Find file
Fetching contributors…
Cannot retrieve contributors at this time
562 lines (561 sloc) 33.4 KB
>AF063097 AF063097 Bacteriophage P2, complete genome.
ggcgaggcggggaaagcactgcgcgctgacggtggtgctgattgtattttttcagcgtct
cagcgcgtcgtgacggcacttagtctgcccgttgaggcgttgtgtgtctgcggggtgttt
tgtgcggtggtgagcgtgtgaggggggatgacggggtgtaaaaaagccgcccgcaggcgg
cgatgttcagtcgttgtcagtgtccagtgagtagtttttaaagcggatgacctcctgacc
gagccagccgtttatctcgcggatcctgtcctgtaacgggataagctcattgcggacaaa
gacctttgccactttctcaatatcacccagcgacccgacgttctccggcttgccacccat
caactgaaaggggatgcggtgcgcgtccagcaggtcagcggcgctggcttttttgatatt
aaaaaaatcgtccttcgtcgccacttcactgagggggataattttaatgccgtcggcttt
cccctgtggggcatagagaaacaggtttttaaagttgttgcggcctttcgacttgaccat
gttttcgcgaagcatttcgatatcgttgcgatcctgcacggcatcggtgacatacatgat
gtatccggcatgtgcgccattttcgtaatacttgcggcggaacaacgtggccgactcatt
cagccaggcagagttaagggcgctgagatattccggcaggccgtacagctcctgattaat
atccggctccagcaggtgaaacacggagccgggcgcgaaggctgtcggctcgttgaagga
cggcacccaccagtaaacatcctcttccacgccacggcgggtatattttgccggtgaggt
ttccagtctgatgaccttaccggtggtgctgtaacgcttttccagaaacgcattaccgaa
caccagaaaatccagcacaaagcggctgaaatcctgctgggaaagccatggatgcgggat
aaatgtcgaggccagaatattgcgtttgacgtaaatcggcgagctgtgatgcacggcagc
ccgcaggctttttgccagaccggtaaagctgaccggtggctcataccatctgccgttact
gatgcactcgacgtaatccagaatgtcacggcggtcgagtaccggcaccggctcaccaaa
ggtgaatgcctccattttcgggccgctggcggtcattgtttttgccgcaggttgcggtgt
tttcccttttttcttgctcatcagtaaaactccagaatggtggatgtcagcggggtgctg
ataccggcggtgagtggctcatttaacagggcgtgcatggtcgcccaggcgaggtcggcg
tggctggcttcctcgctgcggctggcctcataggtggcgctgcgtccgctgctggtcatg
gtcttgcggatagccataaacgagctggtgatgtcggtggcgctgacgtcgtattccaga
cagccacggcggataacgtcttttgccttgagcaccattgcggttttcatttccggcgtg
tagcggatatcacgcgcggcgggatagaacgagcgcacgagctggaacacgccgacaccg
aggccggtggcatcaataccgatgtattcgacgttgtatttttcggtgagtttgcggatg
gattccgcctgggtggcaaagtccatgcctttccactggtgacgctcaagtattctgaat
ttgccaccggccaccaccggcggtgccagtaccacgcatccggcgctgtcgccacggtgt
gacgggtcgtaaccaatccataccgggcgggagccgaacggattggcggcaaacggcgca
tagtcttcccattcttccagcgtgtcgaccatgcagcgttgcagctcctcgaacgggaac
accgatgccttgtcgtcaacaaattcacacatgaacaggtttttaaaatcgtcggcgctg
ttttcgcgtttgagctgctcaatgtcgaacagcgtgcagccgcctttcagggcgtcctca
atggtgacaatctgtcgccactggccgtccgcacagagaagcccaccggcaagggcgtta
tgactgacgtcgatttccacgcgttcggcggcgctggcgcgtccccggttaaacagttca
cccgaccagaacgggtaggcgtcgtgcgccagcgtggacggggtggagaaataggtcgag
cgcaggtgactctgtgaggccatacctgatgccaccttacgcagtacctgaaaattcggg
atccagaaaatctcatcgacgtacaggtcgccgttatgactctgcgcggtgttggagttg
gtgccgagaaaaatcagttttgcgccgttattgcccaggacaatcgggtcaccggtcagg
tcaacgtcaaccagacgggcaaaggcgatgatgtattcgcggaacacatacgcctgtgtt
ttactggccgacagaaaaatctggttatgaccggttttcagggcacgcagcagcgcctcg
cgggaaaaataaaacgtcgcgccaatctggcgggatttcaggatatcgcggatgcggtgc
tcaagcccggcacgataccagtgcagctgatagtcgaaagactgctcaaagaaaatctgc
tccagcttttcgatggcctcgtcactgaaaaaattctttttcggtttgcgccgtccgcct
ttgttacggttagcgacgttcggattaaggtctgcctcgttgccggtctggctgtagcgg
ttgacccgtgccagtcgttcaatctggcgtcccagcaggtcaatttccttgaagtcaccg
ccggttttctgtggtttgatgatgagctgggtcagccgcgcttccagactcatttcgaca
cggctgatgggggcaacgctgtcccagccgtcgcgctgtttccagctctgcactgtcggg
cgtttcatctgcaacatggcggcaatctgcggcacggaaaacccctgccagtacagcagc
gccgcctgacgacgcgggtcgtgtaaaagagtggtgtctgtggtgatggtcatgaatacc
tcgccgtgatgaatacacggcaaggctactgagtcgcgccccgcgattcgctaaggtgct
gttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaact
gatgccgacatgtgactcctctaatcactattcaggactcctgacaatggcaaaaaaagt
ctcaaaattctttcgtatcggcgttgagggtgacacctgtgacgggcgtgtcatcagtgc
gcaggatattcaggaaatggccgaaacctttgacccgcgtgtctatggttgccgcattaa
cctggaacatctgcgcggcatcctgcctgacggtatttttaagcgttatggcgatgtggc
cgaactgaaggccgaaaagattgacgatgattcggcgctgaaaggcaaatgggcgctgtt
tgcgaaaatcaccccgaccgatgaccttatcgcgatgaacaaggccgcgcagaaggtcta
cacctcaatggaaattcagccgaactttgccaacaccggcaaatgttatctggtgggtct
ggccgtcaccgatgacccggcaagcctcggcacggaatacctggaattctgccgcacggc
aaaacacaaccccctgaaccgcttcaaattaagccctgaaaacctgatttcagtggcaac
gcctgttgagctggaatttgaagacctgcctgaaaccgtgttcaccgccctgaccgaaaa
ggtgaagtccatttttggccgcaaacaggccagcgatgatgcccgtctgaatgacgtgca
tgaagcggtgaccgctgttgctgaacatgtgcaggaaaaactgagcgccactgagcagcg
cctcgctgagatggaaaccgccttttctgcacttaagcaggaggtgactgacagggcgga
tgaaaccagccaggcattcacccgcctgaaaaacagtctcgaccacaccgaaagtctgac
ccagcagcgccgcagcaaagccaccggcggtggcggtgacgccctgatgacgaactgctg
accggcgtcagtcagtccgggaaaaccttcacgattaacccttaatttcaggaaaaacta
