diff --git a/lecture_scripts/problem_solutions/set_1_1.zip b/lecture_scripts/problem_solutions/set_1_1.zip
deleted file mode 100644
index 8397423..0000000
Binary files a/lecture_scripts/problem_solutions/set_1_1.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_1_1/sequences.fasta b/lecture_scripts/problem_solutions/set_1_1/sequences.fasta
new file mode 100644
index 0000000..504844d
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_1_1/sequences.fasta
@@ -0,0 +1,8 @@
+>seq1
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq2
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq3
+ATGGCGTCTTGGCCTTAAAAGCTC
+>seq4
+ATGGCGTCTTGGCCTTAAAAGCTC
diff --git a/lecture_scripts/problem_solutions/set_1_1/unix_commands.txt b/lecture_scripts/problem_solutions/set_1_1/unix_commands.txt
new file mode 100644
index 0000000..2f1b976
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_1_1/unix_commands.txt
@@ -0,0 +1,50 @@
+Log into your machine or account. What is the full path to your home directory?
+    > pwd
+  How many files does it contain?
+    ## look for names that do not end with "/"
+    > ls -F
+  How many directories?
+    ## look for names that end with "/"
+    > ls -F
+
+Without using a text editor examine the contents of the file sequences.fasta.
+  How many lines does this file contain?
+    > wc -l sequences.fasta
+  How many characters?
+    > wc -c sequences.fasta
+  What is the first line of this file?
+    > head -1 sequences.fasta
+  What are the last 3 lines?
+    > tail -3 sequences.fasta
+  How many sequences are in the file?
+    ## grep will only print the lines that contain ">" in the file (headers)
+    ## pipe the result to "wc -l" to count the number of lines
+    > grep ">" sequences.fasta | wc -l
+
+Rename sequences.fasta to something more informative of the sequences the file contains. 
+    > mv sequences.fasta my_random_sequences.fasta
+
+Create a directory called fasta
+    > mkdir fasta
+
+Copy the fasta file that you renamed to the fasta directory
+    > cp my_random_sequences.fasta fasta
+
+Verify that the file is within the fasta directory
+    ## you can visually inspect the output from "ls fasta/" or use
+    ## "ls fasta/my_random_sequences.fasta" directly to see if the file
+    ## is there - if it lists, it's fine, otherwise it will given an error
+    > ls fasta/my_random_sequences.fasta
+
+Delete the the original file that you used for copying
+    > rm my_random_sequences.fasta
+
+Copy a directory
+    ## copy "fasta" directory and its contents to "fasta_copy"
+    ## the "-r" flag tells "cp" to copy recursively
+    > cp -r fasta fasta_copy
+
+Remove a directory
+    ## remove the "fasta" directory and its contents
+    ## the "-r" flag tells "rm" to copy recursively
+    > rm -r fasta
diff --git a/lecture_scripts/problem_solutions/set_1_2.zip b/lecture_scripts/problem_solutions/set_1_2.zip
deleted file mode 100644
index 52593ba..0000000
Binary files a/lecture_scripts/problem_solutions/set_1_2.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_1_2/add.pl b/lecture_scripts/problem_solutions/set_1_2/add.pl
new file mode 100755
index 0000000..ae5e5d2
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_1_2/add.pl
@@ -0,0 +1,17 @@
+#!/usr/bin/perl
+## add.pl
+
+use strict;
+use warnings;
+
+##first value - get it from the command line arguments
+my $value1 = shift;
+
+## second value - get it from the command line arguments
+my $value2 = shift;
+
+## add the two numbers
+my $sum = $value1 + $value2;
+
+## print the sum of the two numbers
+print $sum, "\n";
diff --git a/lecture_scripts/problem_solutions/set_1_2/reversec.pl b/lecture_scripts/problem_solutions/set_1_2/reversec.pl
new file mode 100755
index 0000000..1bf08b5
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_1_2/reversec.pl
@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## reversec.pl
+
+use strict;
+use warnings;
+
+## get the sequence from the arguments
+my $sequence = shift;
+
+## reverse the sequence
+my $reverse_sequence = reverse $sequence;
+
+## complement the reverse sequence
+## tr/// modifies the content of the string directly so we'll first make a copy
+my $reverse_complement_sequence = $reverse_sequence;
+## now complement the reverse sequence
+$reverse_complement_sequence =~ tr/ACGT/TGCA/;
+
+## print the reverse complemented sequence
+print "output: $reverse_complement_sequence\n";
diff --git a/lecture_scripts/problem_solutions/set_2.zip b/lecture_scripts/problem_solutions/set_2.zip
deleted file mode 100644
index e59a337..0000000
Binary files a/lecture_scripts/problem_solutions/set_2.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_2/add.pl b/lecture_scripts/problem_solutions/set_2/add.pl
new file mode 100755
index 0000000..ecc53f5
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/add.pl
@@ -0,0 +1,30 @@
+#!/usr/bin/perl
+## add.pl
+
+use strict;
+use warnings;
+
+##first value - get it from the command line arguments
+my $value1 = shift;
+
+## second value - get it from the command line arguments
+my $value2 = shift;
+
+## check that both values are defined
+if (not defined $value1 or not defined $value2) {
+  print "Please provide two numbers.\n";
+}
+## check that both values are positive numbers
+elsif ($value1 < 0 or $value2 < 0) {
+  print "Please provide two positive numbers.\n";
+}
+## only run the rest of the program if the values are OK
+
+else {
+
+  ## add the two numbers
+  my $sum = $value1 + $value2;
+
+  ## print the sum of the two numbers
