Permalink
Find file
Fetching contributors…
Cannot retrieve contributors at this time
513 lines (512 sloc) 30.5 KB
>B132222 U32222 Bacteriophage 186, complete sequence.
ggcgtggcggggaaagcattgcgcgccagaggtggcgcgtgaatgataaaaattatcgtc
tgagcgcctcgtaatggcgctatcgtggtgctgttggttcgttggtggtcgtgtgtgttt
gtgcgcgtgtggcgcgtctgagacgtgatggtggcggggtatgaaaaagccgccatgctg
gcggcttgagagggattattccgggttgtcgagggtgtactctttgaacctgatgacctc
catgccgagccagtcgtttacctccctgaacctgtcctgcagcggcgacaggtcgttacg
cacaaatacctttgccactttctcaacgtcaccgagcgagccgatattctcgggcttgcc
gcccatgagctggaacggtacgcggtgcgcgtccatcaggtcggcggcgctggctttctt
gatgttgaaaaagtcatcctttgtggcgacctcgctcagtggcacgattttaatgccgtc
cggttttccattgggagcgtagaaaaacaggtttttaaaattgccgagccctttcgagtt
gcgcatcgcctcgcgcagcgattcgacgtcggtcgcgctctgcgccgggtcggtcacata
catgatgtaacccgcatgcgcgccgttctggtaatacttgcggcggaacagcgttgcgga
ttcattcagccaggcggaattaagcgcgctgagatattcgggcaggccgtaaatctcctg
attaatgtcgggctccagcaggtgaaacacggtatcaggcgcgaattcatgcggcagagt
gaagttttccacaaaccagaaaaccgaatcgtcgaccccgcggcgggtgtatttggccgg
tgaggccagtagcttgattagctggccggtaacgctgtggcgctgctcaagaaaggcgtt
gccgaataccagatagtcgagcgcaaagcggctgaaatcctgacgggacagcagcgggtg
cgggatgtaggtgctcgcgagcacgttgcgcttaacgtaaatcggtgagctgtgatgtac
agcagagcgcaggctctttgccagcccggagaagctgaccggcggctcgtaccatttgcc
gttactgatgcactcgacataatccagaatgtcgcgcttatcgagtaccggcactggctc
gccaaaggtgaacgcctccattttttgcggggcgctggcggtcatggctacctgtttgcg
tggcttgcgcttgctcatgctgccacctcacccgctgcaacagcgaaagaccagtcgcag
ccaaacagcaggcgataatcatcgtcgctgtattcgtgtttaatttcatcgggcgcaaag
agattgcacccgcgctggcatgctgcatccagagtgaccgactgacgccagacaccatct
gtacaaaatacgctgtcgccggtattgatgagcggtgacggtcggtgcctgcgggttgtg
ccgttccataccctgaaagcgtcataattatcagagggcgaggtaaacatcgtcaggctg
tggcgtttatggcaggcgatacccgccgcgactttcgcagctcttagcgggttattgaac
catccgaactcatcaagatagacattacccgccagtgcggcgcaatgggattcctcgccg
acaaagctgataaccgcaccgtcgtcgagctgcaggctgtggccgttactcgtaagactg
acgccgacgcgcgccgaaaggttactcatgtacatcagcgccacgcgcgcatgctcaata
gtgtgagcaaaccagacatgattatcgcctgttgtcagcgcatcgagcagcgcctcacgg
ctaaagagctgcgttgcgccaatctggcgcgatttggtgatgctgcggtcgatattgagt
ttcccgacacgcaaccatgttgcctgatagtcaaagctgtcattgtgcagaatatcggcc
attgcctgaatctggctttgtgagaaaacgttatttttcattaattaaactccagaatgg
atttaggctgtatgccgctaccggcggaaagcggttcgtttaacagggcgtgcatggtcg
cccatgcaatatcggcgtgactggcttcctcggtgcggctggcctcgtaggtggcgctgc
gcccgctgctggtcatggttttgcggatggacataaacgactgcgtgacgtcggttgctc
cggcgtcgtactccagacagccgcggcgaatggtgtcttttgccttgagtaccattgcgg
ttttcatttcaggcgtgtaacggatgccgcgtgcggccgggtagaatgagcgcaccaact
ggaacacgccgaggccgaggccggttgcgtcaatgccgatgtattcgacgctgtatttct
cggtcagtttgcggatgccatctgcctgcgcggcaaagtccatgcccttccactggtggc
gctccagcatgcggaacttgccaccagaaaccaccggcggcgcgagcacgacgcacccgg
cgctgtcgccagtgtgtgacgggtcgtagccaatccagacggggcgagagccgaacggat
ggtcggcgaacggggcgaagtcctcccattcttccatcacgtcgaccatgcagcgctgca
gctcctcgaacgggaataccgacgctttatcgtcgacaaactcgcacataaacaggtttt
taaagtcctcatcactgttttcgcgtttgagttggtcgaggtcgaacagggtgcagccac
cggcaagggcgtcctcaatggtgacaatctgccgccactggccatcgtcgcagagctggc
caccggcgagcgcgcggtgactgatgtcaatttcgatgcggtcggcaatacggctgcgcc
ccttgttgaacagctcgccagaccagaagggataagcgccgtgcgccagcgttgagggtg
tcgaaaagtaggttgagcgcagatgcttctgcgaggccatgcccgaggcgactttgcgca
gcttctgaaaattcgggatccagaatatttcatcgacatacaggtcgccgttatggctct
gagccgtgttggagttggtaccgagaaaaatcagctttgcgccgttgttgccaatgacaa
tcgggtcgccggtcaggtcgacgtcaaccagtcgcgcaaactgtatgatgtattcgcgga
acacgtaagcctgcgttttactggccgacagaaaaatctggttatggccggtcttgagtg
ctcgcagcagtgcctcacgggaaaaatagaacgtcgcgccaatctggcgggatttgagaa
tgtcgcgaatacggtgtgccagtcctgcgcggtaccactgcaactggtactcgaaagact
ggtcgaaaaataattcctccagcttttcgatagcctcgtcgctgaaaaaattctttttcg
gcttcttgcgctcacccttgttgcggttggcgacgttggggttaaggtcggcctcgttgc
cggtctggctgtagcggttaacgcgtgccagtcgttcaatctgccgcccgagcaggtcaa
tctctttgaagtcaccgcctgacttttgcggcttggcgatgagctgaatcaggcgcgcct
caaggctgctttcaacgcgggaaatcggtgcgatgccatcccagccgtcgcgctgtttcc
agctctgcacggtcgggcgcttgacctgcagcatttcggcaatctgcggcacggaaaaac