tgcgccaggaaacccgctttaaatttaatgcctacctgtcccgtgttgccgaactgaacg
gcatcgacgccggtgatgtgtcgaaaaaattcaccgttgaaccgtcggtcacccagaccc
tgatgaacaccatgcaggagtcctctgactttctgacccgcatcaatattgtgccggtca
gcgaaatgaaaggggaaaaaattggtatcggtgtcaccggctccatcgccagcactaccg
acactgccggtggtaccgagcgtcagccgaaggacttctcgaagctggcgtcaaacaagt
acgaatgcgaccagattaacttcgatttttatatccgctacaaaacgctggacctgtggg
cgcgttatcaggatttccagctccgtatccgtaacgccattatcaaacgccagtcccttg
atttcatcatggccggttttaacggcgtgaagcgtgccgaaacctctgaccgcagcagca
atccgatgttgcaggatgtggcggtcggctggctgcagaaataccgcaatgaagcaccgg
cgcgcgtgatgagcaaggtcactgacgaggaaggccgcaccacctctgaggttatccgcg
tgggtaagggcggtgattatgccagccttgatgcactggtgatggatgcgaccaacaacc
tgattgaaccgtggtatcaggaagaccctgaccttgtggtgattgtggggcgtcagctac
tggcggacaagtatttccccatcgtcaacaaggagcaggacaacagcgaaatgctggccg
ctgacgtcatcatcagccagaaacgcatcggtaacctaccagcggtacgcgtcccgtact
tcccggcggatgcgatgctcatcacgaagctggaaaacctgtccatctactacatggatg
acagccatcgccgcgtgattgaggaaaacccgaaactcgaccgcgtggagaactacgagt
caatgaacattgattacgtggtggaagactacgccgccggttgtctggtggaaaaaatca
aggtcggtgacttctccacaccggctaaggcgaccgcagagccgggagcgtaaccgatga
cgagtcccgcacagcgccacatgatgcgggtctcggcagcgatgaccgcgcagcgggaag
ccgccccgctgcgacatgcaactgtctatgagcagatgctggttaagctcgccgcagacc
agcgcacactgaaagcgatttactcaaaagagctgaaggccgcaaaaaaacgcgaactgc
tgccgttctggttgccgtgggtgaacggcgtgctggagctgggcaaaggtgcacaggatg
acattctgatgacggtcatgctgtggcgtctggataccggcgatattgccggtgcgctgg
agattgcccgttatgccctgaagtacggtctgaccatgccgggtaaacaccgccgtaccc
cgccgtacatgttcaccgaggaggtagcgcttgcggccatgcgcgctcacgctgccggtg
agtctgtggatacccgcctgctgacggagacccttgaactgaccgccacggctgacatgc
ctgatgaagtgcgcgcaaagctgcacaaaatcaccggtctgtttctgcgtgacggtggtg
atgccgccggtgcgctggcgcacctgcaacgtgcgacacagctcgactgtcaggcaggcg
tcaaaaaagagattgaacgactggagcgggagctgaaaccgaagccggagccgcagccca
aagcggccacccgcgccccgcgtaagacccggagcgtgacaccggcaaaacgtggacgcc
cgaaaaagaaagccagttaacaaccgaatgcgccccgcgccagggcggcacgccggtcag
tgacggtgaatcacctgacactgcaccggcgtccaccgcccgacttttcagaggtagtca
tgatgacgctgattattccgcgaaaggaggctcccgtgtccggtgagggtacggtggtca
tcccgcaaccggcaggcgacgagccggtgattaaaaacacgttcttttttcccgatatcg
acccgaagcgcgtccgggaacgtatgcgccttgagcagaccgtcgcccccgcccgtctgc
gtgaggccatcaagtcaggcatggctgaaacgaatgcggagctgtacgagtaccgcgaac
agaaaattgccgccggttttacgcgtctggctgacgtcccggcggacgatatcgacggtg
aaagcatcaaggttttttactacgagcgcgccgtgtgtgcgatggcgaccgcgtcgcttt
atgagcgttatcgcggtgtggatgccagtgcgaaaggcgacaagaaggctgacagcattg
acagcaccattgatgagctgtggcgggatatgcgctgggcggtggcgcgcatccagggca
agccgcgctgcatcgtgagtcaaatctgatgaagacctttgcgctacagggcgacacgct
cgacgccatttgtgtccgctattacgggcgcactgagggcgtggttgagaccgtgctcgc
cgcaaatccgggactggctgaactgggggcggtgctgccacacggcaccgccgtcgaact
gcccgacgttcagaccgcgcccgtggctgaaactgtcaatctgtgggagtaacgcatgac
agcagaagaaaaaagcgtcctgtcgcttttcatgattggggtgctgattgttgtcggcaa
ggtgcttgccggtggtgaacctatcaccccgcgtctgtttatcgggcgcatgttgctcgg
tggttttgtctcgatggttgccggtgttgttctggtgcagtttcctgacctgtcactgcc
agcggtgtgcggcatcggctccatgctgggtatcgccggttatcaggtgattgagattgc
cattcagcgccgctttaagggcagggggaaacagtaatgccggtaattaacacgcatcag
aatatcgccgcctttctcgacatgctggccgtgtccgaagggacggcgaatcatccactg
acgaaaaaccggggctatgacgtgatagtcaccggactggacgggaagccggaaattttc
accgactacagtgaccacccgttcgcacatggccgaccggcgaaggtgtttaaccgtcgc
ggtgaaaaatccacggcctccggtcgctatcagcagctttacctgttctggccgcattac
cgcaaacagcttgccctgccggatttcagtccgttgtcacaggacagactcgccattcag
ttgatccgcgaacgcggagcactggatgacatccgggcgggacgcattgagcgcgccatt
tcacgctgtcgcaatatctgggcgtccctgccgggtgccggttacggtcagcgtgagcat
tcactggaaaaactggtcaccgtctggcgtaccgctggcggcgtaccggcttaaacggag
taaataccatgaagaaattatccctttcactgatgctgaacgtgtcgctggcgctgatgc
tggcactgtccctgatttacccgcagagcgtggccgtcaattttgtcgctgcctgggcga
ttctggcgacggttatctgtgtggttgccggtggtgtgggcgtgtatgccactgagtatg
tgctggaacgctacgggcgggagctgccgccggaatcgctggccgtgaagattgtcacgt
cgctgtttttgcagccggtgccgtggcgcagacgggcggcggctctggtagtggtggtgg
cgacgtttatctcgctggtcgctgccgggtggatttttaccgcgctgatttatcttgtgg
tgtcgctgtttttccggctgatacgtaaagcctgtcgtcagcgtcttgaggggcgggaac
catgtcaaggctgatgattgtgctggtcgtgttgttatcgctggcggtggccggtctgtt
tctggtgaaacacaaaaatgccagcctgcgcgcctcgctggacagggcgaacaacgtcgc
cagcggtcagcagacgaccatcaccatgctgaaaaatcagcttcatgttgcgctcaccag
ggcagataaaaacgagctggcgcaggtggcactgcgtcaggaactggagaacgccgcgaa
acgtgaagcacagcgcgagaaaaccatcacgaggttacttaatgagaacgaagattttcg
ccgctggtacggtgctgacctgcctgatgctgtgcgccggttgcaccagcgccccgcctg
