Trypanosome RNA Editing Alignment Tool
Switch branches/tags
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
analysis
cmd/treat
docs
examples
scripts
.gitignore
AUTHORS.rst
ChangeLog.rst
LICENSE
README.rst
align.go
align_test.go
const.go
fragment.go
fragment_test.go
glide.lock
glide.yaml
template.go
template_test.go

README.rst

Trypanosome RNA Editing Alignment Tool

docs/treat-logo-lg.png

What is TREAT?

TREAT is a multiple sequence alignment and visualization tool specifically designed to analyze variation in sequences caused by Uridine insertion/deletion RNA editing. This phenomenon occurs in trypanosomes, a group of unicellular parasitic flagellate protozoa such the subspecies of Trypanosoma brucei which are the causative agents of Human African Trypanosomiasis (HAT or African Sleeping Sickness). The pre-mRNA sequences in trypanosomes are posttranscriptionally edited by the insertion/deletion of uridylate residues. TREAT aligns sequences using three bases and assembles editing sites to detect the extent of editing of the fourth base, called the edit base. The edit base is configurable in TREAT and by default uses 'T'. TREAT is written in Go and is released under the GPLv3 free software license.

Installation

Download the latest binary release for your system here. Extract the zip file:

$ unzip treat-0.0.x.zip
$ cd treat-0.0.x
$ ./treat --help

Simple Alignment

TREAT can perform a global alignment between two arbitrary sequences detecting the amount of insertion/deletions (indels) of a single base (called the "edit base"). The default edit base in TREAT is "T". For example:

$ ./treat align -1 ATCTGTATGT -2 ATTCGATTG -b T
A-TCTGTA-TGT
ATTC-G-ATTG-

Alignment with Templates

TREAT can perform global alignments using template sequences. TREAT requires two user provided template sequences: fully edited and pre-edited. The fully edited template represents a mature edited mRNA transcript (completely precisely edited mRNA). The pre-edited template represents the sequence that will be edited in the mature RNA. TREAT accepts input sequences in FASTA format. For example:

# simple-templates.fa
>Fully Edited
CTTAATACACTTTTGATTAACAAACTTTAAA
>Pre-Edited
CTAATTACACTTTGATAACAAACTAAA

# simple-sequences.fa
>example-1
CTTAATTACACTTTGATTAACAAACTTTAAA

Save the above sequence files and run the alignment using TREAT. The example sequences can also be found in the ./examples directory:

$ ./treat align -t simple-templates.fa -f simple-sequences.fa
================================================================================
example-1
================================================================================
JSS: 12
ESS: 11
JES: 18
Junc Len: 7
================================================================================

FE: CTTAA-TACACTTTTGATTAACAAACTTTAAA
PE: C-TAATTACAC-TTTGA-TAACAAAC--TAAA
RD: CTTAATTACAC-TTTGATTAACAAACTTTAAA

TREAT computes the extent of canonical editing and reports various editing site characteristics as shown below:

docs/treat-alignment.png

Large Scale Alignment Analysis

TREAT can optionally store alignments into a database for more complex analysis, searching, and viewing in a web browser. TREAT has been tested on RNA-Seq data containing millions of sequences reads. Here's an example using sequences from ribosomal protein S12 (RPS12) from Trypanosoma brucei mitochondria.

TREAT accepts sequencing data in FASTA format. An example FASTA file (templates.fasta) containing the Fully Edited, Pre-Edited and one alternatively Edited template sequences is shown below:

>RPS12-FE Fully Edited
CTAATACACTTTTGATAACAAACTAAAGTAAAtAtAttttGttttttttGCGtAtGtGAT
TTTTGtAtGGttGttGtttACGttttGttttAtttGttttAtGttAttAtAtGAGtCCGC
GAttGCCCAGttCCGGtAACCGACGtGtAttGtAtGCCGtAttttAttTAtAtAAttttG
tttGGAtGttGCGttGttttttttGttGttttAttGGtttAGttAtGTCAttAtttAttA
tAGAGGGTGGtGGttttGttGAtttACCCGGtGTAAAGtAttAtACACGTAttGtAAGtt
AGATTTAGAtATAAGATATGTTTTT
>RPS12-PE Pre-Edited
CTAATACACTTTTGATAACAAACTAAAGTAAAAAGGCGAGGATTTTTTGAGTGGGACTGG
AGAGAAAGAGCCGTTCGAGCCCAGCCGGAACCGACGGAGAGCTTCTTTTGAATAAAAGGG
AGGCGGGGAGGAGAGTTTCAAAAAGATTTGGGTGGGGGGAACCCTTTGTTTTGGTTAAAG
AAACATCGTTTAGAAGAGATTTTAGAATAAGATATGTTTTT
>RPS12-A0 Alternative Editing (Cruz-Reyes 2013) alt_start=27 alt_stop=34
CTAATACACTTTTGATAACAAACTAAAGTAAAtAtAttttGttttttttGCGtAtGtGAT
TTTTGtAtGGttGttGtttACGttttGttttAtttGttttAtGttAttAtAtGAGtCCGC
GAttGCCCAGttCCGGtAACCGACGtGtAttGtAtGCCGtAttttAttTAtAtAAttttG
tttGGAtGttGCGttGttttttttGttGttttAttGGtttAGttAtGTCAttAtttAttA
tAGAGGGTGGtGGttttGttGAtttACCtCGttGGttTAtAtAGtAttAtACACGTAttG
tAAGttAGATTTAGAtATAAGATATGTTTTT

FASTA file with our DNA fragment reads (sample-1.fasta):