cctgccagtaaagcagcgatgcctgtcgtcgcgggtcatgcaacaaggttgtatcggtgg
aaatggtcattgatgcctcgccgtaatggattcagggcaaggctacttaatggccgtcag
tgattcgctaaggtgctgttgtgtgggcggttgtccagtcgtcattggtggtctggcgtg
tcctgagtctggaaactggcggtgaccagtaaccccaacctcaggactcctgacaatggc
aaaaaaagtctcaaaattctttcgaatcggcgtcgagggtgatacctgcgacgggcgcat
tatcagcgccagtgatattcaggaaatggccgaaacctatgacccgcgtgtttacggttg
ccgtatcaaccttgaacacctgcgcggcctgttgcccgatggcatattcaagcgttacgg
cgatgtggtcgagctgaaagccgagaagattgacgacgattctgcgcttaacggcaagtg
ggcgttgttcgctaaaatcaccccgaccgatgaccttatcgcgatgaataaagccgcgca
gaaggtctacacctcaatggaaattcagccgaattttgccaataccggcaaatgctacct
cgtcggccttgctgtcaccgatgacccggcgagcctcggcactgaatatctcgaattctg
ccgcactgcgaagcacaacccgctgcagcgctttaaagcccaccctgaaaacgtcttttc
cgccgccacgctggccgaactggaatttgaagacgttcccgacacggtgctcaacagcct
ggccgataaggtgaaagccattttcagccgtaagcaggtcagcgacgatgcgcgcctgaa
tgatgtacatgaagcggtgaccgccgtcagcgagcatgtgcagaccaacctcactgcaca
ggataagcgtctttccgatatggaaaccgcgtttgccaccttcaaacaggaactgaccgg
caaggttgaagaaaccagccaggcattttccgtcctgaaaaccactctcgacaaaaccga
aagtttcagccagccgcgacgcacgaaagccagcggcggtggtggcgatgagctgctgac
tgactgctgataaaccgcagaccgaaaccgggcggaacccccgcccgatgctgtgactaa
ccgattaaatcaaacaggaaatactatgcgtcaggaaacccgttttaagttcaatgccta
tctgacccagctcgccaaactgaacggcatcagcgttgatgacgtcagcaaaaaattcac
cgtcgagccgtccgtcacgcaaacgctgatgaacaccgtgcaggcgtcatccgcgtttct
gcagatgattaacattctgccggtcgcagaaatgaagggtgagaaaatcggtgtcggtgt
gaccggcaccatcgccagcacgaccgacacctcgggcgacaaagagcgccagaccgcaga
ttttaccgcgcttgagtccaacaagtacgagtgcaaccagattaactttgacttccacct
gacctataaacgcctcgacctgtgggcgcgttttcaggactttcagcgtcgtattcgcga
cgccattgtccagcgtcaggcactggatttcatcatggccgggtttaacggtaccacccg
cgctgacacctctgaccgtgttaaaaacccgatgctgcaggatgtggccgttggctggct
gcagaaataccgcaatgaagccccggcgcgtgtgatgagcaacatcaccgacgctgacgg
taaagtcgtttcggcagtgattcgcgtcggtaaaaacggcgactatgagaacctcgacgc
actggtgatggatggtaccaataccctgattgacgagatttatcaggatgacccgaaact
cgttgccatcgttggccgtaagctgctggccgacaaatattttccgctggtcaacaaaca
gcaggaaaacaccgagtcgctcgcggcggatatcatcatcagccagaagcgcatcggcaa
cctgccagccgtacgtgtgccgtacttcccggcgaacgcggtgttcgtgaccacgctgga
aaacctctctatctatttcatggatgagagccaccgccgcagcattgatgaaaacccgaa
aaaagaccgcgtggaaaactacgagtcgatgaacatcgactatgtggtcgaggcgtatgc
cgccgggtgcctgctggaaaacatcaccctgggcgatttcaccgcacctgcagcaccgga
aggcggagagtaaacccatgacgagccccgcacagcgtcacatgatgcgggtctcggcct
ctcaagccgcgcagcgggaacaagccccgctgcgccatgcaaccgcctatgagcagatgc
tggttaagctggccgatgaccgccgcacgttaaaaaacatccgttcaaacgaacgtaaag
ccgagaaaaagcgcgagctgctgccgttctatgcgccgtgggtcgccggtgtgctgactg
atggtcgtggtgcgcaggatgacattgttatgaccgtcatgctgtggcgtctcgatgccg
gtgatatcgctggcgcgctggaaattgccccctacgcgctgaagtacggcctcacctctg
accatcgccgcacgacaccttacatgctggtcgaggaagtggcacttgccgcgcagcgcc
tgcgcgatgccggtgagtctgtcgacctttcctggctgcaggccactatcgacctgaccg
acggcgctgacgttcccgatatggtgcgcgcccgtctgcataaggtgacaggcctgaccc
tgcgtgatgccggtatgaatgcagaggcgctggcgcagtttcagcgcgcgatgcagctcg
accgcaatgccggtgtgcgcaaggagattgagcgactggaacgggcattgaagccaaaga
cagaggccgcgccccgtaaaacgactaaaccgcgcacgcgtaaacctgccaccaaaccgg
cagcaaagcgcgggcgtccaccaaaggcggcaaaaaccgccggttaactgaacgctcccc
gagccgggcggcacgccggtcaaagcaggcaaagacctgacggcgaccggcgtccaccgc
ccaacctgatgaggttgtcatgacgacagtgatactgaaccagcccgacgaaccgcagga
cgtaccgggcgtggtgattcccgcaccggagacgggcggtgcagtgattaaaaacacgtt
ctttttccctgatgtggatccgaagcgcgtgcgcgaactgatgcgccttgagcagacggt
ttccgatgcgcgcctgcgcaatgccatcaagaccggcatggccgagaccaatgcggagct
ttacgactaccggctgcgccagactgccgccgggtttaagcaactggccgacgtgcctgc
cgaggaaatcgacggcgagaatgtacgtgttttccactatctgagtgctgtgacggcaat
ggcaaccgccaccctgtatgagcgctatcgcggcgttgaggccaccggcaaaggtgacaa
aaaagccgacagcgtggaaaccaccattgatgacctgtggcgggatatgcgctggtcagt
tgcgcgtctgcaggacaagccgcgctgcattgtggggcagctctgatgaaagtcaggtcg
atgcagggcgataccctcgacacgatttgcgccaggtattacgggcgcactgagggcgtg
gttgagacggtgctgcaggctaatccgggtctgtctgagctgggtgtcattctgccgaat
ggtacagagattgacctgcccgatgtggcatcgtcacccgtaactaaaactatcaacctt
tgggagtaaccatgacagaaggtgaaaaaggcgtcctgtcactgtttgtgattggcgtga
tgattgttgttgggaaagtgctggcaggcggtgaacccatcaccccgcgtctgtttattg