+  print $sum, "\n";
+}
diff --git a/lecture_scripts/problem_solutions/set_2/even_odd.pl b/lecture_scripts/problem_solutions/set_2/even_odd.pl
new file mode 100755
index 0000000..e90feac
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/even_odd.pl
@@ -0,0 +1,52 @@
+#!/usr/bin/perl
+## even_odd.pl
+
+use strict;
+use warnings;
+
+## create file myresult.txt and open it for writing output
+open OUT, ">", "myresult.txt" or die "Error writing to file: $!\n";
+
+## open numbers.txt for reading
+open IN, "<", "numbers.txt" or die "Error reading file: $!\n";
+
+## read each line in the file
+while (my $number = <IN>) {
+
+  ## remove the newline
+  chomp $number;
+
+  ## check if the number is even -- we can use the modulus operator to see
+  ## the remainder when the number is divided by 2; if it's 0, then it's
+  ## even
+  if ($number % 2 == 0) {
+
+    ## check whether the number is less than 24
+    if ($number < 24) {
+
+      ## print the number
+      print "$number\n";
+    }
+
+  }
+  ## odd number
+  else {
+
+    ## compute the factorial of the number
+    my $factorial = 1;
+    ## go through each value from $number down to 1
+    for (my $i = $number; $i > 0; $i--) {
+      ## multiply the existing result by the new lower number
+      $factorial *= $i;
+    }
+
+    ## print the factorial
+    print OUT "$factorial\n";
+
+  }
+
+}
+
+## close the file handles
+close IN;
+close OUT;
diff --git a/lecture_scripts/problem_solutions/set_2/myresult.txt b/lecture_scripts/problem_solutions/set_2/myresult.txt
new file mode 100644
index 0000000..8dbfb01
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/myresult.txt
@@ -0,0 +1,4 @@
+1.1962222086548e+56
+1
+8.22283865417792e+33
+120
diff --git a/lecture_scripts/problem_solutions/set_2/numbers.txt b/lecture_scripts/problem_solutions/set_2/numbers.txt
new file mode 100644
index 0000000..120c798
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/numbers.txt
@@ -0,0 +1,8 @@
+22
+45
+1
+2
+31
+32
+72
+24
diff --git a/lecture_scripts/problem_solutions/set_2/order.pl b/lecture_scripts/problem_solutions/set_2/order.pl
new file mode 100755
index 0000000..fafdada
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/order.pl
@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## order.pl
+
+use strict;
+use warnings;
+
+## get the first argument
+my $string1 = shift;
+
+## get the second argument
+my $string2 = shift;
+
+## check that $string1 is "less than or equal" $string2 (already ordered)
+if ($string1 le $string2) {
+  print "right order\n";
+}
+## otherwise $string1 is "more than" $string2
+else {
+  print "wrong order\n";
+}
diff --git a/lecture_scripts/problem_solutions/set_2/pali.pl b/lecture_scripts/problem_solutions/set_2/pali.pl
new file mode 100755
index 0000000..cfa3337
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/pali.pl
@@ -0,0 +1,33 @@
+#!/usr/bin/perl
+## pali.pl
+
+use strict;
+use warnings;
+
+## get the string argument
+my $string = shift;
+
+## lowercase $string so that comparisons are case insensitive
+my $lower_case_string = lc $string;
+
+## remove whitespace from the string
+## we want to apply the substitution globally to remove ALL occurences
+## since s/// works on the string itself, we'll first make a copy
+my $lower_case_clean_string = $lower_case_string;
+## we can use s/// to remove the whitespace
+$lower_case_clean_string =~ s/\s//g;
+## we can remove all non alphanumerical characters
+$lower_case_clean_string =~ s/\W//g;
+
+## get the reverse of the string
+my $reverse_lower_case_clean_string = reverse $lower_case_clean_string;
+
+## check that forward and reverse strings are the same - if they're the same, we have a palindrome
+if ($lower_case_clean_string eq $reverse_lower_case_clean_string) {
+  print "yes!\n";
+}
+## otherwise the strings aren't the same
+else {
+  print "no!\n";
+}
+ 
diff --git a/lecture_scripts/problem_solutions/set_2/percent.pl b/lecture_scripts/problem_solutions/set_2/percent.pl
new file mode 100755
index 0000000..4f38a5e
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/percent.pl
@@ -0,0 +1,23 @@
+#!/usr/bin/perl
+## percent.pl
+
+use strict;
+use warnings;
+
+## get the first number argument
+my $number1 = shift;
+
+## get the second number argument
+my $number2 = shift;
+
+## check that the sum of the two numbers does not equal to 0
+if ($number1 + $number2 != 0) {
+  ## calculate the percentage
+  my $percentage = $number1 / ($number1 + $number2) * 100;
+  ## use printf to print a nicely formatted percentage
+  printf "%.2f%%\n", $percentage;
+}
+## otherwise the sum equals to 0
+else {
+  print "You are trying to trick me!\n";
+}
diff --git a/lecture_scripts/problem_solutions/set_2/reorder.pl b/lecture_scripts/problem_solutions/set_2/reorder.pl
new file mode 100755
index 0000000..5f004bb
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/reorder.pl
@@ -0,0 +1,20 @@
+#!/usr/bin/perl
+## reorder.pl
+
+use strict;
+use warnings;
+
+## get the first argument
+my $string1 = shift;
+
+## get the second argument
+my $string2 = shift;
+
+## if $string1 is "less than or equal" $string2 (already ordered)
+if ($string1 le $string2) {
+  print "$string1 $string2\n";
+}
+## otherwise $string1 is "more than" $string2 (swap them)
+else {
+  print "$string2 $string1\n";
+}
diff --git a/lecture_scripts/problem_solutions/set_2/same.pl b/lecture_scripts/problem_solutions/set_2/same.pl
new file mode 100755
index 0000000..45554c2
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_2/same.pl
