza         100%[===================>]   2.48M  7.56MB/s    in 0.3s    \n",
      "\n",
      "2020-01-14 21:29:07 (7.56 MB/s) - ‘ref-tax.qza’ saved [2604632/2604632]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!wget https://github.com/BenKaehler/readytowear/raw/master/data/gg_13_8/515f-806r/ref-tax.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Train a classifier"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved TaxonomicClassifier to: gg138_v4_human-stool_classifier.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-classifier fit-classifier-naive-bayes \\\n",
    "  --i-reference-reads ref-seqs-v4.qza \\\n",
    "  --i-reference-taxonomy ref-tax.qza \\\n",
    "  --i-class-weight human-stool.qza \\\n",
    "  --o-classifier gg138_v4_human-stool_classifier.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 3. Assign taxonomy"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 25,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureData[Taxonomy] to: bespoke-taxonomy.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-classifier classify-sklearn \\\n",
    "  --i-reads rep-seqs-deblur.qza \\\n",
    "  --i-classifier gg138_v4_human-stool_classifier.qza \\\n",
    "  --o-classification bespoke-taxonomy.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 4. Visualize taxonomies"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 26,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: bespoke-taxonomy.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime metadata tabulate \\\n",
    "  --m-input-file bespoke-taxonomy.qza \\\n",
    "  --m-input-file rep-seqs-deblur.qza \\\n",
    "  --o-visualization bespoke-taxonomy.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Filter ECAM data to contain children samples only"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Filter feature table"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 27,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: child-table.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-table filter-samples \\\n",
    "  --i-table filtered-table-deblur.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-where \"[mom_or_child]='C'\" \\\n",
    "  --o-filtered-table child-table.qza"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Visualize new feature table"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 28,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: child-table.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-table summarize \\\n",
    "  --i-table child-table.qza \\\n",
    "  --m-sample-metadata-file metadata.tsv \\\n",
    "  --o-visualization child-table.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Alpha rarefaction plots"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 29,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: child-alpha-rarefaction.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime diversity alpha-rarefaction \\\n",
    "  --i-table child-table.qza \\\n",
    "  --i-phylogeny insertion-tree.qza \\\n",
    "  --p-max-depth 10000 \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --o-visualization child-alpha-rarefaction.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Basic data exploration and diversity analyses"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 0. Filter feature table to include only one sample per subject per month"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 30,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: child-table-norep.qza\u001b[0m\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: child-table-norep.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime feature-table filter-samples \\\n",
    "  --i-table child-table.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-where \"[month_replicate]='no'\" \\\n",
    "  --o-filtered-table child-table-norep.qza\n",
    "\n",
    "# create a visualization summary of new table\n",
    "!qiime feature-table summarize \\\n",
    "  --i-table child-table-norep.qza \\\n",
    "  --m-sample-metadata-file metadata.tsv \\\n",
    "  --o-visualization child-table-norep.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Generate taxonomic barplot"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 31,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: child-bar-plots.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime taxa barplot \\\n",
    "  --i-table child-table-norep.qza \\\n",
    "  --i-taxonomy bespoke-taxonomy.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --o-visualization child-bar-plots.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Compute alpha and beta diversity"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 32,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: child-norep-core-metrics-results/rarefied_table.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] % Properties('phylogenetic') to: child-norep-core-metrics-results/faith_pd_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-norep-core-metrics-results/observed_otus_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-norep-core-metrics-results/shannon_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-norep-core-metrics-results/evenness_vector.