caccgacgccagtgattgtccccaacgcatgcccgaaagtgagcctttgcccgatgccgg
gcagtgacccgcagacgaacggcgatttaagtgccgatatccggcagcttgagaacgcgc
tggcacgctgtgccagccaggtaaaaatgattaaacactgtcaggacgaaaacgatgctc
aaacccgacagcctgcgcagggcgctgactgatgccgtcacggtgctgaaaactaacccc
gatatgctgcggatattcgtggataacgggagtattgcctccacactggcggcgtcgctg
tcattcgaaaagcgttacacgctcaatgtgattgtgaccgactttaccggtgattttgac
ctgctcattgtgccggtgctggcgtggctgcgggaaaatcagcccgacatcatgaccacc
gacgaaggccagaaaaagggcttcacgttttatgcagacatcaacaatgacagcagcttt
gatatcagtatcagcctgatgctgaccgagcgcacgctggtcagtgaggtggacggcgca
ctgcatgtgaagaatatctcggaacccccgccgccggagccggtcacccgcccgatggag
ctgtatatcaatggcgaactggtgagtaagtgggatgaatgagtttaagcgttttgaaga
ccggctgaccggactgattgaatcgctgtcaccgtcagggcgtcggcgactgagtgccga
actggcgaaacgtctgcggcagagtcagcagcgtcgggtgatggcacagaaagccccgga
cggcacaccctacgcgccacgccagcagcagagcgtcagaaaaaagaccggtcgcgttaa
gcgaaaaatgtttgcgaaacttattaccagtcgttttttgcatatccgtgccagcccgga
gcaggcatcaatggaattttacggcgggaagtcgccgaaaatcgccagtgtgcatcagtt
tggtctgtcggaagaaaaccggaaagacggtaagaaaattgattatccggcgcgtcccct
gctcggctttaccggtgaggatgtgcagatgattgaagagattatcctggctcaccttga
gcgttagttttatccaggcagaggctgatgcgcaattaaacattgagcggccatgctggt
cgctcaatgtttagaggtttatgagtgatttttatttgatgctttgtattctaaaacctt
cttattggcgtaaaagaattttgtatatgacaggaatataaccagacctgaagtgaaata
gacgagggatagtattaataatgcttttttgtgactgttattatctttaatctcctggct
taaccattcggagtcctcctcgtttagctgtaagagcttattgcaggcgatctcaggaag
tgtgtcttttataaatacgttttgcagtctcttgcaatcggcaaggctataagttttatt
aaattcaactgctttatttttgaaggataaaagaactttgtcactataaacatagtacat
catgtttttatatggtatgcctgtggcatcccttactataacggattgttcgttgtgtat
gtaacatgcgaggagaatgtaaaaaatactggccagaattacaattattgttttaattat
gtgtggtggttttgttatgtcaccccagatacgagtaaggaaaaaatacgatgtttttag
ttttccatcaatcagtccctgctgtatcattctcacattttcaatgcctgatacattgat
tccgttaattattttaaatagttgaatgtcgcgccactcgcggtcaagtctttttaattt
tttgtctgaatatccaaaattgaaataatgtgcaataagcctcataaggttacttttacc
aaagctaaaaaatgctaatactgcaaagctacaaaggaaaaaaacgattagcccccacac
attagtcacattatagctgaccattacgctctccttgaatgttgtctggtagttctacaa
atgaatccagatagcataacttttatatattgtgcaatctcacatgcatgaacactctcg
caaatattcaggaactcgcgcgcgcactgcgcaacatgattcgcactggcattatcgtcg
aaaccgaccttaacgccggtcgctgccgcgtgcagaccggcggcatgtgcaccgactggc
ttcagtggctgacccatcgcgcaggacgttcgcgcacatggtgggcaccttccgtggggg
aacaggtgctgattctggccgtgggtggtgaactcgacacggcgttcgttctgccgggga
tttattccggcgataacccctcgccgtctgtgtcggcggatgccctgcatatccgtttcc
ctgacggggcggtgattgaatatgaacccgaaaccagtgcactcacggtaagcggaatta
aaacggccagcgtgacggcttccggttctgttactgccacggtgccggtggtcatggtga
aagcatcaacccgcgtcaccctggacaccccggaggtggtctgcaccaacaggctgatta
ccggcacgctggaagtgcagaaaggcgggacgatgcgcggcaacattgaacacaccggcg
gtgaactctcatcaaacggtaaggtactgcatacccataaacaccccggcgacagcggcg
gcacaaccgggagtcctttatgacagcgcgttatctcggaatgaatcgcagtgatggcct
gactgtcactgaccttgagcatatcagccagagtatcggcgatatcctgcgcacaccggt
cggctcacgggtgatgcgtcgtgattacggctcgttgctggcgtcaatgattgaccagcc
gcagaccccggcgcttgagttgcagattaaagtcgcctgttacatggcagtgctgaaatg
ggaaccccgcgtcaccctgtcatccgtcaccacggcgcgcagttttgacgggcgaatgac
ggtcacgttaaccggccagcacaacgacaccggccagccactttcattaaccatccctgt
gagttgaaaccatgccgattatcgacctgaaccagctacccgcaccggatgtggtcgagg
agctggactttgaaagcattctcgctgaacgcaaggcgacactgatttccctttacccgg
aagatcagcaggaggcggtcgcccgtaccctgacactggaatctgagcctctcgtcaaac
tgctggaagaaaatgcttatcgtgagcttatctggcgtcagcgtgtgaatgaggccgcac
gggcggtgatgctggcctgtgccgccggtaatgaccttgatgtgattggtgccaattaca
acaccacgcgcctgactatcaccccggcagatgattcgaccatcccgccgacaccggcag
tgatggaatctgacaccgattatcgtctgcgtattcagcaggcttttgagggcttaagcg
tcgccgggtcagtgggagcctatcagtatcatggtcgcagtgctgacgggcgtgtcgcgg
atatttctgtcaccagtccgtctccggcctgtgtcaccatctctgtgctgtcacgtgaaa
ataacggcgtcgcatccgaagacctgctggctgtggtgcgtaacgcccttaatggcgagg
acgtcaggccggtggccgaccgcgtgaccgtgcagtctgccgccatcgttgaataccaga
taaacgccacgctttacctttaccctggtcccgaaagcgaacccatccgcgctgccgctg
tgaaaaagctggaagcgtatatcacggcacagcaccggctggggcgcgacatccgtctgt
ctgccatttatgccgctttgcatgtggaaggtgtgcagcgtgtcgaactggctgcaccac
tggccgacatcgtgctcaacagtacgcaggcgtctttctgtaccgaataccgcgtcgtga
ccggaggctcggatgagtgattcgcgactgctgccgaccggctcatcaccgcttgaggtc
gccgccgcaaaagcctgtgcggaaattgaaaaaacgccggtcagtattcgtgaactgtgg
aacccggacacctgtccggcaaatctgctgccgtggctggcgtgggcgttttcggtcgac
aggtgggatgaaaagtggccggaagcgacaaaacgcgccgttatccgcgatgcctatttc
atccactgtcataagggcacgataggtgcaatccggcgtgtggtggagccgctcggctat
