Fasta Format

Wubin Qu edited this page May 23, 2017 · 3 revisions

Fasta format

A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. The word following the ">" symbol is the identifier (unique required) of the sequence, and the rest of the line is the description (optional). There should be no space between the ">" and the first letter of the identifier. It is recommended that all lines of text be shorter than 80 characters. The sequence ends if another line starting with a ">" appears; this indicates the start of another sequence.

Examples

 >PrimerName1 This is description, can be any words
 CTGTTTAAGACTCACCCTGAGAC
 >PrimerName2 Primer name should be unique, duplication name not allowed
 GGTGCAACCATGCTTCTTCA
 >PrimerName3 Primer name just like everyone's ID
 CTGCCGAGATCCAGCCTCTA
 >PrimerName4
 GCATCTGCTCCAAAGTCCCC
Clone this wiki locally
You can’t perform that action at this time.
You signed in with another tab or window. Reload to refresh your session. You signed out in another tab or window. Reload to refresh your session.
Press h to open a hovercard with more details.