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: child-norep-core-metrics-results/unweighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: child-norep-core-metrics-results/weighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: child-norep-core-metrics-results/jaccard_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: child-norep-core-metrics-results/bray_curtis_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-norep-core-metrics-results/unweighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-norep-core-metrics-results/weighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-norep-core-metrics-results/jaccard_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-norep-core-metrics-results/bray_curtis_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-norep-core-metrics-results/unweighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-norep-core-metrics-results/weighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-norep-core-metrics-results/jaccard_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-norep-core-metrics-results/bray_curtis_emperor.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime diversity core-metrics-phylogenetic \\\n",
    "  --i-table child-table-norep.qza \\\n",
    "  --i-phylogeny insertion-tree.qza \\\n",
    "  --p-sampling-depth 3400 \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-n-jobs 4 \\\n",
    "  --output-dir child-norep-core-metrics-results"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Perform statistical tests on diversity and generate interactive visualization"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Statistical test on alpha diversity"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### A. Across all time points"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 33,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: child-norep-core-metrics-results/shannon-group-significance.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime diversity alpha-group-significance \\\n",
    "  --i-alpha-diversity child-norep-core-metrics-results/shannon_vector.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --o-visualization child-norep-core-metrics-results/shannon-group-significance.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### B. At last time point (month 24)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 34,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: table-norep-C24.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# filter the feature table to have the final time point only\n",
    "!qiime feature-table filter-samples \\\n",
    "  --i-table child-table-norep.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-where \"[month]='24'\" \\\n",
    "  --o-filtered-table table-norep-C24.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 35,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: norep-C24-core-metrics-results/rarefied_table.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] % Properties('phylogenetic') to: norep-C24-core-metrics-results/faith_pd_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: norep-C24-core-metrics-results/observed_otus_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: norep-C24-core-metrics-results/shannon_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: norep-C24-core-metrics-results/evenness_vector.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: norep-C24-core-metrics-results/unweighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: norep-C24-core-metrics-results/weighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: norep-C24-core-metrics-results/jaccard_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: norep-C24-core-metrics-results/bray_curtis_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: norep-C24-core-metrics-results/unweighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: norep-C24-core-metrics-results/weighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: norep-C24-core-metrics-results/jaccard_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: norep-C24-core-metrics-results/bray_curtis_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/unweighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/weighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/jaccard_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/bray_curtis_emperor.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# recalculate diversities\n",
    "!qiime diversity core-metrics-phylogenetic \\\n",
    "  --i-table table-norep-C24.qza \\\n",
    "  --i-phylogeny insertion-tree.qza \\\n",
    "  --p-sampling-depth 3400 \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-n-jobs 4 \\\n",
    "  --output-dir norep-C24-core-metrics-results"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 36,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/shannon-group-significance.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# statistical test on alpha diversity at last time point\n",
    "!qiime diversity alpha-group-significance \\\n",