ctcatcaacgtgacggagtggtgggaaaacagtgacccgcccggcaccttccggcttgat
attggtgtactggaaagcggtatcacagaggcaatgtatcaggaaatggaacggctgatt
gctgatgccaaacctgcaagccgtcaccttattggcctgaacattacccgggacattccc
ggctatctgttcgccggtggtgtggcttacgacggcgatgtaattacggtttaccccgga
taagtgaggaataatgagcataaaattcagaaccgttatcaccactgccggtgcagcaaa
gctggcagcggcaaccgcgccgggaaggcggaaggtcggcattaccacgatggccgtcgg
ggatggcggtggtaaattgcctgtcccggatgccggacagaccgggcttatccatgaagt
ctggcgacatgcgctgaacaaaatcagccaggacaaacgaaacagtaattatattatcgc
cgagctggttattccgccggaggtgggcggtttctggatgcgtgagcttggcctgtacga
tgatgcgggaacgttaattgccgtggcgaacatggccgaaagctataagccagcccttgc
cgaaggctcaggacgttggcagacctgtcgcatggtcatcatcgtcagcagtgtggcctc
agtggagctgaccattgacaccacaacggtgatggcgacgcaggattacgttgatgacaa
aattgcagagcacgaacagtcacgacgtcacccggacgcctcgctgacagcaaaaggttt
tactcagttaagcagtgcgaccaacagcacgtctgaaacactggccgcaacgccgaaagc
ggtaaaggccgcgtatgacctggctaacgggaaatataccgcacaggacgccaccacagc
gcgaaaaggccttgtccagcttagtagcgccaccaacagcacgtctgaaacgctcgccgc
aacaccaaaagccgttaagacggtaatggatgaaacgaacaaaaaagcgccattaaacag
ccctgcactgaccggaacgccaacgacgccaactgcgcgacagggaacgaataatactca
gatcgcaaacacggctttcgttatggccgcgattgccgcccttgtagactcgtcgcctga
cgcactgaatacgctgaacgagctggcggcggcgctgggcaatgacccgaattttgctac
caccatgactaatgcgcttgcgggtaagcaaccgaaagatgctaccctgacggcgctggc
ggggcttgctactgcggcagacaggtttccgtattttacggggaatgatgttgccagcct
ggcgaccctgacaaaagtcgggcgggatattctggctaaatcgaccgttgccgccgttat
cgaatatctcggtttacaggaaacggtaaaccgagccgggaacgccgtgcaaaaaaatgg
cgataccttgtccggtggacttacttttgaaaacgactcaatccttgcctggattcgaaa
tactgactgggcgaagattggatttaaaaatgatgccgatggtgacactgattcatacat
gtggtttgaaacgggggataacggcaatgaatatttcaaatggagaagccgccagagtac
cacaacaaaagacctgatgacgttgaaatgggatgcactaaatattcttgttaatgccgt
cattaatggctgttttggagttggtacgacgaatgcactaggtggtagctctattgttct
tggtgataatgataccggatttaaacagaatggagacggtattcttgatgtttatgctaa
cagtcagcgtgtattccgttttcagaatggagtggctattgcttttaaaaatattcaggc
aggtgatagtaaaaagttctcgctatccagctctaatacatccacgaagaatattacctt
taatttatggggtgcttccacccgtccagtggttgcagagttaggcgatgaggccggatg
gcatttctatagccagcgaaatacagataactcggtaatatttgctgttaacggtcagat
gcaacccagcaactggggaaattttgattcccgctatgtgaaagatgttcgcctgggtac
gcgagttgttcaattgatggcgcgaggtggtcgttatgaaaaagccggacacacgattac
cggattaagaatcattggtgaagtagatggcgatgatgaagccatcttcaggccgataca
aaaatacatcaatggcacatggtataacgttgcgcaggtgtaagttatgcagcatttaaa
gaacattaagtcaggtaatccaaaaacaaaagagcaatatcagctaacaaagaattttga
tgttatctggttatggtccgaagacggaaaaaactggtatgaggaagtgaagaactttca
gccagacacaataaagattgtttacgatgaaaataatattattgtcgctatcaccagaga
tgcttcaacgcttaatcctgaaggttttagcgttgttgaggttcctgatattacctccaa
ccgacgtgctgacgactcaggtaaatggatgtttaaggatggtgctgtggttaaacggat
ttatacggcagatgaacagcaacaacaggcagaatcacaaaaggccgcgttactttccga
agcggaaaacgttattcagccactggaacgcgctgtcaggctgaatatggcgacggatga
ggaacgtgcacgactggagtcatgggaacgttacagcgttctggtcagccgtgtggatcc
tgcaaatcctgaatggccggaaatgccgcaataagttgtatgacctctgttgtgaactta
catatctatggcacagagtaaagcctaatctgaagtccactctgtgccaaaagcggacct
tataaacaagaacaatggtcatatcagtgtgttttgattgcatagctaacgtgcgtcttc
ctgtacagaatcataagatgatagggcataggagatgattattatcgcgtgttttaaaaa
tagctttctgcatcaagtgtcacttgcgaagaggtattggcgctatgattggcatcactc
agttcagataatattttaaatatttggtaaatgttcagattacacaattcggtctgcgtc
ccgttaaaattatctactattagttattactatgaggtgaatggcaagtgttttccactc
gccatttttgttttttatttttttaaagcctttccgacgtttaaggattttgccaagcca
taaaatatttgatatttcattcctgtttttatttttggtgagatatttgcgtaacttctt
tctctaaaacaccaacgtataaacctattattatcttcggttgtttctatatagcatatt
acattgagaccaaaaagaaactgaaggaagtcatttgcagttgtcatgaattttggtttt
gttgtggaaatggaactaatatgagtttcaagttgtttatatgctaagaggtattcagcg
taatcaaaagtatcttttccagagaggaattcaaagaactttaaaaaaatctcataatgt
tcacttccataataaaatgataaatgatcttttatttctccaagtaaatagttagagtaa
tctctttgcatgctaggactttcaaagtcatctagactaaattgatttttcccatcatca
ccgctggcgtgtgatttgataatttcgagcatccgtaatatatctcttgggcgataatat
gaccagcgaaggaaattaataaatgatgtggggtggttataattatcatggacgttgggt
gaatcccaagggaaataatggtcccatgcctgtccctttttaagggccatgtcttgctga
gtcctaagcagatgatctaatacctcaaataattgagagctacggtggttaacatattct
gtccgccagtccaagaatactgaattatctctgatttttgcgttttgattttgtaatcct
atggattcaaatatatctggcctgatcaagagaacggccttcattctcccttttcctccc
tttatacttgggaagaaatcgttgttaatctcccagactgcgtgagctaatccttttata
cattctagataatcatcgtatggaattgaggaagggcggatatcaataccatcgataaat
aaaatatgattttgagataaacgtatttggctaaaggcctcttcaaattttttttgtata
taaaataaatttatctgaaatctgctctcagaaaaagataaagactctctttcttcacct