@@ -0,0 +1,29 @@
+#!/usr/bin/perl
+## same.pl
+
+use strict;
+use warnings;
+
+## prompt user for the first string
+print "Enter string 1: ";
+## get the first string from the user input
+my $string1 = <>;
+
+## prompt user for the second string
+print "Enter string 2: ";
+## get the second string from the user input
+my $string2 = <>;
+
+## make both $string1 and $string2 lower case so that the comparison is
+## case insensitive
+my $lower_case_string1 = lc $string1;
+my $lower_case_string2 = lc $string2;
+
+## check to see if $lower_case_string1 and $lower_case_string2 are "equal"
+if ($lower_case_string1 eq $lower_case_string2) {
+  print "same\n";
+}
+## otherwise they're different
+else {
+  print "different\n";
+}
diff --git a/lecture_scripts/problem_solutions/set_3.zip b/lecture_scripts/problem_solutions/set_3.zip
deleted file mode 100644
index 7da569d..0000000
Binary files a/lecture_scripts/problem_solutions/set_3.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_3/divide.pl b/lecture_scripts/problem_solutions/set_3/divide.pl
new file mode 100755
index 0000000..c08103e
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_3/divide.pl
@@ -0,0 +1,26 @@
+#!/usr/bin/perl
+## divide.pl
+
+use strict;
+use warnings;
+
+## get the first number argument
+my $dividend = shift;
+
+## get the second number argument
+my $divisor = shift;
+
+## if both arguments have not been provided, bail out
+die "Two numbers are required\n" if not defined $dividend or not defined $divisor;
+
+## if both numbers are not positive, bail out
+die "Both numbers have to be positive\n" if $dividend < 0 or $divisor < 0;
+
+## if divisor is 0, bail out
+die "Divisor cannot be zero\n" if $divisor == 0;
+
+## calculate the quotient
+my $quotient = $dividend / $divisor;
+
+## print quotient
+print "$quotient\n";
diff --git a/lecture_scripts/problem_solutions/set_3/line_length.pl b/lecture_scripts/problem_solutions/set_3/line_length.pl
new file mode 100755
index 0000000..c88fbc3
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_3/line_length.pl
@@ -0,0 +1,45 @@
+#!/usr/bin/perl
+## line_length.pl
+
+use strict;
+use warnings;
+
+## get the filename argument
+my $file = shift;
+
+## total length of the file
+my $total_length = 0;
+
+## number of lines in the file
+my $number_of_lines = 0;
+
+## open a filehandle to access the file
+open IN, "<", $file or die "Error reading $file: $!\n";
+
+## read each line of the file
+while (my $line = <IN>) {
+
+  ## remove the newline
+  chomp $line;
+
+  ## add to the count of lines
+  $number_of_lines++;
+
+  ## get the length of the line
+  my $length = length $line;
+
+  ## print the length of the line to STDOUT
+  print "Line length for line $number_of_lines: $length\n";
+
+  ## add to the total length of the file up to this line
+  $total_length += $length;
+}
+
+## calculate the average line length
+my $average_line_length = $total_length / $number_of_lines;
+
+## print the average line length to STDOUT
+print "Average line length: $average_line_length\n";
+
+## close filehandles
+close IN;
diff --git a/lecture_scripts/problem_solutions/set_3/lines.txt b/lecture_scripts/problem_solutions/set_3/lines.txt
new file mode 100644
index 0000000..3e980b4
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_3/lines.txt
@@ -0,0 +1,7 @@
+Two numbers are required.
+Numbers have to be positive.
+Divisor cannot be zero.
+Write the quotient to STDOUT
+Write any errors to STDERR
+Redirect STDOUT to an output file (out.txt)
+Redirect STDERR to an error file (err.txt)
diff --git a/lecture_scripts/problem_solutions/set_3/lines_uc.txt b/lecture_scripts/problem_solutions/set_3/lines_uc.txt
new file mode 100644
index 0000000..0948733
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_3/lines_uc.txt
@@ -0,0 +1,7 @@
+TWO NUMBERS ARE REQUIRED.
+NUMBERS HAVE TO BE POSITIVE.
+DIVISOR CANNOT BE ZERO.
+WRITE THE QUOTIENT TO STDOUT
+WRITE ANY ERRORS TO STDERR
+REDIRECT STDOUT TO AN OUTPUT FILE (OUT.TXT)
+REDIRECT STDERR TO AN ERROR FILE (ERR.TXT)
diff --git a/lecture_scripts/problem_solutions/set_3/upper_case_file.pl b/lecture_scripts/problem_solutions/set_3/upper_case_file.pl
new file mode 100755
index 0000000..356288a
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_3/upper_case_file.pl
@@ -0,0 +1,34 @@
+#!/usr/bin/perl
+## upper_case_file.pl
+
+use strict;
+use warnings;
+
+## get the filename argument for reading
+my $in_file = shift;
+
+## get the filename argument for writing
+my $out_file = shift;
+
+## open the filehandle to read from $in_file
+open IN, "<", $in_file or die "Error reading $in_file: $!\n";
+
+## open the filehandle to write to $out_file
+open OUT, ">", $out_file or die "Error writing $out_file: $!\n";
+
+## read each line from $in_file
+while (my $line = <IN>) {
+
+  ## remove the newline
+  chomp $line;
+
+  ## make letters uppercase
+  my $upper_case_line = uc $line;
+
+  ## write the uppercase line to the $out_file
+  print OUT "$upper_case_line\n";
+}
+
+## close filehandles
+close IN;
+close OUT;
diff --git a/lecture_scripts/problem_solutions/set_4.zip b/lecture_scripts/problem_solutions/set_4.zip
deleted file mode 100644
index 7b314f4..0000000
Binary files a/lecture_scripts/problem_solutions/set_4.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_4/calculate_gc_content.pl b/lecture_scripts/problem_solutions/set_4/calculate_gc_content.pl
new file mode 100755
index 0000000..a29d3e2
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_4/calculate_gc_content.pl