    "  --i-alpha-diversity norep-C24-core-metrics-results/shannon_vector.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --o-visualization norep-C24-core-metrics-results/shannon-group-significance.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Statistical test on beta diversity"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 37,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: norep-C24-core-metrics-results/uw_unifrac-delivery-significance.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime diversity beta-group-significance \\\n",
    "  --i-distance-matrix norep-C24-core-metrics-results/unweighted_unifrac_distance_matrix.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --m-metadata-column delivery \\\n",
    "  --p-pairwise \\\n",
    "  --o-visualization norep-C24-core-metrics-results/uw_unifrac-delivery-significance.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Longitudinal data analysis"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 1. Linear mixed effects models"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 38,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: child-core-metrics-results/rarefied_table.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] % Properties('phylogenetic') to: child-core-metrics-results/faith_pd_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-core-metrics-results/observed_otus_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-core-metrics-results/shannon_vector.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[AlphaDiversity] to: child-core-metrics-results/evenness_vector.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: child-core-metrics-results/unweighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix % Properties('phylogenetic') to: child-core-metrics-results/weighted_unifrac_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: child-core-metrics-results/jaccard_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved DistanceMatrix to: child-core-metrics-results/bray_curtis_distance_matrix.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-core-metrics-results/unweighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-core-metrics-results/weighted_unifrac_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-core-metrics-results/jaccard_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults to: child-core-metrics-results/bray_curtis_pcoa_results.qza\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-core-metrics-results/unweighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-core-metrics-results/weighted_unifrac_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-core-metrics-results/jaccard_emperor.qzv\u001b[0m\n",
      "\u001b[32mSaved Visualization to: child-core-metrics-results/bray_curtis_emperor.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# recalculate diversities based on the full dataset\n",
    "!qiime diversity core-metrics-phylogenetic \\\n",
    "  --i-table child-table.qza \\\n",
    "  --i-phylogeny insertion-tree.qza \\\n",
    "  --p-sampling-depth 3400 \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-n-jobs 4 \\\n",
    "  --output-dir child-core-metrics-results"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 39,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: lme-shannon.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# LME model on testing the effects of delivery model and diet\n",
    "!qiime longitudinal linear-mixed-effects \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --m-metadata-file child-core-metrics-results/shannon_vector.qza \\\n",
    "  --p-metric shannon \\\n",
    "  --p-random-effects day_of_life \\\n",
    "  --p-group-columns delivery,diet \\\n",
    "  --p-state-column day_of_life \\\n",
    "  --p-individual-id-column host_subject_id \\\n",
    "  --o-visualization lme-shannon.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### 2. Volatility visualization"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 40,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: shannon-volatility.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime longitudinal volatility \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --m-metadata-file child-core-metrics-results/shannon_vector.qza \\\n",
    "  --p-default-metric shannon \\\n",
    "  --p-default-group-column delivery \\\n",
    "  --p-state-column month \\\n",
    "  --p-individual-id-column host_subject_id \\\n",
    "  --o-visualization shannon-volatility.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Differential abundance testing"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Option 1: ANCOM"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 41,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: table-norep-C6.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# Create a new feature table that contains only samples from children at 6 months\n",
    "!qiime feature-table filter-samples \\\n",
    "  --i-table child-table-norep.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-where \"[month]='6'\" \\\n",
    "  --o-filtered-table table-norep-C6.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 42,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: filtered-table-C6.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# filter out low abundant features\n",
    "!qiime feature-table filter-features \\\n",
    "  --i-table table-norep-C6.qza \\\n",
    "  --p-min-samples 5 \\\n",
    "  --p-min-frequency 20 \\\n",
