adding dir and problem sets

lecture_scripts/problem_solutions/set_1_1/sequences.fasta

@@ -0,0 +1,8 @@
+>seq1
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq2
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq3
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq4
+ATGGCGTCTTGGCCTTAAAAGCTC

lecture_scripts/problem_solutions/set_1_1/unix_commands.txt

@@ -0,0 +1,50 @@
+Log into your machine or account. What is the full path to your home directory?
+    > pwd
+  How many files does it contain?
+    ## look for names that do not end with "/"
+    > ls -F
+  How many directories?
+    ## look for names that end with "/"
+    > ls -F
+
+Without using a text editor examine the contents of the file sequences.fasta.
+  How many lines does this file contain?
+    > wc -l sequences.fasta
+  How many characters?
+    > wc -c sequences.fasta
+  What is the first line of this file?
+    > head -1 sequences.fasta
+  What are the last 3 lines?
+    > tail -3 sequences.fasta
+  How many sequences are in the file?
+    ## grep will only print the lines that contain ">" in the file (headers)
+    ## pipe the result to "wc -l" to count the number of lines
+    > grep ">" sequences.fasta | wc -l
+
+Rename sequences.fasta to something more informative of the sequences the file contains. 
+    > mv sequences.fasta my_random_sequences.fasta
+
+Create a directory called fasta
+    > mkdir fasta
+
+Copy the fasta file that you renamed to the fasta directory
+    > cp my_random_sequences.fasta fasta
+
+Verify that the file is within the fasta directory
+    ## you can visually inspect the output from "ls fasta/" or use
+    ## "ls fasta/my_random_sequences.fasta" directly to see if the file
+    ## is there - if it lists, it's fine, otherwise it will given an error
+    > ls fasta/my_random_sequences.fasta
+
+Delete the the original file that you used for copying
+    > rm my_random_sequences.fasta
+
+Copy a directory
+    ## copy "fasta" directory and its contents to "fasta_copy"
+    ## the "-r" flag tells "cp" to copy recursively
+    > cp -r fasta fasta_copy
+
+Remove a directory
+    ## remove the "fasta" directory and its contents
+    ## the "-r" flag tells "rm" to copy recursively
+    > rm -r fasta

lecture_scripts/problem_solutions/set_1_2/add.pl

@@ -0,0 +1,17 @@
+#!/usr/bin/perl
+## add.pl
+
+use strict;
+use warnings;
+
+##first value - get it from the command line arguments
+my $value1 = shift;
+
+## second value - get it from the command line arguments
+my $value2 = shift;
+
+## add the two numbers
+my $sum = $value1 + $value2;
+
+## print the sum of the two numbers
+print $sum, "\n";

lecture_scripts/problem_solutions/set_1_2/reversec.pl

@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## reversec.pl
+
+use strict;
+use warnings;
+
+## get the sequence from the arguments
+my $sequence = shift;
+
+## reverse the sequence
+my $reverse_sequence = reverse $sequence;
+
+## complement the reverse sequence
+## tr/// modifies the content of the string directly so we'll first make a copy
+my $reverse_complement_sequence = $reverse_sequence;
+## now complement the reverse sequence
+$reverse_complement_sequence =~ tr/ACGT/TGCA/;
+
+## print the reverse complemented sequence
+print "output: $reverse_complement_sequence\n";

lecture_scripts/problem_solutions/set_2/add.pl

@@ -0,0 +1,30 @@
+#!/usr/bin/perl
+## add.pl
+
+use strict;
+use warnings;
+
+##first value - get it from the command line arguments
+my $value1 = shift;
+
+## second value - get it from the command line arguments
+my $value2 = shift;
+
+## check that both values are defined
+if (not defined $value1 or not defined $value2) {
+  print "Please provide two numbers.\n";
+}
+## check that both values are positive numbers
+elsif ($value1 < 0 or $value2 < 0) {
+  print "Please provide two positive numbers.\n";
+}
+## only run the rest of the program if the values are OK
+
+else {
+
+  ## add the two numbers
+  my $sum = $value1 + $value2;
+
+  ## print the sum of the two numbers
+  print $sum, "\n";
+}

lecture_scripts/problem_solutions/set_2/even_odd.pl

@@ -0,0 +1,52 @@
+#!/usr/bin/perl
+## even_odd.pl
+
+use strict;
+use warnings;
+
+## create file myresult.txt and open it for writing output
+open OUT, ">", "myresult.txt" or die "Error writing to file: $!\n";
+
+## open numbers.txt for reading
+open IN, "<", "numbers.txt" or die "Error reading file: $!\n";
+
+## read each line in the file
+while (my $number = <IN>) {
+
+  ## remove the newline
+  chomp $number;
+
+  ## check if the number is even -- we can use the modulus operator to see
+  ## the remainder when the number is divided by 2; if it's 0, then it's
+  ## even
+  if ($number % 2 == 0) {
+
+    ## check whether the number is less than 24
+    if ($number < 24) {
+
+      ## print the number
+      print "$number\n";
+    }
+
+  }
+  ## odd number
+  else {
+
+    ## compute the factorial of the number
+    my $factorial = 1;
+    ## go through each value from $number down to 1
+    for (my $i = $number; $i > 0; $i--) {
+      ## multiply the existing result by the new lower number
+      $factorial *= $i;
+    }
+
+    ## print the factorial
+    print OUT "$factorial\n";
+
+  }
+
+}
+
+## close the file handles
+close IN;
+close OUT;