gccgcatgctgctcggtggttttgtttcaatggtcgccggtgttgttctggtgcagtttc
ctgacatgtcactgcccgccgtgtgcgggattggatccatgctcggtattgccggttatc
aggtggttgaaatcgccatacagcgccgctttaagtcacaaaagggggaaagtgatgccg
gtcattaacactcaccagaatatcgctgcgtttctggacatgctggcgtattccgaagga
acagcgaaccatccgctgacgaaaaatcgtggctacgacgtcattgtcactggccttgat
ggcagaccagagattttcaccgattacagcgaccaccctttcgcgcatggccgaccaccg
aaagtgtttaatcgccgtggcgagaaatccacagcctcgggacgttaccagcagctttat
ctgttctggccgcactatcagaaacagctcgcattgcctgatttcagcccactgtcgcag
gataagctcgcgatccagttaatccgggagcgcggtgctcttgacgatatccgggcgggg
cgtattgagcgtgctgtttcacgttgtcgcaatatctgggcgtcattaccgggggccggt
tacggccagcgcgagcacggtctcgaaaagctggtcaccatctggcgcacggctggcggg
gtggtggcatgaaagtcctgataacgctgcttgtgatggccgtgctcgggttgctgtggc
tgcaccatgagaacggcaatttatcccgctcatttgagacggcaaaccgcgtcgcgagcg
agcaaaagacgacgattgggatgctgaaaaatcagctcagtgttgccggtcagctcgccc
gacgtaatgaatccgcgcaggtgacactgcgcgaacagctcgcaaaggcaagtgcagaag
ccagccgccgtgagcagacgataacgaggttacttaatgaaaatgaagcctttcgccgct
ggtataacgctgctctgcctgatgctgtgcgtcggctgcacacccgaacagcctgcgcca
gtgccggtgattgtggtcaacggatgcccgagggtgagcctttgccctatgccgggaagt
gacccgaaaaccaatggtgacctgagcgcagatatccgccgtcttgagggggcgctgact
gcctgcgcgctgcaggtcaaaaccgtcaaacactgtcaggatgaactcgatgcagaagca
caaaagcctgcgcaaagcgctgattaacgccgtgccgcagctccgaaataaccccgatat
gctgcgcctttttgccgacaacggccacaccgattcccgactggcgagctcgctgtcgtt
tgaaaaggtgtatgtgcttaacgtggtggtgaccgactttactggcgacctcgatttgat
attcgtgccggtgcaggcatggctgcgtgaacatcagccggacattatgaccaccgacga
cgggcgggaaaaaggattcacctggattattgatatcaataacgacgattcgctcgatat
cagtatcagcctgaggctcaccgagcgcacgctcgtcaaagaggtcgggggcgcgctgca
tgtcagttatgcaccagaaccgccactgcctgagctggtgaagcgcccggttgctatgta
tgcaaacggtgaattagtgagccagtgggatgagtgaattaaccgcgctgcaggagcgcc
tcgccggtctgattgccagcctgtcaccggcggcacgtcgcaaaatggcggctgagattg
cgaaaaagctgcgtaccagtcagcagcagcgcatcaagcgccagcaggcacccgacggca
ccccgtatgccgcacgaaagcgccagccggtacggagcaagaaaggccgcattaagcgcg
aaatgttcgccaaactgcgcaccagtcgctttatgaaagccaaaggcagcgatagtgcgg
cggtggtggagtttaccggcaaggtgcagcgcatggcgcgggtgcatcagtacggcctca
aagaccgcccaaaccgcaacagccgggatgtgcagtacgaggcgcgcccgttgctcggtt
tcacccgcgacgatgagcaaatgattgaagacgtcattatcagccacctcggcaaataaa
tattgtgtgaaccaccaccggaggcgcgtgatttggcgcggctaaagaccagaggcattc
tttgcactatgaatacgttatccacgatacaggagctcgcgcgtgcgattcgtaacctca
tccgctcaggtgtggtgacggaggtcgataccgtgcaggggctgtgccgcgtacaaagcg
gcgggatccagacgacatggctgaactggctgaccacccgcgccggtcgttcgcgcacat
ggtgggctccctcgctcggtgagcaggtgctgctgctggcaatcggtggcgagcttgata
ccgctttcgtgctgccggggattttctccgacgataaccccgctccgtctgcctcggcgg
atgcgtggcatgtggtttttcctgatggcgcggtcattgagtacgagccggagaccagtg
cactgacggtcagaggcatcaaaactgctgacgtgaccgcgtcggaatccatcacggcca
ctgtgcctgtggtgctggtgaaagcagaaacccgcatcaccctcgacaccccggaggtgg
tatgcaccaacaaactgacgacggcaacgcttgaggtgcagaaaggcggggagatgagag
gcgacattgtccacaacggcggcacatttaaatcaaacggtgtgcagctcgacgaccacg
gtcacggtggtgtgcaaagaggcggtgcctggacggaggacaccaaatgacggcgcgcta
tatggggatgaaccgcaacaccggtctcggtatcagtgacactgaacacatcagccagag
catgcgcgacattctgctgacgccggtcggctcgcgggtgatgcgtcgtgaatatggctc
gctcctgtctgcgctgattgatatgccgcaaaacccggcgctcaggctgcaaatcatggt
ggcgtgctattcggccatccagaagtgggagccgcgtatcaggcttacatccatcagctt
tgagactggtgatgctggcgagatgtatgtcgatattaccgggatgcgtaccgatacggg
tgcgtcagtttcaaccactgtttcactgagttaaatcactatggcaactgttgacctgag
cctgttacccgttcccgatgtggttgaggaactggattttgaaaccatccttgcggaacg
cattgcgacgctaatttcgctataccccgaagaccagcaggaagctgtagcccggacgct
cgcacttgagtctgaaccaattgttaaattgctgcaggaaaacgcctaccgtgaggttat
ctggcgtcagcgtgttaatgaagctgctcgcgcaggcatgctggcttatgccagagatag
cgacctcgataatctcggggcgaatttcaatgttgagcgcctggtcgtcaggcctgctga
tgacaccaccatccccccgacccccgctgaaatggagcttgatgccgattttcgtctgcg
tatacagcaggcatttgaagggatgagcgttgcgggatccaccggagcttatgaatttca
tggccgcagtgctgacgggcgtgtcgcagatatttctgttatcagcccttccccagcatg
tgtcacgatatctgtgctttcgcgtgagaataacggtgcggcgtctgatgagcttcagag
catcgtgcgcaatgcgctgaatgctgaggacgtgaggccggttgctgaccgggttacagt
gcagtcagctcagattattgactaccagatacgcgcaacacttttcgtttatccggggcc