    "  --o-filtered-table filtered-table-C6.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 43,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Composition] to: comp-table-C6.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# add pseudo count\n",
    "!qiime composition add-pseudocount \\\n",
    "  --i-table filtered-table-C6.qza \\\n",
    "  --o-composition-table comp-table-C6.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 44,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved Visualization to: ancom-C6-delivery.qzv\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# run ANCOM\n",
    "!qiime composition ancom \\\n",
    "  --i-table comp-table-C6.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --m-metadata-column delivery \\\n",
    "  --o-visualization ancom-C6-delivery.qzv"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Option 2: songbird"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 45,
   "metadata": {},
   "outputs": [],
   "source": [
    "# make a folder to store songbird results\n",
    "!mkdir songbird-results"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 46,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureData[Differential] to: songbird-results/differentials6monthControlled.qza\u001b[0m\n",
      "\u001b[32mSaved SampleData[SongbirdStats] to: songbird-results/regression-stats6monthControlled.qza\u001b[0m\n",
      "\u001b[32mSaved PCoAResults % Properties('biplot') to: songbird-results/regression-biplot6monthControlled.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# run songbird\n",
    "!qiime songbird multinomial \\\n",
    "  --i-table table-norep-C6.qza \\\n",
    "  --m-metadata-file metadata.tsv \\\n",
    "  --p-formula \"delivery+abx_exposure+diet+sex\" \\\n",
    "  --p-epochs 10000 \\\n",
    "  --p-differential-prior 0.5 \\\n",
    "  --o-differentials songbird-results/differentials6monthControlled.qza \\\n",
    "  --o-regression-stats songbird-results/regression-stats6monthControlled.qza \\\n",
    "  --o-regression-biplot songbird-results/regression-biplot6monthControlled.qza"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 47,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mExported songbird-results/differentials6monthControlled.qza as DifferentialDirectoryFormat to directory songbird-results/exported-differentials6monthControlled\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "# examine estimated coefficients\n",
    "!qiime tools export \\\n",
    "  --input-path songbird-results/differentials6monthControlled.qza \\\n",
    "  --output-path songbird-results/exported-differentials6monthControlled"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Meta-analysis through Qiita database using redbiom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 48,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ContextName\tSamplesWithData\tFeaturesWithData\tDescription\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V34-5c6506\t72\t2221\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Deblur-Illumina-16S-V3-V4-150nt-780653\t60\t869\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-IonTorrent-16S-V3-100nt-a243a1\t32\t1089\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-SILVA-Illumina-16S-V3-54d83f\t138\t1014\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-150nt-bd7d4d\t137343\t71900\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-90nt-44feac\t158652\t74095\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-IonTorrent-16S-V3-41ebc6\t32\t1433\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Deblur-Illumina-16S-V9-100nt-fbc5b2\t319\t36485\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V3-90nt-44feac\t1135\t14850\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-FASTA-16S-V3-150nt-bd7d4d\t18\t1705\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-5c6506\t183600\t84058\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Deblur-Illumina-16S-V6-8-100nt-fbc5b2\t51\t2062\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V3-100nt-cb8fea\t3358\t8501\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V3-90nt-efd9ba\t3358\t7991\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V4-100nt-a243a1\t7493\t29896\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-IonTorrent-16S-V3-150nt-bd7d4d\t32\t1008\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V9-58196d\t209\t2633\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Deblur (Reference phylogeny for SEPP: Greengenes_13.8)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V3-150nt-96e6a9\t3357\t10563\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V4-150nt-96e6a9\t6067\t10792\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 150)\r\n",
      "Deblur-Illumina-16S-V9-90nt-99d1d8\t319\t35817\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 90)\r\n",
      "Deblur-Illumina-16S-V3-e40b83\t138\t7273\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Split libraries FASTQ\r\n",
      "Deblur-Illumina-16S-V3-90nt-99d1d8\t1130\t36905\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 90)\r\n",
      "Deblur-Illumina-16S-V4-100nt-fbc5b2\t161625\t6148149\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 100)\r\n",
