Skip to content
Permalink
Branch: master
Find file Copy path
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
61 lines (61 sloc) 4.2 KB
>FJ031219.1 Bos taurus isolate CH522 WC1 (WC1) mRNA, partial cds, alternatively spliced
GATGGTTACAGGTGGACATTGAAGGATGCATCTGTAGTGTGCAGACAGCTGGGGTGTGGAGCTGCCATTG
GTTTTCCTGGAGGGGCTTATTTTGGGCCAGGACTTGGCCCCATTTGGCTTTTGTATACTTCATGTGAAGG
GACAGAGTCAACTGTCAGTGACTGTGAGCATTCTAATATTAAAGACTATCGTAATGATGGCTATAATCAT
GGTCGGGATGCTGGAGTAGTCTGCTCAGGATTTGTGCGTCTGGCTGGAGGGGATGGACCCTGCTCAGGGC
GAGTAGAAGTGCATTCTGGAGAAGCTTGGATCCCAGTGTCTGATGGGAACTTCACACTTGCCACTGCCCA
GATCATCTGTGCAGAGTTGGGTTGTGGCAAGGCTGTGTCTGTCCTGGGACATGAGCTCTTCAGAGAGTCC
AGTGCCCAGGTCTGGGCTGAAGAGTTCAGGTGTGAGGGGGAGGAGCCTGAGCTCTGGGTCTGCCCCAGAG
TGCCCTGTCCAGGGGGCACGTGTCACCACAGTGGATCTGCTCAGGTTGTTTGTTCAGCATACTCGGAAGT
CCGGCTCATGACAAACGGCTCCTCTCAGTGTGAGGGGCAGGTGGAGATGAACATTTCTGGACAATGGAGA
GCGCTCTGTGCCTCCCACTGGAGTCTGGCCAATGCCAATGTTATCTGTCGTCAGCTCGGCTGTGGAGTTG
CCATCTCCACCCCCGGAGGACCACACTTGGTGGAAGAAGGTGATCAGATCCTAACAGCCCGATTTCACTG
CTCAGGGGCTGAGTCCTTCCTGTGGAGTTGTCCTGTGACTGTCCTGGGTGGTCCTGACTGTTCCCATGGC
AACACAGCCTCTGTGATCTGCTCAGGAAACCAGATCCAGGTGCTTCCCCAGTGCAACGACTCCGTGTCTC
AACCTACAGGCTCTGCGGCCTCAGAGGACGGCGCCCCCTACTGCTCAGACAGCAGGCAGCTCCGCCTGGT
GGACGGGGGCGGTCCCTGCGCCGGGAGAGTGGAGATCCTTGACCAGGGCTCCTGGGGCACCATCTGTGAT
GACGGCTGGGACCTGGACGATGCCCGCGTGGTGTGCAGGCAGCTGGGCTGTGGAGAAGCCCTCAATGCCA
CGGGGTCTGCTCACTTCGGGGCAGGATCAGGGCCCATCTGGTTGGACAACTTGAACTGCACAGGAAAGGA
GTCCCACGTGTGGAGGTGCCCTTCCCGGGGCTGGGGGCAGCACAACTGCAGACACAAGCAGGACGCGGGG
GTCATCTGCTCAGAGTTCCTGGCCCTCAGGATGGTGAGTGAGGACCAGCAGTGTGCTGGGTGGCTGGAAG
TTTTCTACAATGGGACCTGGGGCAGTGTCTGCCGTAACCCCATGGAAGACATCACTGTGTCCACGATCTG
CAGACAGCTTGGCTGTGGGGACAGTGGAACCCTCAACTCTTCTGTTGCTCTTAGAGAAGGTTTTAGGCCA
CAGTGGGTGGATAGAATCCAGTGTCGGAAAACTGACACCTCTCTCTGGCAGTGTCCTTCTGACCCTTGGA
ATTACAACTCATGCTCTCCAAAGGAGGAAGCCTATATCTGGTGTGCAGACAGCAGACAGATCCGCCTGGT
GGATGGAGGTGGTCGCTGCTCTGGGAGAGTGGAGATCCTTGACCAGGGCTCCTGGGGCACCATCTGTGAT
GACCGCTGGGACCTGGACGATGCCCGCGTGGTGTGCAAGCAGCTGGGCTGTGGAGAAGCCCTGGACGCCG
CTGTCTCTTCCTTCTTCGGGACGGGATCAGGGCCCATCTGGCTGGATGAAGTGAACTGCAGAGGAGAGGA
GTCCCAAGTATGGAGGTGCCCTTCCTGGGGATGGCGGCAACACAACTGCAATCATCAAGAAGATGCAGGA
GTCATCTGCTCAGGATTTGTGCGTCTGGCTGGAGGAGATGGACCCTGCTCAGGGCGAGTAGAAGTGCATT
