Block or report user

Report or block tseemann

Hide content and notifications from this user.

Contact Support about this user’s behavior.

Report abuse

Organizations

@Victorian-Bioinformatics-Consortium

Pinned repositories

  1. prokka

    ⚡️ ♒️ Rapid prokaryotic genome annotation

    Perl 186 90

  2. snippy

    ✂️ ⚡️ Rapid haploid variant calling and core genome alignment

    Perl 94 26

  3. shovill

    Faster SPAdes assembly of Illumina reads

    Perl 67 12

  4. abricate

    🔎 💊 Mass screening of contigs for antimicrobial and virulence genes

    Perl 60 14

  5. nullarbor

    💾 📃 "Reads to report" for public health and clinical microbiology

    Perl 54 15

  6. mlst

    🆔 Scan contig files against PubMLST typing schemes

    Perl 38 11

2,069 contributions in 2018

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Mon Wed Fri

Contribution activity

October 1, 2018

tseemann had no activity during this period.

September 2018

Created a pull request in brewsci/homebrew-bio that received 10 comments

indel-miner 0.2

Have you followed the guidelines for contributing? Have you checked that there aren't other open pull requests for the same formula update/change?

+26 −0 10 comments

Created an issue in tseemann/snippy that received 13 comments

Is 5 SNPS + 1 DEL better than 1 INS and 2 DEL

I really don't want to use GATK indel realigner. CP006053 1598997 . GGCGGCGGCGCGCGGGCTTTTCCA GCGCGGCGGCGCGGGCTTTTCCA 2065.7 wt G-GCGGCGGCGCGCGGGCT…

13 comments
4 repositories not shown

Seeing something unexpected? Take a look at the GitHub profile guide.