      "Deblur-Illumina-16S-V3-150nt-780653\t1139\t9418\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V4-90nt-44feac\t7505\t27838\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V4-41ebc6\t7385\t27273\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V6-100nt-a243a1\t221\t7294\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Deblur-Illumina-16S-V34-150nt-780653\t72\t7819\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V9-100nt-a243a1\t321\t14922\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Deblur-Illumina-16S-V6-8-150nt-780653\t51\t3906\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V4-100nt-cb8fea\t6067\t9921\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 100)\r\n",
      "Deblur-Illumina-16S-V4-150nt-780653\t132667\t7430465\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V6-8-100nt-a243a1\t51\t4586\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-SILVA-Illumina-16S-V4-54d83f\t850\t10235\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Split libraries FASTQ\r\n",
      "Deblur-Illumina-16S-V3-100nt-fbc5b2\t1130\t42073\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 100)\r\n",
      "Deblur-Illumina-16S-V9-150nt-780653\t319\t266737\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 150)\r\n",
      "Deblur-Illumina-16S-V4-125nt-3aae8b\t16576\t397934\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 125)\r\n",
      "Pick_closed-reference_OTUs-SILVA-Illumina-16S-V4-d1cf1d\t20\t5361\tPick closed-reference OTUs (reference-seq: |projects|qiita_test_data|reference|Greengenes_13_8_gg_13_8-97_otus.fasta) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V3-5c6506\t1366\t18170\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V5-V7-90nt-44feac\t84\t4246\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V3-34e809\t3288\t6500\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-250nt-66a626\t174\t2686\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 250)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-100nt-a243a1\t158990\t75814\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V6-8-150nt-bd7d4d\t51\t4250\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Deblur-Illumina-16S-V4-250nt-3b87d8\t200\t14911\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 250)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-41ebc6\t100\t14434\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V4-34e809\t6007\t12821\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V5-V7-41ebc6\t84\t1697\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-SILVA-LS454-16S-V4-90nt-efd9ba\t6067\t8982\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V3-90nt-44feac\t11899\t34392\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V9-5c6506\t388\t5155\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V4-150nt-bd7d4d\t7544\t30847\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V3-150nt-bd7d4d\t11665\t35776\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-200nt-a5e305\t7009\t16070\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 200)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-FASTA-16S-V3-90nt-44feac\t18\t1682\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V9-150nt-bd7d4d\t263\t5054\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Deblur-Illumina-16S-V4-200nt-05cde0\t7009\t73599\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 200)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V34-150nt-bd7d4d\t72\t2653\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V6-150nt-bd7d4d\t221\t7227\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Deblur-Illumina-16S-V4-90nt-99d1d8\t155887\t4861245\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-FASTA-16S-V3-5c6506\t18\t1741\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V3-41ebc6\t11760\t35159\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Pick_closed-reference_OTUs-SILVA-Illumina-16S-V4-150nt-96e6a9\t751\t40335\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V5-V7-150nt-bd7d4d\t84\t4971\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V6-90nt-44feac\t221\t6572\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V6-41ebc6\t221\t8193\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries\r\n",
      "Deblur-Illumina-16S-V4-e40b83\t1785\t120797\tDeblur (Reference phylogeny for SEPP: Greengenes_13.8, BIOM: reference-hit.biom) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-Greengenes-IonTorrent-16S-V3-90nt-44feac\t32\t1065\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V3-150nt-bd7d4d\t1156\t6942\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-not provided-16S-V4-150nt-bd7d4d\t1905\t10232\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 150)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V9-90nt-44feac\t321\t11964\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 90)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V3-100nt-a243a1\t11908\t36166\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V3-100nt-a243a1\t1135\t16186\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-LS454-16S-V5-V7-100nt-a243a1\t84\t4576\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-FASTA-16S-V3-100nt-a243a1\t18\t1706\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 100)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-125nt-65468f\t18160\t41005\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Trimming (length: 125)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-Illumina-16S-V4-58196d\t8468\t34789\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Deblur (Reference phylogeny for SEPP: Greengenes_13.8)\r\n",
