Permalink
Please sign in to comment.
Browse files
Merge remote-tracking branch 'hiten/additions-to-test-suite'
* hiten/additions-to-test-suite: SimpleFeature.fromJSON restored improved test for mergeTranscripts edited resizeExon to test for translation start changes fixed resizeExon removed an extra data from SimpleFeature JSON structure added new test "sortAnnotationsByLocation" added new test "deleteExons" added new test "getCDNACoordinates" added new test "createTranscript" added new test "mergeExons" added new test "copyFeature" added new test "filterFeatures" added new tests "markNonCanonicalSpliceSites","markNonCanonicalTranslationStartSite" and "markNonCanonicalTranslationStopSite" added new test "setLongestORF" added new test "flipStrand" Signed-off-by: Anurag Priyam <anurag.priyam@qmul.ac.uk>
- Loading branch information...
Showing
with
443 additions
and 18 deletions.
- +5 −0 tests/data/transcripts/cds_2.js
- +40 −0 tests/data/transcripts/input_10.js
- +40 −0 tests/data/transcripts/input_11.js
- +58 −0 tests/data/transcripts/merge_2.js
- +46 −0 tests/data/transcripts/non_canonical_1.js
- +46 −0 tests/data/transcripts/non_canonical_2.js
- +88 −0 tests/data/transcripts/orf_3.js
- +19 −4 tests/data/transcripts/transcript_data.js
- +80 −0 tests/js/EditTrack.spec.js
- +10 −6 www/JBrowse/Model/SimpleFeature.js
- +11 −8 www/JBrowse/View/Track/EditTrack.js
| @@ -0,0 +1,5 @@ | ||
| +define([], | ||
| + function() { | ||
| + var str = "ATGGCCGATAACCGCGATCGCAATATTCGAAGAGGCACTTGCCGGATGTCAATTCCATCCAGCAGGATGCGTCCTTGGCTGATCTCGATTAATTGGAAGAGGGCCATCACGGTTGATGATTTTCCGCTACCGGTTCTTCCACAAATACCCAACTACGAATCATTGAATTACCTTTTGTCCAGCTGGTATTTTCAAAGACAAATCTGTGATCACCGGACTTCTATCTACATCGAAGCGCAGAGAGACATTCTCGAAAACGATCTCGCCCCTATTAGGCCAGTCATTGGCCACTTTACAATCGAAGTACTACGCGTCGATCTGATAAACGACGATGACAAAAGACGAAAGATTACCGCGAGACAGTAA"; | ||
| + return str; | ||
| +}); |
| @@ -0,0 +1,40 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq_2 | ||
| + // which is located in file data/RefSeq_2.js | ||
| + var feature = { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 18, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 18, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "type": "exon" | ||
| + } | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 18, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "type": "CDS" | ||
| + } | ||
| + } | ||
| + ], | ||
| + "type": "transcript" | ||
| + }, | ||
| + "normalized": true, | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
| @@ -0,0 +1,40 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq_2 | ||
| + // which is located in file data/RefSeq_2.js | ||
| + var feature = { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 21, | ||
| + "strand": 1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 21, | ||
| + "strand": 1, | ||
| + "type": "exon" | ||
| + } | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 21, | ||
| + "strand": 1, | ||
| + "type": "CDS" | ||
| + } | ||
| + } | ||
| + ], | ||
| + "type": "transcript" | ||
| + }, | ||
| + "normalized": true, | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
| @@ -0,0 +1,58 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq_2 | ||
| + // which is located in file data/RefSeq_2.js | ||
| + var feature = { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 18, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "type": "exon" | ||
| + } | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 21, | ||
| + "strand": 1, | ||
| + "type": "exon" | ||
| + } | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 18, | ||
| + "start": 5, | ||
| + "strand": 1, | ||
| + "type": "CDS" | ||
| + } | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "seq_id": "testRefSeq2", | ||
| + "end": 33, | ||
| + "start": 21, | ||
| + "strand": 1, | ||
| + "type": "CDS" | ||
| + } | ||
| + } | ||
| + ], | ||
| + "type": "transcript" | ||
| + }, | ||
| + "normalized": true, | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
| @@ -0,0 +1,46 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq | ||
| + // which is located in file data/RefSeq.js | ||
| + // This consist a non canonical stop site | ||
| + var feature = { | ||
| + "data": { | ||
| + "type": "transcript", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "type": "exon", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1:exon1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 981763, | ||
| + "end": 982146 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_128" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "CDS", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-augustus-gene-9.30-mRNA-1:CDS1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 981763, | ||
| + "end": 981913 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_129" | ||
| + } | ||
| + ], | ||
| + "start": 981763, | ||
| + "end": 982146 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_127" | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
| @@ -0,0 +1,46 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq | ||
| + // which is located in file data/RefSeq.js | ||
| + // This consist a both start/stop non canonical sites | ||
| + var feature = { | ||
| + "data": { | ||
| + "type": "transcript", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "type": "exon", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1:exon1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 994150, | ||
| + "end": 994370 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_1054" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "CDS", | ||
| + "name": "maker-Si_gnF%2Escaffold02797-snap-gene-10.47-mRNA-1:CDS1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 994150, | ||
| + "end": 994370 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_1055" | ||
| + } | ||
| + ], | ||
| + "start": 994150, | ||
| + "end": 994370 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_1053" | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
| @@ -0,0 +1,88 @@ | ||
| +define([ | ||
| + 'JBrowse/Model/SimpleFeature' | ||
| + ], | ||
| +function (SimpleFeature) { | ||
| + // This transcript is corresponding to RefSeq | ||
| + // which is located in file data/RefSeq.js | ||
| + var feature = { | ||
| + "data": { | ||
| + "type": "transcript", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "subfeatures": [ | ||
| + { | ||
| + "data": { | ||
| + "type": "exon", | ||
| + "name": "undefined:exon1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 18796, | ||
| + "end": 18869 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_72" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "exon", | ||
| + "name": "undefined:exon2", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 19075, | ||
| + "end": 19210 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_73" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "exon", | ||
| + "name": "undefined:exon3", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 19819, | ||
| + "end": 19977 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_74" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "CDS", | ||
| + "name": "undefined:CDS1", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 18796, | ||
| + "end": 18869 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_75" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "CDS", | ||
| + "name": "undefined:CDS2", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 19075, | ||
| + "end": 19210 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_76" | ||
| + }, | ||
| + { | ||
| + "data": { | ||
| + "type": "CDS", | ||
| + "name": "undefined:CDS3", | ||
| + "seq_id": "Si_gnF.scaffold02797", | ||
| + "strand": -1, | ||
| + "start": 19819, | ||
| + "end": 19977 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_77" | ||
| + } | ||
| + ], | ||
| + "start": 18796, | ||
| + "end": 19977 | ||
| + }, | ||
| + "_uniqueID": "SimpleFeature_71" | ||
| +}; | ||
| + | ||
| +var transcript = SimpleFeature.fromJSON(feature); | ||
| +return transcript; | ||
| +}); |
Oops, something went wrong.
0 comments on commit
3013397