@@ -0,0 +1,49 @@
+#!/usr/bin/perl
+## calculate_gc_content.pl
+
+use strict;
+use warnings;
+
+## DNA sequence
+my $sequence_string = "AGTTGTTACATGAAATCTGCAGTTTCATAATTTC";
+
+## Turn a DNA string into an array with split()
+## if we split on and empty string, we can put each character of the
+## string into the array
+my @sequence = split "", $sequence_string;
+
+## total length of the sequence
+my $length = 0;
+
+## number of C's
+my $number_of_c = 0;
+
+## number of G's
+my $number_of_g = 0;
+
+## Use a foreach loop to look at each nucleotide in turn
+foreach my $nucleotide (@sequence) {
+  
+  ## increment $length by one since we're accessing a nucleotide
+  $length++;
+
+  ## check if $nucleotide is a C
+  if ($nucleotide eq "C") {
+
+    ## increment $number_of_c
+    $number_of_c++;
+
+  }
+  ## check if $nucleotide is a G
+  elsif ($nucleotide eq "G") {
+
+    ## increment $number_of_g
+    $number_of_g++;
+  }
+
+}
+
+## calculate GC content (g + c) / length * 100
+my $gc_content = ($number_of_g + $number_of_c) / $length * 100;
+
+printf "GC content: %.2f%%\n", $gc_content;
diff --git a/lecture_scripts/problem_solutions/set_4/compare_sequences.pl b/lecture_scripts/problem_solutions/set_4/compare_sequences.pl
new file mode 100755
index 0000000..07452ee
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_4/compare_sequences.pl
@@ -0,0 +1,39 @@
+#!/usr/bin/perl
+## compare_sequences.pl
+
+use strict;
+use warnings;
+
+## first sequence from sequence alignment
+my $sequence1_string = "AGTTGTTACATGAAATCTGCAG--TTTCATAATTTCCGTGGGTCGGGCCGGGCGGGCCAGGCGCTGGGCACG---------";
+
+## second sequence from sequence alignment
+my $sequence2_string = "-GAAAAAACA-GAAGAGGGAAGGATACCAGA------GCGGTTCATACAGGGC---CCAGAAACTAGGCGAGGTGACCCCT";
+
+## Turn each string into an array with split()
+## if we split on and empty string, we can put each character of the
+## string into the array
+my @sequence1 = split "", $sequence1_string;
+my @sequence2 = split "", $sequence2_string;
+
+## Use a for loop to compare each index for nucleotide differences
+## since both sequences are the same length (it's an alignment) we want
+## want to use the same index to compare the array values
+for (my $i = 0; $i < scalar(@sequence1); $i++) {
+
+  ## get the nucleotide for each alignment at the given index
+  my $nucleotide1 = $sequence1[$i];
+  my $nucleotide2 = $sequence2[$i];
+
+  ## check whether $nucleotide1 is different from $nucleotide2
+  ## remember that nucleotides are strings, so we use "ne"
+  if ($nucleotide1 ne $nucleotide2) {
+
+    ## print the nucleotide position
+    ## since indexes are 0-based, we'll add 1 to to the index to give
+    ## a position that makes sense for people (1-based)
+    print $i + 1, "\n";
+
+  }
+
+}
diff --git a/lecture_scripts/problem_solutions/set_4/shuffle_sequence.pl b/lecture_scripts/problem_solutions/set_4/shuffle_sequence.pl
new file mode 100755
index 0000000..24f33a4
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_4/shuffle_sequence.pl
@@ -0,0 +1,45 @@
+#!/usr/bin/perl
+## shuffle_sequence.pl
+
+use strict;
+use warnings;
+
+## DNA sequence
+my $sequence = "AGTTGTTACATGAAATCTGCAGTTTCATAATTTC";
+
+## turn DNA string into an array
+## if we split on and empty string, we can put each character of the
+## string into the array
+my @nucleotides = split "", $sequence;
+
+## use a for loop to run the loop N times (N = length of seq)
+for (my $i = 0; $i < scalar(@nucleotides); $i++) {
+
+  ## get two random positions using rand
+  ## we want the random position to be <= the length of $sequence
+  ## we can use the int function to get an integer to use as an index
+  ## perldoc -f rand for more information on rand
+  my $random_position_a = int(rand(scalar(@nucleotides)));
+  my $random_position_b = int(rand(scalar(@nucleotides)));
+
+  ## exchange the letters in the @nucleotides array
+  ## you can do it in a single operation, but it might be conceptually
+  ## easier to understand a 3 step approach where we use a temporary
+  ## variable
+
+  ## first take the base at $random_position_a and store to a temporary
+  ## variable
+  my $tmp_nucleotide = $nucleotides[$random_position_a];
+
+  ## assign the nucleotide at $random_position_b to $random_position_a
+  $nucleotides[$random_position_a] = $nucleotides[$random_position_b];
+
+  ## assign the nucleotide at $random_position_b to $tmp_nucleotide
+  $nucleotides[$random_position_b] = $tmp_nucleotide;
+}
+
+## put the shuffled nucleotides into a new sequence string
+my $shuffled_sequence = join "", @nucleotides;
+
+## print the shuffled sequence
+print "$shuffled_sequence\n";
diff --git a/lecture_scripts/problem_solutions/set_5.zip b/lecture_scripts/problem_solutions/set_5.zip
deleted file mode 100644
index d6ee76f..0000000
Binary files a/lecture_scripts/problem_solutions/set_5.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_5/codon_usage.pl b/lecture_scripts/problem_solutions/set_5/codon_usage.pl
new file mode 100755
index 0000000..b9c1111
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_5/codon_usage.pl
@@ -0,0 +1,37 @@
+#!/usr/bin/perl
+## codon_usage.pl
+
+use strict;
+use warnings;
+
+## dna sequence
+my $sequence = "AGCTTAAGGCCGTTAAAATTAAGC";
+
+## hash to keep count of codons
+my %codon_usage = ();
+
+## we can use a for loop to go through our sequence and extract the codons
+## we usually increment the position by one (++), but in this case
+## we can increment the position by 3, since we're looking at 3 bases at a
+## time.