tttaaggttgcatgcttatgaagtagttcggctgcaacttttgactcttgaacaaaactg
agggcttgaattatttctggtgaaaatgccttaagataatactcatctattgcatcatta
agtgatgagaattttgaataatttagtaactttgaaattttcccttctttatctaatact
tgttttgatattaataaatatagaataactttccatatgccagagaagtcagacaaattt
aaatgcttttcagatttaagagtgataaatttttgatattctgtctctcttatatattta
gttgtagctagcgtattgttaatattgttatttgagagatagatagagtatgcggtttta
ccagtacctttctctcctacaagaaacgatatatttggttcacataatctagataggtga
ttatcacgtatgaacactttgttaagtaattctttattctcccttctcttataattttca
gcatcagcatagccaagagttagatctttgattggtatcattattacctcaactaaagca
attgaaaaacatatggttataaaaacatagcgctgctctgtcgcatattgtggatatcaa
catatgaaatgtaaaggaactatttgtggatgaatgaaccgaatcgctgtagcttcggta
gtcatctttcagacttgtataaatgaacaacttccgcttctcgctcaaaggaaactgtca
gatttgatagcttttgggctatgtaaactgtcagtcggaaaatgagtgagtacaaatcag
ggcaggtgagcgaattgcccgccttttctttaccggtggttgtgctgtcgattagccaac
cgggacaaatagcctgacatctccggcgcaactgaaaataccactcacccattaaccacg
gagttaaacggatgagtgactatcatcacggcgtgcaggtgctggagattaacgagggca
cccgcgtcatttccaccgtatccacggccattgtcggcatggtctgcacggccagcgatg
cagatgcggaaaccttccccctcaataaacctgtgctgattaccaatgtgcagagcgcaa
tttcaaaggccggtaaaaaaggcacgctggcggcatcgttgcaggccatcgctgaccagt
caaaaccggtcaccgttgtcatgcgcgtggaagacggcaccggtgatgacgaggaaacga
aactcgcgcagaccgtttccaatatcatcggcaccaccgatgaaaacggtcagtacaccg
gactaaaagccatgctggcggcggagtcggtaaccggtgttaaaccgcgtattctcggcg
tgccgggactggataccaaagaggtggctgttgcactggcatcagtctgtcagaagctgc
gtgctttcgggtatatcagcgcatggggctgtaaaaccatttccgaggtgaaagcctatc
gtcagaatttcagccagcgtgagctgatggtcatctggccggatttcctcgcatgggata
cggtcaccagtaccaccgccaccgcgtatgccaccgcccgtgcgctggggctgcgcgcta
aaatcgaccaggagcagggctggcataaaacgctgtccaatgtcggggtgaacggtgtta
ccggcatcagcgcatctgtattctgggatttgcaggagtccggcaccgatgctgacctgc
ttaacgagtcaggcgtcactacgctgattcgccgcgacggtttccgcttctggggtaacc
gtacctgctctgatgacccgctgttcctctttgaaaactacacccgcaccgcgcaggtcg
tggccgacacgatggctgaggcgcacatgtgggcggtggacaagcccatcactgcaacgc
tgattcgcgacatcgttgacggcatcaatgccaaattccgtgagctgaaaacaaacggct
atatcgtggatgcgacctgctggttcagcgaagaatccaacgatgcggaaaccctcaagg
ccggaaaactgtatatcgactacgactatacaccggtgcctcctctcgaaaacctgaccc
tgcgccagcgtattaccgataaatacctggcaaatctggtcacctcggttaacagcaatt
aaggagcctgaccgatggcaatgccgcgcaaactcaagttaatgaacgtctttctgaacg
gctacagctatcagggcgttgcaaagtccgtcacgctgccaaaactgacccgtaagctcg
aaaactatcgcggtgcggggatgaacggcagcgcaccggtagacctcggccttgatgacg
atgcgctgtcaatggagtggtcgctcggtggcttcccggattcggttatctgggagcttt
acgccgcaaccggtgtggatgccgtgccgattcgttttgcaggctcttaccagcgcgacg
ataccggcgaaacggtggccgtcgaagtggtcatgcgtggacgtcagaaagaaatcgaca
ccggcgagggtaaacagggagaagacactgagtcgaaaatctccgtggtctgcacctatt
tccggctgacgatggacggtaaggagctggtcgaaattgacaccatcaacatgattgaga
aggtgaacggcgtcgatcggctggagcaacaccgccgcaatatcggcctgtgattttcat
ccggtcagcctggctggccggttaaccctgattcagaagtgagaaaaccatgaacaaaga
aaatgtcattaccctggacaatccggtcaaacgtggtgagcaggttatcgaacaggtcac
gctgatgaaacccagtgccgggacgctacgcggtgtcagtctggctgcggttgcaaactc
cgaagtcgatgcactgattaaggtgctgccgcgcatgacggcaccgatgctgaccgagca
ggaagtcgccgcgctggaactgcctgaccttgtggcgctggccggtaaggtggtcggttt
tttgtcgccgaactcggtgcagtgacgtttccgaaaaatctctcggtcgatgacctgatg
gcggatgtggcagtgatatttcactggccgccatcagaactgtatcccatgagcctgacc
gaactcatcacatggcgcgaaaaggcgctccggcgaagcggaaacacgaatgagtaacaa
tgtaaaattacaggtattgctcagggctgttgaccaggcatcccgcccgtttaaatccat
ccgcacagcgagcaagtcgctgtcgggggatatccgggaaacacaaaaatcactgcgcga
gctgaacggtcacgcatcccgtattgagggattccgcaagaccagtgcacagctcgccgt
gactggtcatgcacttgaaaaggcacggcaggaggccgaagcccttgccacacagtttaa
aaacaccgaacgtccgacccgtgctcaggcgaaagtcctggaatccgcaaagcgtgcggc
ggaggacttacaggcgaaatataaccgcctgacagattccgttaaacgccagcagcggga
actggccgctgtgggaattaatacccgcaatcttgcacatgatgagcagggactgaaaaa
ccgtatcagtgaaaccaccgcacagcttaaccgtcagcgtgatgcgctggtgcgtgtcag
tgcgcaacaggcaaaacttaacgcagtaaaacagcgttatcaggccggaaaggaactggc
cggaaatatggcctcagtgggcgctgccggtgtggggattgcggcggcgggaacgatggc
cggtgttaagctactgatgcccggttatgagtttgcgcagaaaaactcagaattacaggc
tgtgatcggagtggcaaaagactccgccgaaatggccgcactccgcaagcaggcgcgcca
gctcggcgacaataccgccgcctcggcagatgatgcagccggtgcgcagattattattgc
gaaagccggtggggatgttgatgccattcaggcggcaacgccggtcacgctgaacatggc
gctggcgaaccgtcgcacaatggaagaaaacgccgccctgctgatggggatgaaatccgc
ctttcagctttcaaacgataaggtcgctcatatcggggatgttctctccatgacgatgaa
caaaaccgccgccgattttgacggcatgagcgatgcgctgacctatgccgcacctgtggc
aaaaaatgccggtgtcagcattgaagaaaccgccgcaatggtcggggcgctgcatgatgc
