Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

150 lines (137 sloc) 5.022 kb
// The Computer Language Benchmarks Game
// http://benchmarksgame.alioth.debian.org/
//
// contributed by the Rust Project Developers
// Copyright (c) 2012-2014 The Rust Project Developers
//
// All rights reserved.
//
// Redistribution and use in source and binary forms, with or without
// modification, are permitted provided that the following conditions
// are met:
//
// - Redistributions of source code must retain the above copyright
// notice, this list of conditions and the following disclaimer.
//
// - Redistributions in binary form must reproduce the above copyright
// notice, this list of conditions and the following disclaimer in
// the documentation and/or other materials provided with the
// distribution.
//
// - Neither the name of "The Computer Language Benchmarks Game" nor
// the name of "The Computer Language Shootout Benchmarks" nor the
// names of its contributors may be used to endorse or promote
// products derived from this software without specific prior
// written permission.
//
// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
// "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
// LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS
// FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE
// COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT,
// INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES
// (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR
// SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
// HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT,
// STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
// ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED
// OF THE POSSIBILITY OF SUCH DAMAGE.
#![feature(slicing_syntax)]
use std::io;
use std::io::{BufferedWriter, File};
use std::cmp::min;
use std::os;
static LINE_LENGTH: uint = 60;
static IM: u32 = 139968;
struct MyRandom {
last: u32
}
impl MyRandom {
fn new() -> MyRandom { MyRandom { last: 42 } }
fn normalize(p: f32) -> u32 {(p * IM as f32).floor() as u32}
fn gen(&mut self) -> u32 {
self.last = (self.last * 3877 + 29573) % IM;
self.last
}
}
struct AAGen<'a> {
rng: &'a mut MyRandom,
data: Vec<(u32, u8)>
}
impl<'a> AAGen<'a> {
fn new<'b>(rng: &'b mut MyRandom, aa: &[(char, f32)]) -> AAGen<'b> {
let mut cum = 0.;
let data = aa.iter()
.map(|&(ch, p)| { cum += p; (MyRandom::normalize(cum), ch as u8) })
.collect();
AAGen { rng: rng, data: data }
}
}
impl<'a> Iterator<u8> for AAGen<'a> {
fn next(&mut self) -> Option<u8> {
let r = self.rng.gen();
self.data.iter()
.skip_while(|pc| pc.val0() < r)
.map(|&(_, c)| c)
.next()
}
}
fn make_fasta<W: Writer, I: Iterator<u8>>(
wr: &mut W, header: &str, mut it: I, mut n: uint)
{
wr.write(header.as_bytes());
let mut line = [0u8, .. LINE_LENGTH + 1];
while n > 0 {
let nb = min(LINE_LENGTH, n);
for i in range(0, nb) {
line[i] = it.next().unwrap();
}
n -= nb;
line[nb] = '\n' as u8;
wr.write(line[..nb+1]);
}
}
fn run<W: Writer>(writer: &mut W) {
let args = os::args();
let args = args.as_slice();
let n = if os::getenv("RUST_BENCH").is_some() {
25000000
} else if args.len() <= 1u {
1000
} else {
from_str(args[1].as_slice()).unwrap()
};
let rng = &mut MyRandom::new();
let alu =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
let iub = &[('a', 0.27), ('c', 0.12), ('g', 0.12),
('t', 0.27), ('B', 0.02), ('D', 0.02),
('H', 0.02), ('K', 0.02), ('M', 0.02),
('N', 0.02), ('R', 0.02), ('S', 0.02),
('V', 0.02), ('W', 0.02), ('Y', 0.02)];
let homosapiens = &[('a', 0.3029549426680),
('c', 0.1979883004921),
('g', 0.1975473066391),
('t', 0.3015094502008)];
make_fasta(writer, ">ONE Homo sapiens alu\n",
alu.as_bytes().iter().cycle().map(|c| *c), n * 2);
make_fasta(writer, ">TWO IUB ambiguity codes\n",
AAGen::new(rng, iub), n * 3);
make_fasta(writer, ">THREE Homo sapiens frequency\n",
AAGen::new(rng, homosapiens), n * 5);
writer.flush();
}
fn main() {
if os::getenv("RUST_BENCH").is_some() {
let mut file = BufferedWriter::new(File::create(&Path::new("./shootout-fasta.data")));
run(&mut file);
} else {
run(&mut io::stdout());
}
}
Jump to Line
Something went wrong with that request. Please try again.