+## we still want to stop the loop when we reach the end of our sequence
+for (my $offset = 0; $offset < length($sequence); $offset += 3) {
+
+  ## extract the codon from the sequence
+  my $codon = substr($sequence, $offset, 3);
+
+  ## increment the count for $codon in the %codon_usage hash
+  $codon_usage{$codon}++;
+
+}
+
+## report the codon usage
+foreach my $codon (keys %codon_usage) {
+
+  ## get the count for $codon
+  my $count = $codon_usage{$codon};
+
+  ## print the codon usage to STDOUT
+  print "$codon - $count\n";
+
+}
diff --git a/lecture_scripts/problem_solutions/set_5/expression.data b/lecture_scripts/problem_solutions/set_5/expression.data
new file mode 100644
index 0000000..ad29875
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_5/expression.data
@@ -0,0 +1,4 @@
+CDC2	brain	34.5	AGCGCGGTGAGTTTGAAACTGCTCGCACTTGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGAC
+ALT	liver	9.2	ATGTTCAGAAGAAGTTTAAAACTATTAAGTAAAGAAACCATTACTCGTGTTAAACCAAATACAACTATTG	
+ARG1	liver	458.5	AGCCGATGCGTGGCGCCCCGGCGGCCACGCCGCCGCCCGCTACGGAATCGGCGGCCGAGCGGCTGCGCCG
+TSHR	thyroid	2.8	CCTCCTCCACAGTGGTGAGGTCACAGCCCCTTGGAGCCCTCCCTCTTCCCACCCCTCCCGCTCCCGGGTC
diff --git a/lecture_scripts/problem_solutions/set_5/expression.pl b/lecture_scripts/problem_solutions/set_5/expression.pl
new file mode 100755
index 0000000..95ce202
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_5/expression.pl
@@ -0,0 +1,86 @@
+#!/usr/bin/perl
+## expression.pl
+
+use strict;
+use warnings;
+
+## get the filename to open from the arguments
+my $filename = shift;
+
+## open the expression file
+open IN, "<", $filename or die "Cannot open $filename: $!\n";
+
+## hash to store tissue information
+my %tissue = ();
+
+## hash to store expression levels
+my %expr = ();
+
+## hash to store sequences
+my %seq = ();
+
+## read each line from the expression file
+while (my $line = <IN>) {
+
+  ## remove the newline
+  chomp $line;
+
+  ## split the line on tabs
+  my @columns = split /\t/, $line;
+
+  ## gene id (1st column)
+  my $gene_id = $columns[0];
+
+  ## tissue (2nd column)
+  my $tissue_data = $columns[1];
+
+  ## expression (3rd column)
+  my $expression_data = $columns[2];
+
+  ## sequence (4th column)
+  my $sequence_data = $columns[3];
+
+  ## in the 3 hashes $gene_id will be the key
+
+  ## add to %tissue
+  $tissue{$gene_id} = $tissue_data;
+
+  ## add to %expr
+  $expr{$gene_id} = $expression_data;
+
+  ## add to %seq
+  $seq{$gene_id} = $sequence_data;
+
+}
+
+## array to keep track of gene_id's expressed in liver
+my @gene_ids_expressed_in_liver = ();
+
+## search %tissue for genes that are expressed in liver
+## (where the value is "liver")
+foreach my $gene_id (keys %tissue) {
+
+  ## get the tissue the gene is expressed in
+  my $tissue_data = $tissue{$gene_id};
+
+  ## check whether the tissue equals "liver"
+  if ($tissue_data eq "liver") {
+
+    ## add gene_id to @gene_ids_expressed_in_liver
+    push @gene_ids_expressed_in_liver, $gene_id;
+
+  }
+
+}
+
+## create a report of the gene id and expression level for genes expressed in
+## liver
+foreach my $gene_id (@gene_ids_expressed_in_liver) {
+    
+  ## get the expression level
+  my $expression_data = $expr{$gene_id};
+
+  ## print the gene id and expression levels to STDOUT
+  print "$gene_id\t- $expression_data\n";
+
+}
diff --git a/lecture_scripts/problem_solutions/set_6.zip b/lecture_scripts/problem_solutions/set_6.zip
deleted file mode 100644
index 78e1658..0000000
Binary files a/lecture_scripts/problem_solutions/set_6.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_6/restriction_site.pl b/lecture_scripts/problem_solutions/set_6/restriction_site.pl
new file mode 100755
index 0000000..8d08044
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_6/restriction_site.pl
@@ -0,0 +1,77 @@
+#!/usr/bin/perl
+## restriction_site.pl
+
+use strict;
+use warnings;
+
+## sequence
+my $sequence = "GAATTCAAGTTCTTGTGCGCACACAAATCCAATAAAAACTATTGTGCACACAGACGCGAC
+TTCGCGGTCTCGCTTGTTCTTGTTGTATTCGTATTTTCATTTCTCGTTCTGTTTCTACTT
+AACAATGTGGTGATAATATAAAAAATAAAGCAATTCAAAAGTGTATGACTTAATTAATGA
+GCGATTTTTTTTTTGAAATCAAATTTTTGGAACATTTTTTTTAAATTCAAATTTTGGCGA
+AAATTCAATATCGGTTCTACTATCCATAATATAATTCATCAGGAATACATCTTCAAAGGC
+AAACGGTGACAACAAAATTCAGGCAATTCAGGCAAATACCGAATGACCAGCTTGGTTATC
+AATTCTAGAATTTGTTTTTTGGTTTTTATTTATCATTGTAAATAAGACAAACATTTGTTC
+CTAGTAAAGAATGTAACACCAGAAGTCACGTAAAATGGTGTCCCCATTGTTTAAACGGTT
+GTTGGGACCAATGGAGTTCGTGGTAACAGTACATCTTTCCCCTTGAATTTGCCATTCAAA
+ATTTGCGGTGGAATACCTAACAAATCCAGTGAATTTAAGAATTGCGATGGGTAATTGACA
+TGAATTCCAAGGTCAAATGCTAAGAGATAGTTTAATTTATGTTTGAGACAATCAATTCCC
+CAATTTTTCTAAGACTTCAATCAATCTCTTAGAATCCGCCTCTGGAGGTGCACTCAGCCG
+CACGTCGGGCTCACCAAATATGTTGGGGTTGTCGGTGAACTCGAATAGAAATTATTGTCG
+CCTCCATCTTCATGGCCGTGAAATCGGCTCGCTGACGGGCTTCTCGCGCTGGATTTTTTC
+ACTATTTTTGAATACATCATTAACGCAATATATATATATATATATTTAT";