CTGGAGAAGCCTGGACCCCAGTGTCTGATGGAAACTTCACACCCCCCACTGCCCAGGTCATCTGTGCAGA
GCTGGGATGTGGCAAGGCTGTGTCTGTCCTGGGACACATGCCATTCAGAGAGTCCGATGGCCAGGTCTGG
GCTGAAGAGTTCAGGTGTGATGGGGGGGAGCCTGAGCTCTGGTCCTGCCCCAGAGTGCCCTGTCCAGGAG
GCACGTGTCTCCACAGTGGAGCTGCTCAGGTTGTCTGTTCAGTGTACACAGAAGTCCAGCTTATGAAAAA
CGGCACCTCTCAATGTGAGGGGCAGGTGGAGATGAAGATTTCTGGACGATGGAGAGCGCTCTGTGCCTCC
CACTGGAGTCTGGCCAATGCCAATGTTGTCTGTCGTCAGCTCGGCTGTGGAGTCGCCATCTCCACCCCCA
GAGGACCACACTTGGTGGAAGGAGGTGATCAGATCTCAACAGCCCAATTTCACTGCTCAGGGGCTGAGTC
CTACCTGTGGAGTTGTCCTGTGACTGCCTTGGGTGGGCCTGACTGTTCCCATGGCAACACAGCCTCTGTG
ATCTGCTCAGGAAACCATACCCAGGTGCTGCCCCAGTGCAACGACTTCCTGTCTCAACCTGCAGGCTCTG
CGGCCTCAGAGGAGAGTTCTCCCTACTGCTCAGACAGCAGGCAGCTCCGCCTGGTGGACGGGGGCGGTCC
CTGCGCCGGGAGAGTGGAGATCCTTGACCAGGGCTCCTGGGGCACCATCTGTGATGACGGCTGGGACCTG
GACGATGCCCGCGTGGTGTGCAGGCAGCTGGGCTGTGGAGAAGCCCTCAATGCCACGGGGTCTGCTCACT
TCGGGGCAGGATCAGGGCCCATCTGGCTGGACGACCTGAACTGCACAGGAAAGGAGTCCCACGTGTGGAG
GTGCCCTTCCCGGGGCTGGGGGCGGCACGACTGCAGACACAAGGAGGACGCCGGGGTCATCTGCTCAGAG
TTCCTGGCCCTCAGGATGGTGAGCGAGGACCAGCAGTGTGCTGGGTGGCTGGAGGTTTTCTACAACGGGA
CCTGGGGCAGTGTCTGCCGCAGCCCCATGGAAGACATCACTGTGTCCGTGATCTGCAGACAGCTTGGATG
TGGGGACAGTGGAAGTCTCAACACCTCTGTTGGTCTCAGGGAAGGTTCTAGACCCCGGTGGGTAGATTTA
ATTCAGTGTCGGAAAATGGATACCTCTCTCTGGCAGTGTCCTTCTGGCCCATGGAAATACAGTTCATGCT
CTCCAAAGGAGGAAGCCTACATTTCATGTGAAGGAAGAAGACCCAAGAGCTGTCCAACTGCTGCCGCCTA
CACAGACAGAGAGAAGCTCCGCCTCAGGGGAGGAGACAGCGAGTGCTCAGGGCGGGTGGAGGTGTGGCAC
AACGGCTCCTGGGGCACCGTGTGCGATGACTCCTGGAGCCTGGCAGAGGCTGAGGTGGTGTGTCAGCAGC
TGGGCTGTGGCCAGGCCCTGGAAGCCGTGCGGTCTGCAGCATTTGGCCCTGGAAATGGGAGCATCTGGCT
GGACGAGGTGCAGTGCGGGGGCCGGGAGTCCTCCCTGTGGGACTGTGTTGCGGAGCCCTGGGGGCAGAGC
AACTGCAAGCACGAGGAGGATGCTGGTGTGAGGTGCTCTGGTGTAAGGACAACATTGCCCACGACCACAG
CAGGGACCAGAACAACCTCAAATTCTCTCCCTGGCATCTTCTCCCTGCCTGGGGTTCTCTGCCTTATCCT
GGGGTCGCTTCTCTTCCTGGTCCTCGTCATCCTGGTGACTCAGCTACTCAGATGGAGAGCAGAGCGCAGA
GCCTTATCCAGCTATGAAGATGCTCTTGCTGAAGCTGTGTATGAGGAGCTCGATTACCTTCTGACACAGA
AGGAAGGTCTGGGCAGCCCAGATCAGACGACTGAGGTCCCTGATGAAAATTACGATGATGCTGAAGAAGT
ACCAGTGCCTGGAACTCCTTCTCCCTCTCAGGGGAATGAGGAGGAAGTGCCCCCAGAGAAGGAGGACGGG
GTGAGGTCCTCTCAGACAGGCTCTTTCCTGAACTTCTCCAGAGAGGCAGCTAATCCTGGGGAAGGAGAAG
AGAGCTTCTGGCTGCTCCAGGGGAAGAAAGGGGATGCTGGGTATGATGATGTTGAACTCAGTGCCCTGGG
AACATCCCCAATGACTTTCTCATGA
You can’t perform that action at this time.