Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
paired end NGS emulator (Node.js)
JavaScript
branch: master

Fetching latest commit…

Cannot retrieve the latest commit at this time

Failed to load latest commit information.
bin
test
.gitignore
LICENCE
README.md
package.json
pairgen.config.js
pairgen.input.js
pairgen.js
pairgen.worker.js

README.md

pairgen

paired-end NGS simulator

Overview

Installation

npm install pairgen 

Usage

command line

$ pairgen [options] <fasta file> [<ranges bed file>]

[options]
  --name  name of the sequence. default = basename(path)
  --readlen length of the read. default = 100
  --tlen  length of the template. default = 400
  --dev standard deviation of the total fragment length. default = 50
  --depth physical read depth. default = 40
  --save_dir  directory to save result. default = /home/shinout/node_modules/pairgen
  --pair_id <id_type> pair id type, put pair information explicitly. id_type is one of A, 1, F, F3.
  --parallel  the number of processes to run. default: 1
  --p5  Illumina P5 adapter. default: GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
  --p7  Illumina P7 adapter. default: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
  --adapter1  Illumina Sequence Primer#1. default: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
  --adapter2  Illumina Sequence Primer#2. default: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Something went wrong with that request. Please try again.