ggaaaatgagccgattcgtgcggcggctgaggcgaagctcaaagcttatatcagtgcaca
gcacaggttggggcgggatattcgcctgtcagcaatttatgccgcgttgcatgttgaggg
ggtgcaacgtgtcgaactggctgcacctgtggccgacattgtgcttgataaaacgcaggc
atctttttgcacagactatcagatagtgattggtggctccgatgagtgatgtccgcctgt
tacctgtagggtcatcacctcttgaggtggctgctgccagagcctgcgcagatattgaaa
atacacctgttccgttacgccgcctgtggagtcctgacacctgtcctgcaaatcttttgc
cgtggctggcgtgggcgttttccgttgaccgctgggatgagaactggccggaaaaaacaa
agcgcgatgttattcgcagcgcgtatttcactcactgccacaaaggcacgataggcgctg
tcaggcgagttattgagccgctcggatacataatcaacgttacggaatggtgggagacag
gtgacccggcgggaacgtttcgtcttgatatcggtgtgctggaaagcggtattaccgaag
aaatgtatttagaaatggagcggttgattgctgatgcgaaacctgcgagccgtcatttga
ttggcctgaatattatccaggatattcccggttatatgtatacaggtggtgtgagctgtg
acggcgacattattacagtttaccccggataagtgaggaataatgagcacgaaatttaaa
actattatcaccactgccggagccgaaaaactggcagcggctactgtgccgggtggtaaa
aaagtgaatatcaccgtgatggccgttggtgacggaggcggaaaactgccagtgccggac
gccggtcaggtgcagctcgtgaatgaggtctggcgccatgccctgaataaaatcagccag
gacaaccggaacagcaattacattgtagccgagctggttattccgcccgaggtgggagga
ttctggatgcgcgagttgggtctttatgatgacgagggcactctcattgctgttgccaat
atggcagaaagctacaagccagaacttgccgagggctcaggccgtgcgcagacatgtcgc
atggtcattattgtcagcagtattgcctcagttgaattatccattgattcgacaatggta
atggcgacgcaggaatatgttgatgacaggattgcggaacatgagaagtcacgtcgacat
cctgacgccacactgaaagaaaaaggctttactcaactcagtagcgcaacagacagcgcg
tctgaggtgcttgcggcgacgccgaaagcggttaaagcggcgtatgaccttgctaatgct
aaatataccgctcaggacgcgagcacagcgcaaaaaggcattgtgaggctgagtagtgcg
gcagacagtaccagtgaagctgaggccgcaacaccgaaagctgtcaaaattgcgatggat
aatgcgaatgcgaggctggcaaaagaccggaacggcgctgatattccgaatccgccgttg
tttgtccagaatatcggtttaaaacccacggtcgataaagctgctaatgccgttgataaa
aatggcgacacgatgaacggaaacctgacactcaagggtgattaccggctgagttttatt
atccagaatgaagacggttctattcgtgcttatatcttcaaggacaaaggtggcgacggt
attcgcatcagtaatggcgatgacggcggcggtgattttgtttttggtaaaaatggacag
ttttactgcccggatattatgcatgttggtaatacgattgtatggggtgacggaaatatc
gagggggcgcgatggggcggtttgttgagcgactggttaactgctcaactggttgcccgt
gacaataatattaacttgcgagcaccctatgaatgggttaaccaaaactttgtcaaccgt
gcacagcgcggcgcacaggccagcatgactatggacggcggacttgtagaggctccatgg
ggatgttttcttacgggggggaacggtaacgagggtaatcaggttggagtggctttatac
cgtccattgcagattcttcgcaataatacttgggtaacgatagagaactgaaaatgaaac
tgattaatttgcaacgctacattctgatgaattattttttaggtgatggcattcagtatt
ttatagatgccacaggtaaggactggtataaatcactgcccaaattcacaaagaaataca
gccttgctatcgaaaatgatacgggcgttattcgtagtatcagcgaagatgcatcccggc
tttatcccggtggtttgaccgttgttgatgttgacagtattccggcaggttgtgacattt
tcggcggatgggtatttgacggagagaaagtcattcctcgtgagtacacattggccgaac
agcaacgccagtcagatgaaaagaaaaaaacacttcttgctgaggcggaggcaacaattt
ccacgcttgagcgtgcggtaaggttaggcatggctaccggggaagaaataaggcgactcg
aagcatgggagcgttacagcgtattggtgagcagggttaagcagtcagatgactggccgc
aaaaacctgaataacccggcggcatttgcccgcttctttctcatccattagttgtgccag
acatcatccagccctgacaaatagcccctcacaagaccagccaggacaataacactcgcc
cactaactacggagttaaccggatgagtgattttcaccacggcacgaaggtcatcgaaat
aaatgacggtacgcgtgttatttccacggtcgcaaccgcaatcgtcggcatggtctggac
agccagcgatgcggatgccgagacatttcccctcaacgagccggtactgattaccaatgt
gcagagcgccattgcgaaagccggtaaaaaaggcactctgtcagcttccctgcaggccat
cgccgaccagtcaaagcctgtcaccgttgtcgtgcgcgttgccgaaggtaccggagacga
tgcagaagcgcagaccacgtccaacattatcggcggcacggatgagaacggtaaatacac
cggtatcaaggcgctgctaactgccgaagcggtcaccggcgttaagccgcgcattctcgg
tgtgccgggtctcgatacgcaggaagtcgcaaccgcacttgcatcggtctgtatcagcct
gcgtgcgtttggttacgtcagcgcatggggctgtaagaccatttccgaggcgatggcata
tcgcgagaatttcagccagcgcgagctgatggtcatctggcctgatttcctcgcatggga
taccaccgcgaacgccaccgccacggcatacgccaccgcccgcgcactcggtctgcgtgc
ctacatcgaccagactatcggctggcacaaaacgctgtctaacgttggcgtgcagggcgt
taccggcatcagcgcctcagtcttttgggatttgcaggcatccggcacagatgctgacct
gctcaacgaggccggagtcaccacgctggtgcgcaaggatggtttccgtttttgggggaa
ccgcacatgctctgatgacccgcttttcctgtttgagaactacacccgaaccgcgcaggt
gctggccgacacaatggctgaggcgcacatgtgggcggtcgataagcccatcaccgcatc
gctcatccgtgacattgtcgacggcattaacgccaaattccgcgagctgaaatcaaatgg
ctacatcgtggacggtgaatgctggttcgacgaggaatcgaacgataaggaaaccctcaa