+
+## R^AATTY is the restriction site for ApoI
+## R can be either A or G
+## Y can be either C or T
+## we can using [] in the regular expression to have different characters
+## grouping (R) and (ATTY) separately allows us to add characters between
+## the two groupings
+my $apoI_cutsite_regex = "([AG])(AATT[CT])";
+
+## remove the newlines from $seq - since there are many, we'll use a global
+## substitution
+$sequence =~ s/\n//g;
+
+## print all restriction sites in $seq
+
+print "Restriction sites:\n";
+
+## if we do a global search we can go through each match
+while ($sequence =~ /$apoI_cutsite_regex/g) {
+
+  ## the restriction site will be $1$2
+  my $restriction_site = "$1$2";
+
+  print "$restriction_site\n";
+
+}
+
+## add cuts to the sequence
+## make a copy of the sequence
+my $sequence_with_cuts = $sequence;
+
+## "^" needs to go between $1 and $2 (our subpatterns) - we can use s/// to
+## handle this globally
+$sequence_with_cuts =~ s/$apoI_cutsite_regex/$1^$2/g;
+
+## print $sequence_with_cuts
+print "Sequence with cut sites:\n";
+print "$sequence_with_cuts\n";
+
+## $sequence_with_cuts has "^" at the cut sites - we can use that to split
+## the string into an array of fragments
+my @fragments = split /\^/, $sequence_with_cuts;
+
+## we need to sort the array of fragments
+## sorting should order sequences in reverse order by length
+## since we want a reverse order, we want to compare $b and $a, rather than
+## $a and $b
+## we're comparing integers, so we need to use <=>
+my @sorted_fragments = sort { length($b) <=> length($a) } @fragments;
+
+## print fragments along with their lengths
+print "Sorted fragments:\n";
+foreach my $fragment (@sorted_fragments) {
+  printf "[%3d] %s\n", length($fragment), $fragment;
+}
diff --git a/lecture_scripts/problem_solutions/set_7.zip b/lecture_scripts/problem_solutions/set_7.zip
deleted file mode 100644
index 37a4477..0000000
Binary files a/lecture_scripts/problem_solutions/set_7.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_7/reverse_complement.pl b/lecture_scripts/problem_solutions/set_7/reverse_complement.pl
new file mode 100755
index 0000000..8f3b1a4
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_7/reverse_complement.pl
@@ -0,0 +1,43 @@
+#!/usr/bin/perl
+## reverse_complement.pl
+
+use strict;
+use warnings;
+
+## get the sequence from the arguments to the program
+my $input_sequence = shift;
+
+## call the reverse_complement subroutine and assign the returned value
+## from the subroutine to a new variable
+my $reverse_complement_input_sequence = reverse_complement($input_sequence);
+
+## print the reverse complement
+print "$reverse_complement_input_sequence\n";
+
+
+## subroutines ##
+
+## this will take a sequence string as an argument and
+## return the reverse complement
+sub reverse_complement {
+
+  ## get the sequence argument for the subroutine
+  ## just like we can call "shift" to get an argument for the program
+  ## we can call shift to get an argument to the subroutine
+  my $sequence = shift;
+
+  ## reverse the sequence
+  my $reverse_sequence = reverse $sequence;
+
+  ## create a copy of the reversed string which will become the complement
+  my $reverse_complement_sequence = $reverse_sequence;
+
+  ## complement the reverse string
+  ## we can use tr/// to transliterate characters
+  $reverse_complement_sequence =~ tr/ACGT/TGCA/;
+
+  ## return the reverse complement
+  ## code that calls this subroutine will be able to use this returned value
+  return $reverse_complement_sequence;
+
+}
diff --git a/lecture_scripts/problem_solutions/set_8.zip b/lecture_scripts/problem_solutions/set_8.zip
deleted file mode 100644
index 21854c6..0000000
Binary files a/lecture_scripts/problem_solutions/set_8.zip and /dev/null differ
diff --git a/lecture_scripts/problem_solutions/set_8/.FastaUtilities.pm.swp b/lecture_scripts/problem_solutions/set_8/.FastaUtilities.pm.swp
new file mode 100644
index 0000000..d9ddf68
Binary files /dev/null and b/lecture_scripts/problem_solutions/set_8/.FastaUtilities.pm.swp differ
diff --git a/lecture_scripts/problem_solutions/set_8/FastaUtilities.pm b/lecture_scripts/problem_solutions/set_8/FastaUtilities.pm
new file mode 100644
index 0000000..a66cb1f
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_8/FastaUtilities.pm
@@ -0,0 +1,94 @@
+## tell Perl that we're creating a package, not a regular script
+package FastaUtilities;
+
+## tell perl that we'll be exporting stuff
+use base "Exporter";
+
+## export some functions
+our @EXPORT = qw(get_id get_description get_sequence reformat_sequence);
+
+## regex should be in single quotes since we have \
+my $regex = '>(\S+)\s?(.*)';
+
+## extract the id from the fasta entry
+sub get_id {
+
+  ## get the fasta string ">id description\nseq_chunk\nseq_chunk..."