aaaaatcacaggctcaatggcggggacgggaagccgtgccgtgttaagccgcctgcaggc
accgacgggaaaagcatgggatgcactcaaagagcttggagtgaaaacctcagacagcaa
aggaaacacccggccaatatttaccattctgaaagaaatgcaggccagttttgagaaaaa
ccggctcggtactgcccagcaggctgaatacatgaaaactattttcggggaggaggccag
ctcagccgctgccgtgctgatgactgccgcctcaaccggaaagctggacaaactgaccgc
tgcgtttaaagcctcagacgggaagaccgccgagctggtaaatatcatgcaggacaacct
aggcggtgactttaaagcgtttcagtccgcttatgaggcggtggggactgacctgtttga
ccagcaggaaggcgcgctgcgtaagctcacgcagacggccacaaagtatgtgttaaaact
cgacggctggatacagaaaaacaaatcactggcgtcaaccatcggcatcattgccggcgg
tgcactggcgcttactggcatcatcggtgccattggcctcgtagcctggccggttatcac
cggcatcaatgccatcatcgcggcagcaggcgcaatgggggcagtcttcacgacggttgg
cagtgctgttatgaccgccatcggggctattagctggccggttgtggccgtggtggctgc
cattgtcgccggtgcgttgcttatccgtaaatactgggagcctgtcagcgcattctttgg
tggtgtggttgaagggctgaaagcggcatttgcgccggtgggggaactgttcacgccact
taaaccggtttttgactggctgggcgaaaagttacaggccgcgtggcagtggtttaaaaa
cctgattgccccggtcaaagccacccaggacaccctgaaccgttgccgtgacacgggcgt
catgttcgggcaggcactggctgacgcgttgatgctgccgcttaatgcgttcaacaaact
gcgcagtggtattgactgggtactggaaaaactcggtgttatcaacaaagagtcagacac
acttgaccagaccgccgccagaactcataccgccacgtatggtaccggtgactatattcc
ggcgaccagctcttatgcaggctatcaggcttatcagccggtcacggcaccggctggccg
ctcttatgtagaccagagtaaaaacgaatatcacatcagcctgacgggggggactgcgcc
ggggacacagcttgaccgccagttacaggatgcgctcgaaaaatacgagcgggataaacg
tgcgcgcgcccgtgccagcatgatgcatgacggttaaggaggtgacgaaaaatgatgctc
gcgttaggtatgtttgtttttatgcgccagacgctgccacaccagaccatgcagcgtgaa
tcagattatcgctggccgtcaaattcccgtatcggtaaacgggatgcctttcagtttctc
ggtgtgggtgaggaaaacatcacgctggccggtgtgctttatcccgaactgaccggcggc
aagctgacgatgaccacgctcaggctgatggcagaggaggggcgggcgtggccgttgctg
gatggcaccggcatgatttacggcatgtatgtcatcagcagggtgagtgaaacagggagt
attttctttgcagacggcacaccccggaaaattgattttacgctgtcactcacccgcgtt
gatgaatcactggccgcgctttatggcgatatcggtaaacaggcggaatcgctcatcggt
aaggccggcagtatggcgaccagattcacaggtatgacgggggcgggataatgctggatg
cgctgacatttgatgcaggcagtacgctgacgccggattacatgctgatgctcgacagca
gggatattaccggcaatatcagcgaccgtctgatgagcatgaccctgacggataaccggg
gctttgaggctgaccagcttgatattgaactgaacgatgccgacgggcaggtcgggctgc
cggttcgtggcgctgtcctgacggtgtatatcggctggaaaggttttgccctggtatgca
aagggaaatttaccgttgatgaggttgaacaccggggcgcaccggatgtagtcaccatcc
gcgcccggagtgcagattttcgcgggacgctcaattcccgccgggaaggctcctggcatg
acaccacgctcggtgcgattgttaaggcgatagccacccgtaacaggctggaagccagtg
tcgctccgtcactggccggaataaaaattccacacatcgaccagtcgcaggagtctgatg
cgaaattcctgacccgtcttgcagaacgcaacggcggtgaggtgtcggtaaaaatgggaa
aactgttgtttctcaaagcggggcagggagtgacggccagcggtaaaaaaatcccgcagg
tcaccataacccgcagcgacggcgaccgccatcattttgcgattgctgaccgtggagcct
acaccggtgtaacggcaaaatggctacacactaaagacccgaagccgcaaaagcagaagg
taaaactgaaacgcaaaaagaaagagaaacacctgcgcgcactggagcacccgaaagcga
aaccggtcaggcagaagaaagcgcctaaagtaccggaagcgcgtgaaggtgaatacatgg
ccggtgaggctgacaacgtttttgccctgaccacggtatatgccacgaaagcgcaggcca
tgcgcgccgctcaggcgaagtgggataaactgcaacggggcgttgcggagttctctatca
gcctggctaccggtcgggcagatatttacacggaaacaccggtcaaagtgtctggcttta
agcgcgtcatagacgagcaggactggacaatcactaaggtgacacattttctgaataata
gcggcttcacgacgtccttagagcttgaggtcaggctttctgatgtggagtacgaaacag
aagatgatgagtgatgtttttgttttatctgtttgttttgtaaggataaattaactaaaa
tggcaccatcaacaaaaccggaagaggtgctcgcgatgtttcattgtcctttatgccagc
atgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatc
agtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgataca
tcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaa
ttatgtggatgtaattacaaacagaaagcccctcagtcgaggggcttttttgtcgatgtg
gtcaatgtgtggacgtgaccagaaataaatccttttatttcaatttattgtacgtaaaaa
ataagcccgtgtaagggagatttagggtgtcaccagtaggggctttcaacggtacaatgc
gggtttgagcggcataaattaccactgaaagcccttaaacgttactctactgtggacact
gtgtggacactctcggcctcagtaccacctcttagcggattaagagaaatggcgtcctga
aggtactctggcgcaaaatgagcgtaaaccatagtttgctcaatccgcgtgtgacctagt
atccgttgtagcgtgataatacttcctccattaatcatgaaatgagtggcaaagctgtgc
cttagtgcatgtgtggcttgccccattggcaaatccggttttattgctttcattgttcgt
ctgaagcgagggtaatcagcatcagggaataaaaaacctcgtttgttatccgcgatcatt
ttggcaacagcctctgagatcgggacggtgcgtggtttgtttgttttcgttttaacaaac
gtgacgcggttatggatgatattttctgctttcaaacgagctgcttctccccaacgtgct
cctgtactcaggcaaagaatcgcaatctttttattgtcgccgtcaagtgctgcaagcagt
aaggcaatttcttcctgtgttagatagcctgtttctggtttttcctccttaagccttttt
gtccctctgatagggtgctcaccaaagaataactccgcttcaatcagggctgtaaacatg
ccgctaatacatgttaaatcacgattgatactcgaaggtttaataccctgacttcttcgg