ggccgggaaactgtatatcgactacgactatacaccggttcccccactggaaagcctgac
cctgcgccagcgtatcaccgataaatatctggtgaatctggctgaatcggtcaacagcta
aggagcctgaaacaacatggcactaccccgcaaacttaaatatctgaacatgttcaatga
cggccttagctacatgggcgttgttgaatccgtgacgctgccgaagctgacccgcaagct
cgaaaactatcgcggcggcggtatgaatggcgctgcagcgattgacctcggcctcgacga
tgatgcgcttactgtcgaatggtctgtcggtggcctgcctgatgtggcgctgtgggcgca
gtatgccgcgccgggggctgatgccgtgccgctgcgttttgctggctcttaccagcgtga
cgacactggcgaaatcgttgcggtcgaggtggtcatgcgtggccgtcataaagaaatcga
cggcggcgaaaataagcagggtgaaaatacctcgaccaaactgtcgaccgtttgcaccta
ttaccgcctcacgattgatggtagcgacattatcgaaatcgacaccgtcaacatggtcga
gaaggtgaacggcgtcgaccgtctggaacagcaccgccgcgcaatcgggctgctgtaatt
ccctgaccggtcagcactgctggccggttattacccccattcagagcagagaaaaaatca
tggcaaaagcaccacgcaaaacccctgaatttattgatacggctggcaatgaaattgaca
ccgtaaacccgaatgtcgtgaccctcgacaagccgattaaacgcgccggtcagacaattg
aaaaggtcacgctgattgaaccgaacgcaggcaccctgcgcggcgtcagtctggcggcgg
tggcgcagtccgaggtcgatgcgctgattaaggtgctgccccgcatgacctacccggcac
tcaccacgcaggagctcaccgcaatgaacctgcccgatatgctgtcgctggccgctaagg
tgattggttttttgtcaccggcttcggcggaatagacttcccgcccggcctgtcgaccga
tgacctgatggcggatatcgcagtgatattccactggccgccatcagagctctattccct
gagcctgaccgagctcatcacatggcgcgaaaaggcgctgcagcgtagcggaaaccacaa
tgagtaataacctgaggcttgaggtattgctgaaagcggtcgaccaggcgacccgaccgc
ttaaatccatccagaccgcgagtaaaagcctgtcgggcgatattcgcgacacacaaaaag
ggctgcgtgacctgaatggtcaggcgtcgaaaatcgacggctttcgtaaggcaagcgcgc
aactggccgtaaccagtcaggcgcttgataaggcgaaacgcgaggccggtgagctggccg
tgcagtttaaaaacaccaccaatccgacccgcgcgcaggcgcaggcacttgaagcggcaa
ggcgtgccgcctctgagttgcagacgaaatacaacagcctgagaacgtcggtacagcgcc
agcgctccgagctgatgcaggccggtattaatacccgcactctctctgcagatgagcgtc
ggctcaaaacctccatcagcgaaacaactgcgcacgttaatcgacaacgtgaggcactgg
cgcgcgtcagtgcgcagcaggcgaaattaagccgggtgaaagagcgatataaatcaggca
aggagcttgccggtaacatggccgcagcaggcgctgcggggtcggtatcgcgacacggaa
cgatggccggggttaaattactgatgcccggttatgactttacgcagaaaaattccgagc
tgcaggctgtgctcggggtcgataagcagtcgccagaaatgcaggcgttacgcaaacagg
cgcgccacgtcggcgacaatactgcagcctctgcagatgatgcagcaagcgcgcaaatca
tcattgcgaaaagcggcggtgatgcagctgccattcaggcgcgacgccgagtcacgctga
atatggcgctgtcaaaccggcgcacgatggaggaaaacgcagcgctgctgaccgggatga
aatcagcgtttcagctttcaaacgacaagattgcgcacattggcgacgttctctcgatga
cgatgaacaaaaccgccgccgattttgacggactgagcgacgcgctgacctatgccgcac
cggtggcaaaaaatgccggggtgagcatcgagcaaaccgccgcaatggtcggtgcactgc
acgatgccaaaatcaccgggtcaatggcgggcacgggtagccgcgccattctcagccgcc
tgcagctcccaccggaaaaagcgtttgaggccattaaggagctcggcgtcaaaacgtcag
acagcaaggggaacacgcgcccgatattctccatcctgaaagaaatgcagcgcagctttg
agaaaaacaacctcgggacaagccagcgcggcgagtatatgaaaaccattttcggcgagg
aggccagctcggcggcggcggtactgatggaagccgcctcaagcggcaaacttgaccggc
tcaccgctgcgtttaaagcctcggacggtaaaaccgaggaactggttaaggttatgcagg
ataacctcggcggcgactttaaagagttccagtctgcttatgaggcagtcggtactgacc
tttttgaccagcaagagggctcgctgcgtaaactcacccaaaccgccacgcaatacgtgt
taaagctcgacggctggatccagaagaacaaagggctggcgacaaccattggcatcatcg
ccggtggcgctctagctctgattggtatcatcggcggtattggcctcgttgcgtggccgg
ttgttatggggattaacgccattatcgctgctgctggcgtgctgggtacggtctttactg
ttaccggtagtgccattgtgaccgcacttggcgcgattacctggccgattgtcgcagtgg
gggcggctattgtggctggtgcgttactcatccgtaaatattgggagcccatcagcgcat
ttttctcgggggtgattgagggcatcatgagtgcctttgcaccggtcgcagaaatgttcg
ctccactggcacccatttttgacggtctcggtgagaaactgcgcggcgtctggcagtggt
ttaaagacctgatagcaccggtcaaagccacgcaggaaacgctcgatagctgcaaaaatg
tcggcgtcatatttggtcaggcgctggcctctgctttgatgcgtccgctcaatgtattta
acaagttgcgcagcggtgtcgactggcttctcgaaaagctcggtatcatcaacaaagagt
cagacaacctcgaccagactgccgccaaaaccaacgccgccacgcagggtaattcctaca
tcccggcaaccagcacatatggcggctatcaagcttaccagccagttaccgcaccggcgg
gacgctcttacattgaccagagtaaaagcgaatacaaaatcactctgccgggaggtgctg
cgccggggcatcagcttgacagacagctacgcgacacgctcgaacagattgagcgcgaaa
agcgtgcgcgtcagcgtgccagtatgagccatgactgagaggaataaacgatgatgcttg
cgcttggaatgtttgtgtttgaacgtcgcaccctgccttatcagtcgatgcagcactcga
aggattaccgctgggcgtctaatgaccgggtgggtaagccgcctgcttatcagtttctcg
gcgagggggaaacgtcgatacagcttgccggtacactgtacccagccatcaccggcggct