+  my $fasta = shift;
+
+  ## break $fasta into individual lines
+  my @lines = split /\n/, $fasta;
+
+  ## the defline will be the first line in the entry
+  my $defline = shift @lines;
+
+  ## search the defline with our regex
+  $defline =~ /$regex/;
+
+  ## id will be the first subgrouping match
+  my $id = $1;
+
+  return $id;
+
+}
+
+## extract the description from the fasta entry
+sub get_description {
+
+  ## get the fasta string ">id description\nseq_chunk\nseq_chunk..."
+  my $fasta = shift;
+
+  ## break $fasta into individual lines
+  my @lines = split /\n/, $fasta;
+
+  ## the defline will be the first line in the entry
+  my $defline = shift @lines;
+
+  ## search the defline with our regex
+  $defline =~ /$regex/;
+
+  ## description will be the second subgrouping match
+  my $description = $2;
+
+  return $description;
+
+}
+
+## extract the sequence from the fasta entry
+sub get_sequence {
+
+  ## get the fasta string ">id description\nseq_chunk\nseq_chunk..."
+  my $fasta = shift;
+
+  ## break $fasta into individual lines
+  my @lines = split /\n/, $fasta;
+
+  ## get rid of the first line (defline) - we don't care about it here
+  shift @lines;
+
+  ## join the rest of the array (which is all sequence) as a single string
+  my $sequence = join "", @lines;
+
+  return $sequence;
+}
+
+## reformat the sequence to user specified number of characters
+sub reformat_sequence {
+
+  ## get the fasta string
+  my $fasta = shift;
+
+  ## get the line length
+  my $length = shift;
+
+  ## get the sequence - we're calling the defined function
+  my $sequence = get_sequence($fasta);
+
+  ## use s/// to insert newlines at $length number of character
+  $sequence =~ s/(.{$length})/$1\n/g;
+
+  return $sequence;  
+}
+
+## must always put "1;" at the end of a package
+1;
diff --git a/lecture_scripts/problem_solutions/set_8/SequenceUtilities.pm b/lecture_scripts/problem_solutions/set_8/SequenceUtilities.pm
new file mode 100755
index 0000000..df69186
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_8/SequenceUtilities.pm
@@ -0,0 +1,43 @@
+package SequenceUtilities;
+## SequenceUtilities.pm
+## This module contains a number of useful subroutines for sequence
+## manipulation -- at this point it only contains reverse_complement
+
+use strict;
+use warnings;
+
+## make Exporter available so that we can export subroutines
+use base "Exporter";
+
+## add to the @EXPORT array the name of the subroutine
+## you'll often see people use qw() which just creates a list
+## where each element is treated as a string -- "quote word == qw"
+our @EXPORT = qw(reverse_complement);
+
+## this will take a sequence string as an argument and
+## return the reverse complement
+sub reverse_complement {
+
+  ## get the sequence argument for the subroutine
+  ## just like we can call "shift" to get an argument for the program
+  ## we can call shift to get an argument to the subroutine
+  my $sequence = shift;
+
+  ## reverse the sequence
+  my $reverse_sequence = reverse $sequence;
+
+  ## create a copy of the reversed string which will become the complement
+  my $reverse_complement_sequence = $reverse_sequence;
+
+  ## complement the reverse string
+  ## we can use tr/// to transliterate characters
+  $reverse_complement_sequence =~ tr/ACGT/TGCA/;
+
+  ## return the reverse complement
+  ## code that calls this subroutine will be able to use this returned value
+  return $reverse_complement_sequence;
+
+}
+
+## we need to end our module with "1;"
+1;
diff --git a/lecture_scripts/problem_solutions/set_8/fasta_utilities_test.pl b/lecture_scripts/problem_solutions/set_8/fasta_utilities_test.pl
new file mode 100755
index 0000000..dc31857
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_8/fasta_utilities_test.pl
@@ -0,0 +1,75 @@
+#!/usr/bin/perl
+## fasta_utilities_test.pl
+
+## fasta sequence
+my $fasta = ">gi|170016048|ref|NM_001122723.1| Xenopus (Silurana) tropicalis microcephalin 1 (mcph1), mRNA
+CGGGTTCTGAAAGTAATGTGTGTGGAGTATGGAGTCTCCTGTAACAGCGTTGTCTTCTCTGTATGGACAT
+GTTCTTTCAGATGTTACTGCATATGTTGAGGTGTGGTCATCCAACAGAAGAGAAAATTATTCTAAAACAT
+TTTCACAACAGCTGGTTAATTTAGGTGCAAAGGTTTCGAAAACCTTTAATAAACACATTACTCATGTTGT
+TTTTAAAGATGGCCATCAAGGTACCTGGGACAAGGCTGTCAAGGCTGGTGTGAAACTGGTGTCTGTACTT
+TGGGTGGAAAGATGCAGAGAGGCTGCGGCACATGTAGATGAATCTGAATTTCCAGCAATCAATACAAATG
