Skip to content
Permalink
Browse files

1043-IGK.should-vdj.fa: New perspective

See https://gitlab.inria.fr/vidjil/vidjil/merge_requests/148#note_83304
for more information on this change.

IGKJ4*02 has more mutations but aligns on the whole length of the sequence.
  • Loading branch information...
mikael-s committed Jun 21, 2018
1 parent ba51fb4 commit ca1678a71d66916d0c7e06560c7ca6b1f7478233
Showing with 2 additions and 2 deletions.
  1. +1 −1 algo/tests/should-vdj-tests/1043-IGK.should-vdj.fa
  2. +1 −1 demo/Demo-X5.fa
@@ -1,2 +1,2 @@
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF}
>IGKV1-5*03 (9/4/1 IGKJ1*01, 9/7/4 IGKJ4*02) [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
@@ -27,7 +27,7 @@ TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
### IGK: VJ, V-KDE, Intron-KDE

# 1043-IGK
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF}
>IGKV1-5*03 (9/4/1 IGKJ1*01, 9/7/4 IGKJ4*02) [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT

# 0119-lil-IGK+-TRA+D-TRD+-TRG

0 comments on commit ca1678a

Please sign in to comment.
You can’t perform that action at this time.