ggatctcactaaaggctgtagaggtaatggctaacgagggcagagcgtggccgttgattg
agggaactggaaacattttagggatgtatatcgtcgataaggtgtcgaccacgcacgccg
agtttttcagcgacggcgctgccagaaagattgatttcaccctttcgcttaaacgggtcg
acgaatcactgacggcaatgtttggcgacctgaataagcaggccagcgagcttctaggct
ctgccggaaatctgactgataagctgcagagtgcgctcggaggactgaccgcatgattac
gggcatgactattgacgccggaactagccttgcaccggcatttatgttaacgctgaacag
ccaggacattaccagcaattttagtgaccggctgatttctctcaccatgacagacaaccg
gggctttgaggctgaccagctcgacattgagctcgacgacaccgacggcaaagtcgaatt
accactgcgcggggcggtgctgacgttgtggcttggctggcagggttcggcgcttctgaa
taagggcgatttcacggtcgatgagattgagcaccggggcgcgcctgatatcctgaccat
ccgcgcgcgtagtgcagactttcgcggaacgctcaattcacggcgtgaagaatcatggca
cgatactaccatcggtgagttggtcagcaccattgcaaagcgcaataaactgacggccag
tgtcgcggattcactgaaaaaaattccggtaccgcatatcgaccagtcgcaggagtccga
cgccgtatttctgacccgactggctgaccgcaatggggcgacggtgtcagtgaaagcggg
gaaactcctgtttctgaaagccggtagtgcgatgacggccagcggcaagcccgtcccgca
aatgacactaactcgcaacgatggtgaccgtcatcagtttgctattgccgaccgtggggc
ttacaccggcgtaaccgcaaaatggttgcacaccaaagacccgaagccgcaaaagcagaa
agtaacactgaaacgcaagccaaaagagaagcacctgcgcgcactggagcacccgaaagc
aaagccagtcagcaaaaagacaaaggccaaaaaagagccggaagcgcgcgagggtgagta
tatggccggtgaggccgataacgtgctggcgctgacgacggtctacgcttctaaggcgca
ggcgatgcgtgccgctcaggctaagtgggataagctgcagcgaggcgttgcggagttttc
aattacgctggcgcttggtagggctgatttattccctgagacaccggtgcgcgtatcagg
ctttaagcgcgtcatagatgagcaggcatggttaatcagtaaggtaactcacaatctgaa
taatagcggcttcacgacgggcttagagcttgaggttaaactctctgatgtggagtacaa
cgcggaatcggatgatgaataaaatgtattcacaaaaagtgaatttatgattatcattta
ttcacgaattgagaataaagggtgggttatgtttcattgtccgaagtgccatcatgccgc
acatgcgcgaacaagccgctatctaaccgaaaacacgaaagaacgctaccaccagtgcca
gaacatcaactgtagttgtacgtttatgacaatggaaacgatagagcgctttattgttac
tccgggagccattgacccggcaccgcctcacccgactgtcggtggtcagcggccattgtg
gctctgataaatttccgctaaatgcccgccgcgtgcgggtttttttatgcactcaggaaa
gtggcggtaaaaaatccaccgccattctatcgccactcgaaaacgaggcaacaaaaaggc
cactcgagagagtggcctaactgtatgtatttactacttaaatttggtggcccctgctgg
acttgaaccagcgaccaagcgattatgagttcctacaagaacaaccgaaaatcaatagta
tgcgttatttatcattgacatagattgccattgtttgccaataattacctattattcgcc
atttctaccgccactttatcgccattctattatctgttactcagaaccatcgccgacata
ggttccatcaggtgcgagatgatatcttccaccaacataagtcccatctggggcaagtgt
tgggcggccagcaacataacttccatttggcgctaagcgtggaacgccaccgacataagt
tccatcgggtgcaaggcgtggtgctcctcctccaacataagtcccattaggggcaagcat
aggttgtccgtaaacataggtaccatcaggtgctaatcgaactgacatacaacctccata
acttatttgctgttagtaatgtgaactaaaggatttagtttaactgcatcctctaaatgg
tcgggtgcaaagtgcgcatatcgcatggtcatttttatatctgtatggccgagtacgcgc
tgcaacaccaaaatattaccgccattcatcataaagtgactagcgaaggtgtgacgtaaa
acgtgggtaagttgtcctgccggtagttcgatacctgttctttccaaagctgaccggaac
gcgccataacaatcactgaacaaccggccctttttatcatcaggcagagactcatagagc
tctttgctgattgggacggtgcgattttttctacctttcgtgttggtgtatgtgattttg
tatttcgcgagttggctttttctcagactctcggcctcagaccaccgtgcgccagttgcg
agacagattcttaccacggtttctaaatcagggtggtcatgtcggttacactctccgagc
agttgcgaaatttggtcgtgagttagccaagtcatttccatttcttctgtgcggaatggg
cgcatattttttagtgggttttcacccttccattctccgaggcggtttagctcattgaac
accgcccggaagtaggccagctcaagattaagcgtgcgaggcgatacctctttcactctg
tttgaacgggcatactcaccttttaaccgtttttctcggtagcgggaaaacatctgcgca
tcgaaatcgcgtgcgagtggttcgcccatacactcaaaagcatggtgcatggctaactgg
cgtttcaaaccatctttcagtgtaatgccatgagcgctataccatgaatcaaccagctct
tttaacgtgcgcctgtcttccttttcttcctgccacgggttttgaacggtgtactgctca
aacgccagagcctcgcctttagtagcgaatttctttctgatacgtttgccttttgcaccg
tttgggtagagttcacaaatccaaccgccagccggatttttacggacggtcattagttaa
cctcgctgtatacacccaccacacgccccaacgttttaatatcatcaatgccgcattcga
aaggaaccttcccgcctgcaacatgtagttttctacccggtagttttgttaactctcgaa
tgcttattgctccctcaatgtcgactagccataagccgtcagacaatgatgcttgcttgt
ccacaaaataaattttcccctcggaacggatagccatcccatctgtgagcggttttgtga
aaaattgggcatcaacactcaattgtttatcggatttgaggatttcttcacttaatgtga
atccctcaatcctttttgcgtcgctcgattctctgttatttacaaatgcttctccttctc
cggtaagtaaccactggagattagcacctgtttcaagggcacagtgagccgcaaagtcat
aggagatagcgcctcgggtgtacctgtttgacaatgagctggacgcgatatcgaagtggt