+ATGGATTGCCACAGATTGTTAAAAAGAAACACAAGTGTATGCAACCCAAGGATTTTGTTGAGAAAACACC
+AGAAAATGATAGACGAATGCAAAGAAAATTTGATAAAATGTCTAAAGAACTGAAAGTGCAAAAAGCTGGT
+GTAGATGATCCTGTTTTATTATTTGATCAATATGGAACATTAATGTACAGCCCAAAGGCTGTGGCTGCTG
+ATTGTTGCAATGCAATGGAAAAAAGAATTAAAGAAATGAAAAACAAGAGAGAGAATCTTTCTCCTACAGC
+CTCCCAAATTTCACAGACATTTGATTTTCCCCAACTTAAGCCATCACTTGGATATAGTCCTTCTGCCTTG
+GGGAGCTCTCCACTTGACAATGGCTGTGACGATCTTGACACTAGTTATGATGAGCTGTGGGGCAGTCTCG
+AAAAGAAACGGAACATTTCTAACTACTCAAAGAACAAAGTAACAAGTAAAAAATCAGTGATACGTGCAAC
+AGAACTAGAAGATCCAAATTGCCTTTTAACATCTGGCAAGTCATCTAATAATTTGACTCCTCAGCAGATT
+AAAGACAAATTACGGAGGAATAGTCATGCAGTCACGTCTTTTCAAAAGAAAAGCAGAAAGTCACTTGCAA
+GTAAAACAGTTGAGGAGCCAGTTCAATCCTTTATGAATTGTGGTACACAGAGTGCATTGGATTCCAATGT
+GGATTATGAAGCCCTGCCAAACAAACTTACTGTGTGCGAAGAAAATGAAAGTACTAAGAAAGTAAGATCA
+AATTGCCGGAAATCCAAAACTCCGACATCCAATCTGCACCTCTCAACTGAAAACATTGTGATGCCTGAGA
+TACCAAAACTTAGTGAATTAAGAAATGGCTCTGATTCAGAAGGAGCATGTTCTAGTTTTGAAGACTTTTT
+TTCAGCAGATATAAAAAGCCAGAAAAGACCATTTGCTAGATTTTCCTTAGGAACTCTGCCTCCAGAGTCA
+CCAACCTCACCTTTATTTATCAAAAACAAAAAGGGTTCATCTCGAAAAAGGAGGAGGTCAGTTCAAGATT
+TGGAAGAGTGTAATTCTAGTGGTAAAAGAAGAAGAAAGTCAATATGTAGTAAGGATAATCTGGTAAATTC
+AGAGTCCAAACATGATGCCAAGACAATGTCACCCGTGGCCGACTGTGTTGAAAGGAATCCTATAAAAACT
+AAAATAAATAAAACTGCTAAGTCTGATCAAGTAAACAATAAAGGAACTACATCAAGCAGTTTACTATCTT
+CTGAAACAAATTTAAATACAAAAGATACATTAGCAACATCTTCTGAATTAAATCAAAAGAAAGATATAGG
+TCTGGTAAAAGGTATGGAAAAAATAACTGAATTGACAACATGCAAAAAATCACCAAATCAGCCTGTGATG
+AAAAATGGTGCAGAGTCTGAAAAGCAAGAAGATGAGCCAAAAAGCTTTCAGAAATGTATGTGAACAATTA
+TCCATTATTAGCTGATCCATTATTAACTGATTTTTCTTTGTTGGTAATACAACTTTGTCTTATAGCTAAT
+AATAGTACTGTCCAATTTGGTTAGGTTTCTCATATGTCTGACAAAAAAAGGCAATTCACAGATTTTTTTC
+TTTTGCTGTGACCGACACGTTTACTGCATAACATTGTTTTGAATATTTTAAATTATGCAACCTTAGTTTT
+TTGTTTTTTTTTATTTAAAAATAAAATTGTTAGAATGGCAGGTGTCAATAAATGTGCTATTAGAAGGATG
+CTTTCAGATATACAAGTAATCTTGCATGATCTTGTGTCGAGACAAGCTAAAATATTGCAGTCTGAAATCT
+ATGATTCTTTCACTTAATTTTATATGCTGGTGGTTTTAACCTTAGCTTTCTGACATATTTTTTTTTTTTA
+TGGAAATTTTCATGTGTGGCCCAAGAATTTCATATTTTTTTGGGAATCTGTAAAAAAAAAATGGAGGGAT
+TCTAATGTACAATGCTTCATGCATAGTGGCGCTGTATTATTAGAATATACATACATTGCAAGATAGACTG
+ATCGGTGTTGTTTTATCTTGCCTTCTCTGGTCATGCTTTAGAATCAGGTAAAGATTTTGATTTTTTGCAT
+TGTCAAATAAAGCTGCTTGATAAGAAAAAAAAAAAAAAAAAAAAAAAAAA";
+
+## make FastaUtilities available to our program
+use FastaUtilities;
+
+## get the id
+my $id = get_id($fasta);
+
+## print id
+print "Id:\n";
+print "$id\n";
+print "\n";
+
+## get the description
+my $description = get_description($fasta);
+
+## print description
+print "Description:\n";
+print "$description\n";
+print "\n";
+
+## get the sequence
+my $sequence = get_sequence($fasta);
+
+## print sequence
+print "Sequence:\n";
+print "$sequence\n";
+print "\n";
+
+## reformat the sequence with 60 characters per line
+my $new_fasta = reformat_fasta($fasta, 60);
+
+## print new fasta
+print "New fasta:\n";
+print "$new_fasta\n";
diff --git a/lecture_scripts/problem_solutions/set_8/reverse_complement.pl b/lecture_scripts/problem_solutions/set_8/reverse_complement.pl
new file mode 100755
index 0000000..ba205a2
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_8/reverse_complement.pl
@@ -0,0 +1,18 @@
+#!/usr/bin/perl
+## reverse_complement.pl
+
+use strict;
+use warnings;
+
+## make SequenceUtilities module available to our program
+use SequenceUtilities;
+
+## get the sequence from the arguments to the program
+my $input_sequence = shift;
+
+## call the reverse_complement subroutine from the SequenceUtilities module
+## and assign the returned value from the subroutine to a new variable
+my $reverse_complement_input_sequence = reverse_complement($input_sequence);
+
+## print the reverse complement
+print "$reverse_complement_input_sequence\n";
diff --git a/lecture_scripts/problem_solutions/set_8/round.pl b/lecture_scripts/problem_solutions/set_8/round.pl
new file mode 100755
index 0000000..ea82ce3
--- /dev/null
+++ b/lecture_scripts/problem_solutions/set_8/round.pl
@@ -0,0 +1,17 @@
+#!/usr/bin/perl
+## round.pl
+
+use strict;
+use warnings;
+
+## we need to make the Math::Round module available to our script
+use Math::Round;
+
+## get a number argument from the command line
+my $number = shift;
+
+## call the round() subrotine to round the number
+my $rounded_number = round($number);
+
+## print the rounded number
+print "$rounded_number\n";