>1-10
CTAATACACTTTTGATAACAAACTAAAGATATAATATTTTTGTTTTTTTTGCGTATGTGA
TTTTTGTATGGTTGTTGTTTACGTTTTGTTTTATTTGTTTTATGTTATTATATGAGTCCG
CGATTGCCCAGTTCCGGTAACCGACGTGTATTGTATGCCGTATTTTATTTATATAATTTT
GTTTGGATGTTGCGTTGTTTTTTTTGTTGTTTTATTGGTTTAGTTATGTCATTATTTATT
ATAGAGGGTGGTGGTTTTGTTGATTTACCCGGTGTAAAGTATTATACACGTATTGTAAGT
TAGATTTAGATATAAGATATGTTTTT
>2-9
CTAATACACTTTTGATAACAAACTAAAGTAAAAAGGCGAGGATTTTTTGAGTGGGATTCGGT
ATTTGTTTTATGTTATTATATGAGTCCGCGATTGCCCAGCTCTGGTAACCGACGTGTATTGT
ATGCCGTATTTTATTTATATAATTTTGTTTGGATGTTGCGTTGTTTTTTTTGTTGTTTTATT
GGTTTAGTTATGTCATTATTTATTATAGAGGGTGGTGGTTTTGTTGATTTACCCGGTGTAAA
GTATTATACACGTATTGTAAGTTAGATTTAGATATAAGATATGTTTTT
>3-120
CTAATACACTTTTGATAACAAACTAAAGTAAAAAGGCGAGGATTTTTTGAGTGGGATTCGGTA
TTTGTTTTATGTTATTATATGAGTCCGCGATTGCCCAGCTCTGGTAACCGACGTGTATTGTAT
GCCGTATTTTATTTATATAATTTTGTTTGGATGTTGCGTTGTTTTTTTTGTTGTTTTATTGGT
TTAGTTATGTCATTATTTATTATAGAGGGTGGTGGTTTTGTTGATTTACCCGGTGTAAAGTAT
TATACACGTATTGTAAGTTAGATTTAGATATAACATATGTTTTT

Load the sample data using TREAT:

$ ./treat --db treat.db load --gene RPS12 \
    --fasta sample-1.fa \
    --template templates.fa \
    --offset 10 \
    --sample SampleName01 \
    --knock-down GAP1 \
    --tet \
    --replicate 1


INFO[0000] Using template Edit Stop Site: 9
INFO[0000] Using Edit Site numbering offset: 10
INFO[0000] Processing fragments for sample name: SampleName01
INFO[0000] Done. Loaded 15 fragment sequences for sample SampleName01

A new database file has been created called "treat.db".

Normalize the read counts to 100000 (or an appropriate n) using the following command. Note: If you don't provide an n treat will normalize to the average read count across all samples within the gene:

$ ./treat --db testerino.db norm -n 100000
INFO[0000] Processing gene RPS12...
INFO[0000] Normalizing to read count: 100000.0000
INFO[0000] Processing sample SampleName01 using normalized scaling factor: 9.3844

Search the data using the TREAT command line tool:

$ ./treat --db treat.db search -g RPS12 -l 10 --csv
gene,sample,norm,read_count,alt_editing,has_mutation,edit_stop,junc_end,junc_len,junc_seq
RPS12,sample-1,10.0000,10,0,0,137,143,6,ATATAATATTTTTG
RPS12,sample-1,9.0000,9,0,0,95,123,28,TTCGGTATTTGTTTTATGTTATTATATGAGTCCGCGATTGCCCAGCTCTG

Search options are described below:

$ ./treat help search
NAME:
   treat search - Search database

USAGE:
   treat search [command options] [arguments...]

OPTIONS:
   --gene, -g                                           Gene Name
   --sample, -s [--sample option --sample option]       One or more samples
   --edit-stop "-1"                                     Edit stop
   --junc-end "-1"                                      Junction end
   --junc-len "-1"                                      Junction len
   --alt "0"                                            Alt editing region
   --offset, -o "0"                                     offset
   --limit, -l "0"                                      limit
   --has-mutation                                       Has mutation
   --all, -a                                            Include all sequences
   --has-alt                                            Has Alternative Editing
   --csv                                                Output in csv format
   --fasta                                              Output in fasta format
   --no-header, -x                                      Exclude header from output

Start the TREAT server and view the sequences in a web browser:

$ ./treat --db treat.db server -p 8080
INFO[0000] Processing database: testerino.db
INFO[0000] Computing cache for gene RPS12...
INFO[0000] Max ESS: 21 Max JL: 12 Max JE: 21
INFO[0000] Using template dir: ./templates
INFO[0000] Running on http://127.0.0.1:8080

To view the TREAT web interface, point your web browser at http://localhost:8080. By default, treat will listen on port 8080.

docs/treat-screen-shot.png

Building from source

TREAT is written in go and uses glide for managing dependencies. To build from source first install go runtime and glide.

Clone the repository:

$ git clone https://github.com/ubccr/treat
$ cd treat

Resolve dependencies and build treat:

$ glide install
$ go test
$ cd cmd/treat
$ go build .

References

  • Rachel M. Simpson, Andrew E. Bruno, Jonathan E. Bard, Michael J. Buck and Laurie K. Read. High-throughput sequencing of partially edited trypanosome mRNAs reveals barriers to editing progression and evidence for alternative editing. RNA, 2016. http://dx.doi.org/10.1261/rna.055160.115

License

TREAT is released under the GPLv3 license. See the LICENSE file. TREAT logo designed by Nicole B. Laski.