tagctaattgaattttctgcgaaaatccgtacgcctcgcagatgcggtcaagtacatcca
cgttgctccatcctaaagaatctattctcatttcgataaaacctatttactatctctcaa
ttgggagatatattttggctaaacccacgcaattgatggcaagtgttggcaaacagagtc
aaatcaattgcaaactttggctaatagggaatcatgcaatatggcttctgaaatcgcaat
catcaaagtgcctgcacctatcgttactctgcaacaattcgcagagcttgagggtgtttc
tgaacgcaccgcctaccgctggacaaccggcgacaacccttgtgtaccaatcgaaccccg
cacaatccgtaaaggctgcaagaaagcaggtggcccgattcgcatttattacgcacgctg
gaaagaagagcagttgcgtaaggcgttgggacattcccgttttcaactcgtcatcggtgc
ttaattcactttatgtgaattgtaaggatgcaacatgtttgattttcaggtttccaaaca
tccccactatgacgaagcgtgccgggcttttgcgcagcgtcacaacatggcgaagctggc
cgagcgtgcgggtatgaatgttcaaacgttacgtaacaagctcaacccagaacagcctca
ccagttcacgccgcctgaattgtggctgctgactgacctgaccgaagactcaaccctcgt
tgatggttttctggcgcagattcattgtctgccatgcgtgccggttaatgagctggctaa
agataaattgcagtcttacgtcatgcgcgcaatgagtgaactcggtgaactggcgagcgg
tgcggtatctgatgagcgtctgaccactgcccgtaagcacaacatgattgaaagcgttaa
ctccggcattcgcatgttgtcattgtcggctctggcgctgcatgcacgtctgcagactaa
tcccgctatgtcgagcgtggtcgataccatgagcggtattggcgcatcgtttggtctgat
ttgaggtgcgtatgctgaaaagtgaaccgtcatttgcgtctctgctcgttaagcaaagcc
ccggtatgcattacggccacggctggatcgcaggtaaggacggcaagcgctggcacccgt
gccgctcacagtccgaattattaaaagggctgaaaacaaagtcgccgaaatcgtcaggtt
ttttaattattcgtattgtccactttgtaattaaaggagtgaaacatgtcacgcgatgaa
ttaagaattgttttgggtgccatgattccaaatatggaggaaggttttgaaattaaaacc
cgcgacggcgcaatacttcgcgttgaccctgagtgggagtgctgcaaagaatttaaggat
ggattaaaagccgaaatcatcaagcagttaaaaagcaaacctgctgttgtatttggatat
agttaattaattaaacgtaattacttggcgtaaacccgccgggcattcttttgccaaaaa
acaggaggatatatgagtcgaactatttatttatcaacgccgagtggtgctggcgaccac
ttgctggagtctttgtttaaagaagccaaaaaagaagagcgcaaagaccgccgtctcgcc
gtttcaatccgtctcgaagatctggccgttcacattaccaattcagatatgacaggcaaa
gaagcggccgagctactgcgccgcgaagccactcgctttgagaacgaatcacaggagctt
cactaatggccgacgcaatggatttagcacaactgcgcgagcaggaagaccgcgaacgcc
acataagcaacgcgcgcagccgtcgccatgaggtttctgcatttatctgtgaggaatgcg
atgcacctatcccggaagcgcgccgccgagccataccgggcgtgcagtgctgcgttacct
gtcaggaaatcttagagctgaaaagtaaacattataacggaggtgctttatgagcattac
caatgcaactattagccagcgtgcaaaaaaatggcttgaagatgaccgtatatttattga
caccgaaactacgggtttgggtgatgatgcggaaatagtagaaatctgtttaatagatag
cgctggttttatcatgctaaatacattggttaaaccaactaaaccaattccagcagaggc
tacggccattcatggaataactgatgaaatggttatgtatgcgccaacgtggaaagatat
tcacggcgcagtagcttctttattttttgagtatggctttgttatttataacgccgatta
cgacacaagacttatatatcaaactgcgaaattatatgggcttgagaatgacggcttttg
ttattttttaaatgagcgttcggcctgcgccatgatgctatatgcagagtatcgcggcga
gccagggcgatttaaaggttataaatggcacaaattagttgatgccgctgcacatgaagg
ggttagcgttgaaggaaaggcacaccgtgcattagcagattgccggatgactcttggcat
tatcgacgctttggcaaaaggcggtgcagcatgagtatccgtatcgaaataggtgataaa
tgggtaatcaccagcgaccaatatcaattcatcctgaatgaaaaaaaagtcgttaagacc
ggcaataaagctggcgaggaatggctcgacaccatcggttattacccgaagattaatcag
ctcatttctggtctggtacatcaccacattcatacggcaatgattatttcccttagtgca
atggcagaggaaatagagaagttatcttttatctgtgaagaagcatttaaggcggttaaa
aaatgattgattcccgctgctttgctgaaagcacaataaatattgtttctgtttctggtg
gaaaggacagccttgctcaatggattcttgcggtagagaacgacgtaccgcgcaccactg
tttttgcagataccgggcatgagcattcccaaacaatggagtatctggattatcttgaat
ccagactcggcccggttattcgagtgaaagccgattttactcggcggattgaaggcaaac
ggaaattcattgctgaaaaatggcctgtctctctcgttgaagaatgcggaatgtctcatg
agcaggctgcagaacgaatcgcaaaggcactggaaatccttaagccaaccggtaatccgt
ttctcgatttgtgcatgtggaaaggacggttcccgagcacgaaagcaaggttttgttcac
tggaactgaaacatgactcagtacgggacaagattgtactcccagcgctggagaaatatg
acgaagtaattctatggcagggtgttcgtgctcaggagtcaccagcccgcgctgcgttac
ctatgtgggaggaggatgcagataatacccccggtttgcatgtgtatcgcccaattctta
actggacacatgaagacgtatttgccttagctaaacgacacggaattaaaccgaacccac
tctatcagcaaggttgtagcagagttggctgcatgccatgtattcatgcaagaaaatctg
agctggcagagatttttgctcgctggccggaggagattgcgcgcgttgcagagtgggaac
gtcttgttgctgcctgttcacgtcggggaaactcaacatttttcccttcgactcacgacc
cgcggcgagcagaaaaacgtattgaagttgttaccgtagaagaatatgggatagcttcat
atcgtgactgggcgatgactacgcgtggcggttctcagtacgatttgctcgctgctacaa
acgacaaaactgtgtgcagtagcgtttatgccggtgtatgtgaatgacgggtgtcgttta