gtggcgcagtactggctgataagcgatttcgtaatttgaaatgcgcatgggtcattcgtt
atttttgtgaagatttcaatttttccaagattagatttcccatgctcttcgtgtttaccc
tttaaatcccaccagatctgtgtcagctccgacagacgtcgcttgtctgttggttttgat
agccattctttattgtggtggttgtacaacgtgtatttctcgaaagcgacagcttcgctt
ttcttatcaaacttcctacggatgcgttttccattacgtccagtagggcggatgtccact
tcatatcgaccatcatcgagttttttgattgccatcagaaaaccctccgagtggtgtgtt
tttttgcgactactaatcgcttttttcgtggtggctgaaatttagccaccaatagtaggc
acttgtgatgaatatattcacgatgaattgttaaccagtcttttgaccggagtggggcga
cgttgtttcgttttgcccaaagtgtgcgagagcgggcgcaatttgcccggactcaggagc
gatctgattggtcatgaaccataaagtgtatttggtgaattgtggggtctgcaggatgtt
catcatgacatctgttggaggtgttgaacgaccactttcatagtaactcagcgtgccata
cggaacccctgttaaatcagcaagttgttgtctgctcaaatactctgattttcgcattaa
gactatcttctcgcttatcgtgtttgacatggtgtttagatctcaatagtatttagttta
gatgtagattgtttagtgcttggatgtgggcactaaaaggcattataagacattaaacgc
aattcatgagggctagaggacgacatgagcaagcaagtaacactcatgactgatgcgatt
ccttatcaggagttcgcaaaactaataggaaaatcgacaggagcggttcgtcggatgatc
gataaaggaaagctgcctgtaattgatatgaccgatccacaatcagcttcaggtcgtgca
ggtgaatattgggtataccttccggcatggaataacggactaaaactggcttatgaaagc
cgccctaaagagattcgtgacggctggttgatgtggttaggtctcggtgaaccacgttaa
ggagaaccgtatgaatgagcctcgttgtattgctcagttactgcgtaacgaaagccccag
ggcgattgacttcaccatcacccacggtaaggggcgtaagggaatcattatccgcaccaa
aaaacagagtccgttaaaaaaggctctgacctttctgaaaagccggagggtatggaaatg
acagtgatgacgctcaatctcgttgaaaaacagccagcagctatgcgccggataattggt
aagcatcttgccgttcctcgctggcaggatacatgtgattattataatcagatgatggag
cgcgaacggttaacggtttgcttccatgctcagttaaaacagcgtcacgcaacgatgtgt
tttgaagaaatgaacgacgtcgaacgtgaacgactggtatgtgcaattgatgaattgcgt
ggtgcattctcaaaacgccgtcaggttggcgcaagtgagtatgcatatattagtttttta
acagtcagtcagcgtcgtactttatttatgcatgccggattgactgaaaaagaattcaac
cagccatactggcgaattaatgaagagtcatgttactggcgtgatgctttattccgtgca
ttacgtgaattattcagtctgtttgagtatgcaccgacaattctgacgtcggtaaaaccg
gagcaatatctgcattaagtaattaaccagagtttttaacgcacttaattgtgcggggct
tctttttgcctggagaaagttatgcatacagtttctgaaaatcagtgcggtatatacgca
ttactgctgcaacaggccagaaccgaagcacaggccgacgctgcgacgcgcttttcttct
catcttgatgccatgattcgccacatcacaaaggcggagttatcccgcgtggagatagtc
gagctgctcagtcaggagtcggaaaaatttcacaatatcggattgtctcgcggggaggtg
ctttgatgttctgttctcgtgcagttgtattactgaataacgccttaaaaatcgccgtta
tgaaaaatggcgatttgtctcttattcaacttggtcttgataaagaaaaacgcgaaataa
ctgaatctgttatcgcgatttatcagagtgaattaaacctcctgtctgatgtggtcaatt
tacttgttaaacgcgctgtatttcacaagcaaatttcctccgtggatgaactgacgaaat
taacgacagaaatcgccagctattgcgctgatgaatttaaaaaactgaacgacaaaagga
actggtaatgccggacaacgtagattttattcaggaacaacaggctgaattactggagcg
ccagattaacgcggcaagggtaaaacattgcggtgcttctgcgctggtttgcgaagagtg
tgacgcgccaatacctgctgcccgtcgtgcggcttacccgtcagccacgcgttgtgtttc
ctgtcagtcagtctttgaagcaaaaaacaaacattaccggagaacggcatgagtattcgt
attgaaattggcgaacgttatgtcgttaccagtgacagctttcagtttattctccacgag
aaaaagagagcggaaagcggtaaaaacgccggtcaggaatggctggcggtggttggttat
tacccgaaattaagccagctcgtttcaggcctgatgcatcacgatattctgaccggaagc
gcaaagtcttttgctgatttaaacgtgcaggttgagcaactcagcaagcgttgttcagag
gcttttggctcatatggccgttaaagcctccgggcgttttgtccctccgtcagcatttgc
cgcaggcaccggtaagatgtttaccggtgcttatgcatggaacgcgccacgcgaggccgt
cgggcgcgaaagaccccttacacgtgacgagatgcgtcagatgcaaggtgttttatccac
gattaaccgcctgccttactttttgcgctcgctgtttacttcacgctatgactacatccg
gcgcaataaaagcccggtgcacgggttttatttcctcacatccacttttcagcgtcgttt
atggccgcgcattgagcgtgtgaatcagcgccatgaaatgaacaccgacgcgtcgttgct
gtttctggcagagcgtgaccactatgcgcgcctgccgggaatgaatgacaaggagctgaa
aaagtttgccgcccgtatctcatcgcagcttttcatgatgtatgaggaactcagcgatgc
ctgggtggatgcacatggcgaaaaagaatcgctgtttacggatgaggcgcaggctcacct
ctatggtcatgttgctggcgctgcacgtgctttcaatatttccccgctttactggaaaaa
ataccgtaaaggacagatgaccacgaggcaggcatattctgccattgcccgtctgtttaa
cgatgagtggtggactcatcagctcaaaggccagcgtatgcgctggcatgagacgttact
gattgctgtcggggaggtgaataaagaccgttctccttatgccagtaaacatgccattcg
tgatgtgcgtgcacgccgccaagcaaatctggaatttcttaaatcgtgtgaccttgaaaa
cagggaaaccggcgagcgcatcgaccttatcagtaaggtgatgggcagtatttctaatcc
tgaaattcgccggatggagctgatgaacaccattgccggtattgagcgttacgccgccgc
agagggtgatgtggggatgtttatcacgcttaccgcgccttcaaagtatcacccgacacg
tcaggtcggaaaaggcgaaagtaaaaccgtccagctaaatcacggctggaacgatgaggc
atttaatccaaaggatgcgcagcgttatctctgccatatctggagcctgatgcgcacggc
attcaaagataatgatttacaggtctacggtttgcgtgtcgtcgagccacaccacgacgg
aacgccgcactggcatatgatgcttttttgtaatccacgccagcgtaaccagattatcga
aatcatgcgtcgctatgcgctcaaagaggatggcgacgaaagaggagccgcgcgaaaccg
ttttcaggcaaaacaccttaaccagggcggtgctgcggggtatatcgcgaaatacatctc