lecture_scripts/problem_solutions/set_2/myresult.txt

@@ -0,0 +1,4 @@
+1.1962222086548e+56
+1
+8.22283865417792e+33
+120

lecture_scripts/problem_solutions/set_2/numbers.txt

@@ -0,0 +1,8 @@
+22
+45
+1
+2
+31
+32
+72
+24

lecture_scripts/problem_solutions/set_2/order.pl

@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## order.pl
+
+use strict;
+use warnings;
+
+## get the first argument
+my $string1 = shift;
+
+## get the second argument
+my $string2 = shift;
+
+## check that $string1 is "less than or equal" $string2 (already ordered)
+if ($string1 le $string2) {
+  print "right order\n";
+}
+## otherwise $string1 is "more than" $string2
+else {
+  print "wrong order\n";
+}

lecture_scripts/problem_solutions/set_2/pali.pl

@@ -0,0 +1,33 @@
+#!/usr/bin/perl
+## pali.pl
+
+use strict;
+use warnings;
+
+## get the string argument
+my $string = shift;
+
+## lowercase $string so that comparisons are case insensitive
+my $lower_case_string = lc $string;
+
+## remove whitespace from the string
+## we want to apply the substitution globally to remove ALL occurences
+## since s/// works on the string itself, we'll first make a copy
+my $lower_case_clean_string = $lower_case_string;
+## we can use s/// to remove the whitespace
+$lower_case_clean_string =~ s/\s//g;
+## we can remove all non alphanumerical characters
+$lower_case_clean_string =~ s/\W//g;
+
+## get the reverse of the string
+my $reverse_lower_case_clean_string = reverse $lower_case_clean_string;
+
+## check that forward and reverse strings are the same - if they're the same, we have a palindrome
+if ($lower_case_clean_string eq $reverse_lower_case_clean_string) {
+  print "yes!\n";
+}
+## otherwise the strings aren't the same
+else {
+  print "no!\n";
+}
+

lecture_scripts/problem_solutions/set_2/percent.pl

@@ -0,0 +1,23 @@
+#!/usr/bin/perl
+## percent.pl
+
+use strict;
+use warnings;
+
+## get the first number argument
+my $number1 = shift;
+
+## get the second number argument
+my $number2 = shift;
+
+## check that the sum of the two numbers does not equal to 0
+if ($number1 + $number2 != 0) {
+  ## calculate the percentage
+  my $percentage = $number1 / ($number1 + $number2) * 100;
+  ## use printf to print a nicely formatted percentage
+  printf "%.2f%%\n", $percentage;
+}
+## otherwise the sum equals to 0
+else {
+  print "You are trying to trick me!\n";
+}

lecture_scripts/problem_solutions/set_2/reorder.pl

@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## reorder.pl
+
+use strict;
+use warnings;
+
+## get the first argument
+my $string1 = shift;
+
+## get the second argument
+my $string2 = shift;
+
+## if $string1 is "less than or equal" $string2 (already ordered)
+if ($string1 le $string2) {
+  print "$string1 $string2\n";
+}
+## otherwise $string1 is "more than" $string2 (swap them)
+else {
+  print "$string2 $string1\n";
+}

lecture_scripts/problem_solutions/set_2/same.pl

@@ -0,0 +1,29 @@
+#!/usr/bin/perl
+## same.pl
+
+use strict;
+use warnings;
+
+## prompt user for the first string
+print "Enter string 1: ";
+## get the first string from the user input
+my $string1 = <>;
+
+## prompt user for the second string
+print "Enter string 2: ";
+## get the second string from the user input
+my $string2 = <>;
+
+## make both $string1 and $string2 lower case so that the comparison is
+## case insensitive
+my $lower_case_string1 = lc $string1;
+my $lower_case_string2 = lc $string2;
+
+## check to see if $lower_case_string1 and $lower_case_string2 are "equal"
+if ($lower_case_string1 eq $lower_case_string2) {
+  print "same\n";
+}
+## otherwise they're different
+else {
+  print "different\n";
+}

lecture_scripts/problem_solutions/set_3/divide.pl

@@ -0,0 +1,26 @@
+#!/usr/bin/perl
+## divide.pl
+
+use strict;
+use warnings;
+
+## get the first number argument
+my $dividend = shift;
+
+## get the second number argument
+my $divisor = shift;
+
+## if both arguments have not been provided, bail out
+die "Two numbers are required\n" if not defined $dividend or not defined $divisor;
+
+## if both numbers are not positive, bail out
+die "Both numbers have to be positive\n" if $dividend < 0 or $divisor < 0;
+
+## if divisor is 0, bail out
+die "Divisor cannot be zero\n" if $divisor == 0;
+
+## calculate the quotient
+my $quotient = $dividend / $divisor;
+
+## print quotient
+print "$quotient\n";

lecture_scripts/problem_solutions/set_3/line_length.pl

@@ -0,0 +1,45 @@
+#!/usr/bin/perl
+## line_length.pl
+
+use strict;
+use warnings;
+
+## get the filename argument
+my $file = shift;
+
+## total length of the file
+my $total_length = 0;
+
+## number of lines in the file
+my $number_of_lines = 0;
+
+## open a filehandle to access the file
+open IN, "<", $file or die "Error reading $file: $!\n";
+
+## read each line of the file
+while (my $line = <IN>) {
+
+  ## remove the newline
+  chomp $line;
+
+  ## add to the count of lines
+  $number_of_lines++;
+
+  ## get the length of the line
+  my $length = length $line;
+
+  ## print the length of the line to STDOUT
+  print "Line length for line $number_of_lines: $length\n";
+
+  ## add to the total length of the file up to this line
+  $total_length += $length;
+}
+
+## calculate the average line length
+my $average_line_length = $total_length / $number_of_lines;
+
+## print the average line length to STDOUT
+print "Average line length: $average_line_length\n";
+
+## close filehandles
+close IN;