      "Pick_closed-reference_OTUs-Greengenes-not provided-16S-V4-5c6506\t1905\t10244\tPick closed-reference OTUs (reference-seq: |databases|gg|13_8|rep_set|97_otus.fasta) | Split libraries FASTQ\r\n",
      "Pick_closed-reference_OTUs-SILVA-Illumina-16S-V4-90nt-efd9ba\t387\t5332\tPick closed-reference OTUs (reference-seq: |projects|qiita_data|reference|silva_119_Silva_119_rep_set97.fna) | Trimming (length: 90)\r\n",
      "\r\n"
     ]
    }
   ],
   "source": [
    "# check the name of contexts and number of samples and features indexed\n",
    "!redbiom summarize contexts"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 49,
   "metadata": {},
   "outputs": [],
   "source": [
    "# identify samples where interested sequence was observed\n",
    "!redbiom search features --context Deblur-Illumina-16S-V4-150nt-780653 \\\n",
    "TACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG > observed_samples.txt\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 50,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Animal distal gut\t7124\r\n",
      "Animal surface\t331\r\n",
      "Surface (non-saline)\t204\r\n",
      "Sterile water blank\t102\r\n",
      "Animal secretion\t91\r\n",
      "animal distal gut\t68\r\n",
      "Animal corpus\t58\r\n",
      "Water (non-saline)\t15\r\n",
      "Plant corpus\t13\r\n",
      "Animal proximal gut\t12\r\n",
      "Aerosol (non-saline)\t9\r\n",
      "Soil (non-saline)\t6\r\n",
      "Water (saline)\t6\r\n",
      "Single strain\t6\r\n",
      "not provided\t2\r\n",
      "Sediment (saline)\t2\r\n",
      "Surface (saline)\t1\r\n",
      "\r\n",
      "Total samples\t8050\r\n"
     ]
    }
   ],
   "source": [
    "# search against only EMP samples\n",
    "!redbiom summarize samples \\\n",
    "  --category empo_3 \\\n",
    "  --from observed_samples.txt"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 51,
   "metadata": {},
   "outputs": [],
   "source": [
    "# search against infant samples\n",
    "!redbiom select samples-from-metadata \\\n",
    "  --context Deblur-Illumina-16S-V4-150nt-780653 \\\n",
    "  --from observed_samples.txt \"where (host_age < 3 or age < 3) and qiita_study_id != 10249\" > infant_samples.txt\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 52,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "birth\n",
      "child_3_preterm_birth\n",
      "birth_year\n",
      "child_3_birth_weight\n",
      "child_1_birth_weight_unit\n",
      "child_2_birth_weight_unit\n",
      "birth_head_cir\n",
      "birth_length\n",
      "birth_date\n",
      "child_2_birth_length\n",
      "birth_weight_units\n",
      "year_of_birth\n",
      "birth_length_units\n",
      "antibiotics_at_birth\n",
      "birth_head_cir_units\n",
      "live_births\n",
      "birth_ga_w_units\n",
      "birth_complications\n",
      "place_of_birth\n",
      "child_3_birth_weight_unit\n",
      "country_of_birth\n",
      "birth_route_2cat\n",
      "birth_ga_d_units\n",
      "birth_mode\n",
      "child_3_birth_length\n",
      "date_of_birth\n",
      "mouse_birth\n",
      "type_birth_location\n",
      "child_1_birth_weight\n",
      "child_1_birth_length\n",
      "birth_ga_d\n",
      "child_2_birth_length_unit\n",
      "birth_ga_w\n",
      "birth_season\n",
      "birth_days\n",
      "birth_wt\n",
      "child_2_birth_weight\n",
      "antibiotics_after_birth\n",
      "child_2_preterm_birth\n",
      "child_1_preterm_birth\n",
      "weight_at_birth\n",
      "child_1_birth_length_unit\n",
      "birth_control\n",
      "still_births\n",
      "birth_weight\n",
      "baby_birth_date\n",
      "birth_method\n",
      "child_3_birth_length_unit\n",
      "birth_wt_sd\n",
      "birth_location\n",
      "birth_method\t72\n",
      "birth_mode\t2176\n",
      "Vaginal\t38\n",
      "Cesarea\t16\n",
      "Vag\t3\n",
      "CSseed\t1\n",
      "\n",
      "Total samples\t58\n"
     ]
    }
   ],
   "source": [
    "# summarize the metadata of infant samples\n",
    "!redbiom search metadata \\\n",
    "  --categories birth\n",
    "\n",
    "!redbiom summarize metadata birth_method birth_mode\n",
    "\n",
    "!redbiom summarize samples \\\n",
    "     --category birth_mode \\\n",
    "     --from infant_samples.txt"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 53,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Category value\tcount\r\n",
      "Cesarea\t47\r\n",
      "Vaginal\t135\r\n",
      "CSseed\t335\r\n",
      "Vag\t689\r\n",
      "CS\t970\r\n"
     ]
    }
   ],
   "source": [
    "# check sample balance in modes of delivery\n",
    "!redbiom summarize metadata-category \\\n",
    "  --counter \\\n",
    "  --category birth_mode"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 54,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "10581\t54\r\n",
      "10918\t30\r\n",
      "11076\t19\r\n",
      "1064\t15\r\n",
      "11947\t10\r\n",
      "11358\t10\r\n",
      "2010\t4\r\n",
      "10512\t3\r\n",
      "11284\t1\r\n",
      "\r\n",
      "Total samples\t146\r\n"