aaaaaacatcgatggctatgcactggatggtcagctcgataacgataccggcagaccgct
gaaagacactgctgcggctgttaccgcatgggcgtcaacgtggcgcatcccacaatttaa
aacggttggtctgccgacaatgggggcttaccgtgaactacgcaaattgcctcgcggcgt
cagcattgctgatgagtttgacgagcgcgtcgaggctgcacgcgccgccgcagacagtgg
tgattttgcgttgtatatcagcgcgcagggtggggcaaatgtcccgcgcgattgtcagac
tgtcagggtcgcccgtagtccgtcggatgaggttaacgagtacgaggaagaagtcgagag
agtggtcggcatttacgcgccgcatctcggcgcgcgtcatattcatatcaccagaacgac
ggactggcgcattgtgccgaaagttccggtcgttgagcctctgactttaaaaagcggcat
cgccgcgcctcggagtcctgtcaataactgtggaaagctcaccggtggtgatacttcgtt
accggctcccacaccttctgagcacgccgcagcagtgcttaatctggttgatgacggtgt
tattgaatggaatgaaccggaggtcgtgagggcgctcaggggcgcattaaaatacgacat
gagaacgccaaaccgtcagcaaagaaacggaagcccgttaaaaccgcatgaaattgcacc
atctgccagactgaccaggtctgaacgattgcagatcacccgtatccgcgttgaccttgc
tcagaacggtatcaggcctcagcgatgggaacttgaggcgctggcgcgtggagcaaccgt
aaattatgacgggaaaaaattcacgtatccggtcgctgatgagtggccgggattctcaac
agtaatggagtggacatgatggcaaaaattcacgaggtaaagctgcacgcaaaatatttc
gaccttgtactggaaggaaagaaacgcgcagagtttcggaaaaaagatcgtaattatgag
cgcggggacacgttgattttgcatgaatgggtgcagggtgtgtttacggggcgaaaggtt
gaagcccggataacagatgttactgacctgtcagactggctggaagattatgtcttgctg
cacagaatactaggtgagatactgccgctgactgtcaagctggcagtatcctccacattt
tttataaatctaaggcgaagaacggtggcaatatatttgctttaaattgtaaataagcaa
attattctaagccacaaatgatatcaattgagtatcgattttcgttcgaatataaccata
acgccaagcgtcaaatgtaagtcatctatatgtgattcgtattcatattggtcagcatca
ggagatagtaaatgctctgctgctgtaaaaacatcaattgtaacagatatatcgtctgga
atttcttcatttaattcggatatgtattttttatatttgttttttaatttccttatcatg
tcttccttatggtggattgtagtgcagtaattttttttagttgaatcattgtatgaatgg
aatgaacagtttaatgctaggccaagacttgaatttcctgtagggcctgtgtgtttaaag
tattcaagatttcttcttatgtcagaaaataaaagacttttacagggggcatttccttta
acttctattgcacatattggaatgtcgaaaaatggtctgctgtccaatatggcaatatca
attctgcctgatcttgttgtgtttgtgttttttctgacagttttttttgagaatattttt
tgggggtcagaccgtttcgataaaggaactgttgcattaatgaatttatttgtatggtac
tcaaatataactttgtaatcaccatggcgaaaagattttatttctaacaacgatagacct
atagatacggtagctacatattcagtgtttatttttgcaccagacctgaaatccattaaa
taagttgcgtcggctgactttttcattccatcttttacagctttcacaatatccatgtta
ttcatatcaacaccttttatattccagaattataaatcttaatgattgatttgtttgtgt
gtttaggttactagattgacgtacttatagcacattctgattttgaaatcaccatccttg
ggtaaagcacagcctatcactattggtttagtactgtgctgtaatagtatcagattaagt
taaatccattttatgaaatcttccatttcatcatatttttttattactgctctaacatct
ttgctttcatcacataaacaatctaaaagactatcccattcagtttgttttttaccaaat
ccataaacagcctctatatcaccggatttccatatatagattccgttatctttcaatttt
tgatgtatttcatgtatatgcttttgtgttttttcatggttacatattttgatgaagtct
ttgcttgaaatgcttttgaatgactcaaaagtagtaacttttgtatttaaactaagctct
cctgagttgattgattcaatcaaagcagtcaatagattatcacattcagtactaagtaag
tctttatgctctgttaatagaatatttgataagaaatcacaatcagctagaatccttgtt
tttatgccgatggcattgatgatttgtgacatcttaaataaactacccttaccgtcaacg
gcaacaatgcagattttactcgggttgagttcatgtccgttaatttttttataaagtgca
tatagaacgtttgtctctgttttcccttcaacaagcaaaacttcttcagaaaataaaagg
tatgatgaattagaaagcgtgaatgctgagtgcaattgcggtgatgaagatttatataat
tcttcgattttttcagatatagtcttccttgctatggttccattagaatccttacaaacc
tgaatcgcatttgctgcatgctttgcagaaagcatactggctgagtgagttgatattata
acctgataccctgattcacttaatgtgacaagtgattctctgacagaattaatggctgaa
gggtgtaaatataactcaggttcatcaatgaaaatcaaagtgtttgatttttttgattcg
ctgttttctttttttatttcggccaggtattgaattaatgccatttgaatggaacgttgt
gttccgtgaccaaatcggctgatatctctcattaccggttcatcttcccgagactcaaaa
actttcagagtgccggatttaaatatctcatctaatgtcggtgtgggaaagtgtaacttt
acacttacgtcaggaaaaaattggtttacttttttatttacacctgagtctattttatta
aggctttctaatctgttctcaccgttgtgagaaagatatttacctatttctgatatgttt
tttgaaaatttttcttcgtgttcttgttttatttcagaaacaattgcggaaagtatcttt
cctattgtggtcgtgtttttgcattttgttgagtcttcgacagcgtcagacattgcaggg
atatgaattggttccggaaatatattggagattgcaccatctatgccgccagggtttttc
ttccacgtggtaccgtcatatacatccagactttttttggcttttcctgtttccttatta
aattcctgtcttcttgcaaaggtaagagtcccgtcaattataaacggagctattttttgt
tgattctcttctgttaacaaagacagagtatcatctgttataccttgaataacgccttca
acggatacggggtgtgtaggatcgtacacatctgattctgaaatcaaagagccatctaac
agccacttaattgctaagataatatttgattttcctgcgttattataaccaactaaagca
gtgaaggggcgcaaaatagccgatgttgacttacaagaacgaaagttgctaattgaaact
gaagcaagacgtacagtcattatttttccttaaatgtgctatttgtatgcaatgagttca
tacgaaacgcttttttacattttatagtcgttgcattcaagggtgcatgagattgcatta
agggaaactgtgatatggcttggcttttgactggaaatactgatggctcattagttttat
taaggtgcattaaaaccgccccgtgaagcgggcgggcgaggcggggaaagcac