Skip to content
master
Switch branches/tags
Code

Latest commit

 

Git stats

Files

Permalink
Failed to load latest commit information.
Type
Name
Latest commit message
Commit time
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

travis coveralls pypi

valerius

valerius is a simple Bioinformatics toolset for processing Biological sequences.

Example

>>> import valerius
>>> sequence = valerius.from_string("TGACAATATATATATATATATAATGCTAGC")
>>> sequence.type
'DNA'
>>> sequence.gc_content
0.2

Installing

pip

valerius can be installed using pip:

$ pip3 install valerius

valerius is written for Python 3, and does not support Python 2.

If you get permission errors, try using sudo:

$ sudo pip3 install valerius

Development

The repository for valerius, containing the most recent iteration, can be found here. To clone the valerius repository directly from there, use:

$ git clone git://github.com/samirelanduk/valerius.git

Requirements

valerius requires requests.

Overview

From String

A sequence can be made from a string using:

>>> import valerius
>>> sequence1 = valerius.from_string("MALWMRLLPL")
>>> sequence2 = valerius.from_string("ggttgaactactcat")

valerius will automatically detect which sequence type it is, and will return a PeptideSequence for example, or RnaSequence as required.

Basic properties can be queried:

>>> "LLP" in sequence1
True
>>> sequence1.type
'peptide'
>>> sequence.length
10
>>> sequence2.frequencies
Counter({'T': 5, 'A': 4, 'G': 3, 'C': 3})
>>> sequence1.codes
['MET', 'ALA', 'LEU', 'TRP', 'MET', 'ARG', 'LEU', 'LEU', 'PRO', 'LEU']
>>> sequence2.gc_content
0.4

Opening

You can open a file...

>>> sequence = valerius.open("my_sequence.fasta")
>>> sequence
<DnaSequence (length: 163)>

...or fetch them...

>>> sequence = valerius.fetch("P01308")
<PeptideSequence (length: 110)>

Changelog

Release 0.2.0

14 November 2018

  • You can now fetch sequences from servers.
  • Added sequence type detection.
  • Residue code generation from sequence now possible.
  • Added FASTA parsing.

Release 0.1.0

5 February 2017

  • Added basic nucleotide and peptide sequence classes.

About

Python bioinformatics tools

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages