Permalink
Browse files

Merge remote-tracking branch 'hiten/additions-to-test-suite'

* hiten/additions-to-test-suite:
  SimpleFeature.fromJSON restored
  improved test for mergeTranscripts
  edited resizeExon to test for translation start changes
  fixed resizeExon
  removed an extra data from SimpleFeature JSON structure
  added new test "sortAnnotationsByLocation"
  added new test "deleteExons"
  added new test "getCDNACoordinates"
  added new test "createTranscript"
  added new test "mergeExons"
  added new test "copyFeature"
  added new test "filterFeatures"
  added new tests "markNonCanonicalSpliceSites","markNonCanonicalTranslationStartSite" and "markNonCanonicalTranslationStopSite"
  added new test "setLongestORF"
  added new test "flipStrand"

Signed-off-by: Anurag Priyam <anurag.priyam@qmul.ac.uk>
  • Loading branch information...
2 parents 02a29c6 + b7dc1c4 commit 3013397e0c660b107886a6e9928a0bab0e71302e @yeban yeban committed Jul 5, 2017
@@ -0,0 +1,5 @@
+define([],
+ function() {
+ var str = "ATGGCCGATAACCGCGATCGCAATATTCGAAGAGGCACTTGCCGGATGTCAATTCCATCCAGCAGGATGCGTCCTTGGCTGATCTCGATTAATTGGAAGAGGGCCATCACGGTTGATGATTTTCCGCTACCGGTTCTTCCACAAATACCCAACTACGAATCATTGAATTACCTTTTGTCCAGCTGGTATTTTCAAAGACAAATCTGTGATCACCGGACTTCTATCTACATCGAAGCGCAGAGAGACATTCTCGAAAACGATCTCGCCCCTATTAGGCCAGTCATTGGCCACTTTACAATCGAAGTACTACGCGTCGATCTGATAAACGACGATGACAAAAGACGAAAGATTACCGCGAGACAGTAA";
+ return str;
+});
@@ -0,0 +1,40 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq_2
+ // which is located in file data/RefSeq_2.js
+ var feature = {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 18,
+ "start": 5,
+ "strand": 1,
+ "subfeatures": [
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 18,
+ "start": 5,
+ "strand": 1,
+ "type": "exon"
+ }
+ },
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 18,
+ "start": 5,
+ "strand": 1,
+ "type": "CDS"
+ }
+ }
+ ],
+ "type": "transcript"
+ },
+ "normalized": true,
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -0,0 +1,40 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq_2
+ // which is located in file data/RefSeq_2.js
+ var feature = {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 21,
+ "strand": 1,
+ "subfeatures": [
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 21,
+ "strand": 1,
+ "type": "exon"
+ }
+ },
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 21,
+ "strand": 1,
+ "type": "CDS"
+ }
+ }
+ ],
+ "type": "transcript"
+ },
+ "normalized": true,
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -0,0 +1,58 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq_2
+ // which is located in file data/RefSeq_2.js
+ var feature = {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 5,
+ "strand": 1,
+ "subfeatures": [
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 18,
+ "start": 5,
+ "strand": 1,
+ "type": "exon"
+ }
+ },
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 21,
+ "strand": 1,
+ "type": "exon"
+ }
+ },
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 18,
+ "start": 5,
+ "strand": 1,
+ "type": "CDS"
+ }
+ },
+ {
+ "data": {
+ "seq_id": "testRefSeq2",
+ "end": 33,
+ "start": 21,
+ "strand": 1,
+ "type": "CDS"
+ }
+ }
+ ],
+ "type": "transcript"
+ },
+ "normalized": true,
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -0,0 +1,46 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq
+ // which is located in file data/RefSeq.js
+ // This consist a non canonical stop site
+ var feature = {
+ "data": {
+ "type": "transcript",
+ "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "subfeatures": [
+ {
+ "data": {
+ "type": "exon",
+ "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1:exon1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 981763,
+ "end": 982146
+ },
+ "_uniqueID": "SimpleFeature_128"
+ },
+ {
+ "data": {
+ "type": "CDS",