     ]
    }
   ],
   "source": [
    "# summarize samples over study id category\n",
    "!redbiom summarize samples \\\n",
    "  --category qiita_study_id \\\n",
    "  --from infant_samples.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Supprot Protocols: Exporting QIIME 2 data"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 55,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mExported insertion-tree.qza as NewickDirectoryFormat to directory extracted-insertion-tree\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime tools export \\\n",
    "  --input-path insertion-tree.qza \\\n",
    "  --output-path extracted-insertion-tree"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Support protocols: Analysis of shotgun metagenomic data"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Download all the required example files"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 56,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "--2020-01-14 21:47:24--  https://github.com/qiime2/q2-shogun/raw/master/q2_shogun/tests/data/query.qza\n",
      "Resolving github.com... 192.30.255.112\n",
      "Connecting to github.com|192.30.255.112|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/query.qza [following]\n",
      "--2020-01-14 21:47:24--  https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/query.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 12700 (12K) [application/octet-stream]\n",
      "Saving to: ‘query.qza’\n",
      "\n",
      "query.qza           100%[===================>]  12.40K  --.-KB/s    in 0.002s  \n",
      "\n",
      "2020-01-14 21:47:25 (5.52 MB/s) - ‘query.qza’ saved [12700/12700]\n",
      "\n",
      "--2020-01-14 21:47:25--  https://github.com/qiime2/q2-shogun/raw/master/q2_shogun/tests/data/refseqs.qza\n",
      "Resolving github.com... 192.30.255.112\n",
      "Connecting to github.com|192.30.255.112|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/refseqs.qza [following]\n",
      "--2020-01-14 21:47:25--  https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/refseqs.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 228472 (223K) [application/octet-stream]\n",
      "Saving to: ‘refseqs.qza’\n",
      "\n",
      "refseqs.qza         100%[===================>] 223.12K  --.-KB/s    in 0.05s   \n",
      "\n",
      "2020-01-14 21:47:25 (4.38 MB/s) - ‘refseqs.qza’ saved [228472/228472]\n",
      "\n",
      "--2020-01-14 21:47:25--  https://github.com/qiime2/q2-shogun/raw/master/q2_shogun/tests/data/taxonomy.qza\n",
      "Resolving github.com... 192.30.255.112\n",
      "Connecting to github.com|192.30.255.112|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/taxonomy.qza [following]\n",
      "--2020-01-14 21:47:25--  https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/taxonomy.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 4293 (4.2K) [application/octet-stream]\n",
      "Saving to: ‘taxonomy.qza’\n",
      "\n",
      "taxonomy.qza        100%[===================>]   4.19K  --.-KB/s    in 0s      \n",
      "\n",
      "2020-01-14 21:47:26 (17.2 MB/s) - ‘taxonomy.qza’ saved [4293/4293]\n",
      "\n",
      "--2020-01-14 21:47:26--  https://github.com/qiime2/q2-shogun/raw/master/q2_shogun/tests/data/bt2-database.qza\n",
      "Resolving github.com... 192.30.255.112\n",
      "Connecting to github.com|192.30.255.112|:443... connected.\n",
      "HTTP request sent, awaiting response... 302 Found\n",
      "Location: https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/bt2-database.qza [following]\n",
      "--2020-01-14 21:47:26--  https://raw.githubusercontent.com/qiime2/q2-shogun/master/q2_shogun/tests/data/bt2-database.qza\n",
      "Resolving raw.githubusercontent.com... 151.101.196.133\n",
      "Connecting to raw.githubusercontent.com|151.101.196.133|:443... connected.\n",
      "HTTP request sent, awaiting response... 200 OK\n",
      "Length: 2552396 (2.4M) [application/octet-stream]\n",
      "Saving to: ‘bt2-database.qza’\n",
      "\n",
      "bt2-database.qza    100%[===================>]   2.43M  7.75MB/s    in 0.3s    \n",
      "\n",
      "2020-01-14 21:47:27 (7.75 MB/s) - ‘bt2-database.qza’ saved [2552396/2552396]\n",
      "\n"
     ]
    }
   ],
   "source": [
    "!for i in query refseqs taxonomy bt2-database; \\\n",
    "do wget https://github.com/qiime2/q2-shogun/raw/master/q2_shogun/tests/data/$i.qza; done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Run shotgun metagenomics pipeline"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 57,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n",
      "/Users/ssun/miniconda3/envs/qiime2-2019.10/lib/python3.6/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n",
      "  np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n",
      "\u001b[32mSaved FeatureTable[Frequency] to: taxatable.qza\u001b[0m\n"
     ]
    }
   ],
   "source": [
    "!qiime shogun nobunaga \\\n",
    "  --i-query query.qza \\\n",
    "  --i-reference-reads refseqs.qza \\\n",
    "  --i-reference-taxonomy taxonomy.qza \\\n",
    "  --i-database bt2-database.qza \\\n",
    "  --o-taxa-table taxatable.qza"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.6.7"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 2
}