cgcgtttccgtggaatgccccacggtcggcaatagccagctcatatcttacctatgacca
acagcatcgccgcgaccgtatgttcgcggctttgctgcatgcgagaaaggtgctttttct
ccagccagaatgtgtgcgctttgacgtttatcgcaccgctgcagttctggagcaaaatca
gggcagtcaacgagccaatgcctttttaatcagcttctgcaaaaaggcattaccacgtct
tgaactggtcgcaaaaaaatacgagtgctcgggcatcaacagcaatgtatcagccgctgt
tttcgatggtcattttgatacccagcttatgcaatatctggcgtcacgcatggtcaatat
ggtcgccagatttaaccgcctcccggatatgtcgcgcgccgatattgacctgctggccgc
ggatatcgctaattttattcgcgctgaactggccgacattgatgacaccggatttagcga
actcaaaacgctgtacacttggtacatgcgcgccggttttatttccctgcaattcaacgt
tacaccgccgaaatgggagcgtgtgactaaaaaatatttttgtgaggatgaaatcgcacc
ggcagtaatgcgcatgtttaatgaggtttggtggcgcggccgcttgcgacgcattgcggc
tgcatggcgcgaacatctgcaaattgcagtcggcaacgtaagcaagaaacgacacgcata
cgcgagtaaaaactgcgtcaccgactggcgcgagcagaagcgccgcacgcgcgaatttct
caaggggctggatctcgaagacgaagaaggcaaccgcatcagtctgattgaaaaatacga
cggctcggtcgctaatccagcaatacgccgctgtgagctgatggcccgcattcgtgggtt
tgaaaatatctgtaatgagctcggttatgtcggggagttctatactctgactgcaccgtc
taaatatcacgccaccaccaaagcgggctaccgtaacagcaaatggaacggtgcaagccc
gtcagacacgcagagctatctcacaggcctttgggcacgcatacgcgccaagctgcaccg
ggaagaaatccgcattttcggaatacgcgtcgctgaaccgcatcacgatggaacgccgca
ctggcatatgcttatgttcatgttgccggaagatgtcgagcgtgtgcgactcatcatccg
agattatgcgtgggaggaagaccactacgaactgagaagcgataaagccaaaaaggcgcg
cttccatgctgaggccattgacccggaaaaaggcagtgctactggctatgtcgctaaata
catttccaaaaatatcgacggttatgctctcgatggtgaaaccgatgacgaaagtggtga
gttgttaaaagagactgcacccgccgtttcagcatgggcggcgcgctggcacatccgtca
gtttcaatttatcggcggtgcgccggtgacggtatacagggagctacgcagaatggctga
ccctgaaacagccagggcgctcagtgttgaattcgccgcagtgcatgatgctgctcacta
tggacgctgggctgattatgtgaatgctcaaggcggaccattcgttcgccgtgacgattt
acaggtacgtacattgtatgaacctcgaactgaatttaatcagtatggcgaagaaactgt
gtgcatcaaaggtgtctacgatgcctcgataggtgctggctctcctattctaacccggtt
aacgcagtggaagattgttccaaagcgtgccgttgatttggccgttgacgttaagggcgc
ttctgcgccctctcggagttctgtcaataactgtacgggaagcgaaagcgatccaccgat
actcgatttaacaaaaccgctgagtcggcgtgaaagacgagagttgacgaaccgactcag
gaagaaaaagccaacaacacggcgaaaattcatccacggaacggataagcaaaacgtcgc
tataacgaaaactatcgacgagatacactctgacaaccggcatcacaatcagccggggcg
aagccctgcacctgatggccggtggtaaaagttgttttaacggtcgatgggtgcgcggaa
cgtcaaaaggtgaaatctttgctgcagctccttcacatcaggcgagacgcggaaaatcct
taatcgtgttgcagatttagctgagctggcaacgaaaatgtaaccgctaatattcatcca
tatcatgtacatacagtgtatttaactgtgatttttttcttcacaccttttgccaatacg
tgctactgtatgtttatacagtatctcgtagtggaggttgtgtggatagagagctaaatg
agcacgttatgattgagcgggtcgaaatgattgcgcgtctgactgctgaaggtacttgtc
aggaaagagaccgtgaaatcgcattgaatctaattgcggaaatagcaagaggcaacctaa
tgaaaaataataatttttctgttgttttttccgcaccgcctgttggtgaaacatttgcaa
aggagggcaaagtgaaagtaaatatcacgttggataaagaccaaaaaatcggccagccgg
taattgatgcttttcagtgcgaattgaccaagcgaatacagtccgttttcccgtcaacgc
gcgttactgttaaaaagggatccatgaccggtgtcgagctgatggggttcgataaagatt
cagaccgcgaagcgctggatagcatccttcaggaagtgtgggaagatgagagctggcgtt
aatccctgaaaaatgtgcaaccatcgaccccatgtttgatagcatggggttgttttgtat
gggattacacacaaaggaaaatcatggataccgtaatagcatttttatctctggctctct
ttattgcttttatcgtcgggttaatcaagccgtcgctggttcgaatgccgagccgtaagc
gctccagtgctgtttatctcggtggctgtctggcgctgggcgttattggctcaatcttat
ggccgactgaaaaaactcagccggtggcaaaaactgacgtaccggcggttaaagcggaac
cggctacgccaacgtttgagtacgcagataaaaccctcaaagaatatcgcaacgagccaa
aagaaacccggcacgaaatcgttaaagactatgttggattcaaaggtgtgcaggccagcg
ctaccgatgttttttatgcctgtatgagcgagtacacttttaccaaagatgatgcgttaa
agctcagtgatgtgttggggtggtgtttcaacgacttcgagaaagatccacaatctctga
ataataaaatcaaccttgacgaatttcagggtaattttagcggttgggatggctcttatc
gcccgttagagaagctgataaaagccagtatgaatgatgattcctcttataaacatgttt
caacggtctaccatctgattttgaataaagacccgcatgccgttgtaaaaacaacgtttc
gcggcactaatgcttatggtggcgtggtcaaacagaccgtagcagcacgcgtcaacgtgc
gaacgggcgaggtcgattcaatactcgacaattaaacatgacaaacgccgccggtgctga
aactcgctttcagtgctggcggggttgaacaacgagccccgcgaggcgttagcctacccc
tgagcaaccgcccaagaccggtactattaaagccggtttttttatgccacttttccacga
atttcccgtttttttagccgtgcatgcaacaggtgcattgttttgcatgcgtcaggcttg
cccgttctggttgtgcgtcgccagagctggcgcggctccagagtggtcatgcaactgcat
taaaaccgacccataaagtgggca