+ "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1:CDS1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 981763,
+ "end": 981913
+ },
+ "_uniqueID": "SimpleFeature_129"
+ }
+ ],
+ "start": 981763,
+ "end": 982146
+ },
+ "_uniqueID": "SimpleFeature_127"
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -0,0 +1,46 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq
+ // which is located in file data/RefSeq.js
+ // This consist a both start/stop non canonical sites
+ var feature = {
+ "data": {
+ "type": "transcript",
+ "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "subfeatures": [
+ {
+ "data": {
+ "type": "exon",
+ "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1:exon1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 994150,
+ "end": 994370
+ },
+ "_uniqueID": "SimpleFeature_1054"
+ },
+ {
+ "data": {
+ "type": "CDS",
+ "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1:CDS1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 994150,
+ "end": 994370
+ },
+ "_uniqueID": "SimpleFeature_1055"
+ }
+ ],
+ "start": 994150,
+ "end": 994370
+ },
+ "_uniqueID": "SimpleFeature_1053"
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -0,0 +1,88 @@
+define([
+ 'JBrowse/Model/SimpleFeature'
+ ],
+function (SimpleFeature) {
+ // This transcript is corresponding to RefSeq
+ // which is located in file data/RefSeq.js
+ var feature = {
+ "data": {
+ "type": "transcript",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "subfeatures": [
+ {
+ "data": {
+ "type": "exon",
+ "name": "undefined:exon1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 18796,
+ "end": 18869
+ },
+ "_uniqueID": "SimpleFeature_72"
+ },
+ {
+ "data": {
+ "type": "exon",
+ "name": "undefined:exon2",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 19075,
+ "end": 19210
+ },
+ "_uniqueID": "SimpleFeature_73"
+ },
+ {
+ "data": {
+ "type": "exon",
+ "name": "undefined:exon3",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 19819,
+ "end": 19977
+ },
+ "_uniqueID": "SimpleFeature_74"
+ },
+ {
+ "data": {
+ "type": "CDS",
+ "name": "undefined:CDS1",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 18796,
+ "end": 18869
+ },
+ "_uniqueID": "SimpleFeature_75"
+ },
+ {
+ "data": {
+ "type": "CDS",
+ "name": "undefined:CDS2",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 19075,
+ "end": 19210
+ },
+ "_uniqueID": "SimpleFeature_76"
+ },
+ {
+ "data": {
+ "type": "CDS",
+ "name": "undefined:CDS3",
+ "seq_id": "Si_gnF.scaffold02797",
+ "strand": -1,
+ "start": 19819,
+ "end": 19977
+ },
+ "_uniqueID": "SimpleFeature_77"
+ }
+ ],
+ "start": 18796,
+ "end": 19977
+ },
+ "_uniqueID": "SimpleFeature_71"
+};
+
+var transcript = SimpleFeature.fromJSON(feature);
+return transcript;
+});
@@ -8,14 +8,21 @@ define([
'./input_7',
'./input_8',
'./input_9',
+ './input_10',
+ './input_11',
'./resize_1',
'./resize_2',
'./resize_3',
'./resize_4',
'./orf_1',
'./orf_2',
+ './orf_3',
+ './non_canonical_1',
+ './non_canonical_2',
'./cds_1',
+ './cds_2',
'./merge_1',
+ './merge_2',
'./normalize_1'
], function (
input_1,
@@ -27,23 +34,31 @@ define([
input_7,
input_8,
input_9,
+ input_10,
+ input_11,
resize_1,
resize_2,
resize_3,
resize_4,
orf_1,
orf_2,
+ orf_3,
+ non_canonical_1,
+ non_canonical_2,
cds_1,
+ cds_2,
merge_1,
+ merge_2,
normalize_1
) {
var transcript_data = {
"input": [input_1, input_2, input_3, input_4, input_5, input_6, input_7,
- input_8],
+ input_8, input_9, input_10, input_11],
"resize": [resize_1, resize_2, resize_3, resize_4],
- "orf": [orf_1, orf_2],
- "cds": [cds_1],
- "merge": [merge_1],
+ "orf": [orf_1, orf_2, orf_3],
+ "non_canonical": [non_canonical_1, non_canonical_2],
+ "cds": [cds_1, cds_2],
+ "merge": [merge_1, merge_2],
"normalize": [normalize_1]
};
Oops, something went wrong.

0 comments on commit 3013397

Please sign in to comment.