Permalink
Browse files

updated README

  • Loading branch information...
1 parent 80ce136 commit 929f948cdbc9fcb4f705917f619dd6fd2be0b672 @wwood committed Jun 26, 2012
Showing with 57 additions and 7 deletions.
  1. +57 −7 README.md
View
@@ -2,25 +2,75 @@
[![Build Status](https://secure.travis-ci.org/wwood/bioruby-ipcress.png)](http://travis-ci.org/wwood/bioruby-ipcress)
-Full description goes here
-
-Note: this software is under active development!
+bio-ipcress is a library for programmatically interacting with the In-silico PCR Experiment Simulation System (iPCRess),
+available as part of the [http://www.ebi.ac.uk/~guy/exonerate/](exonerate) package.
## Installation
```sh
- gem install bio-ipcress
+gem install bio-ipcress
```
+To run an ipcress, you must also have ipcress itself installed.
## Usage
```ruby
- require 'bio-ipcress'
+require 'bio-ipcress'
+
+primer_set = Bio::Ipcress::PrimerSet.new('GGTCACTGCTA','GGCTACCTTGTTACGACTTAAC')
+results = Bio::Ipcress.run(
+ primer_set,
+ 'test/data/Ipcress/Methanocella_conradii_16s.fa',
+ {:min_distance => 2, :max_distance => 10000}) # optional parameters
+ #=> a set of Bio::Ipcress::Result objects (in this case containing 1, since there is only 1 amplification product)
+
+results[0].product #=> "1422 bp (range 2-10000)"
+results[0].target #=> "gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence"
+```
+
+A full anatomy of a parsed iPCRess result:
+
+ assert_equal 'AE12_pmid21856836_16S', res.experiment_name
+ assert_equal 'A B', res.primers
+ assert_equal 'gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence',
+ res.target
+ assert_equal '19/20 14/15', res.matches
+ assert_equal '502 bp (range 2-10000)', res.product
+ assert_equal 'forward', res.result_type
+ assert_equal 'AAACTTAAAGGAATTGGCGG', res.forward_matching_sequence
+ assert_equal 'AAACTYAAAKGAATTGRCGG', res.forward_primer_sequence
+ assert_equal 'CRTGTGTGGCGGGCA', res.reverse_primer_sequence
+ assert_equal 'CGTGTGTGGCGGGCA', res.reverse_matching_sequence
+ assert_equal 502, res.length
+ assert_equal 826, res.start
+ assert_equal 1, res.forward_mismatches
+ assert_equal 1, res.reverse_mismatches
+
+```
+** Message: Loaded [1] experiments
+
+Ipcress result
+--------------
+ Experiment: AE12_pmid21856836_16S ## experiment_name
+ Primers: A B ## primers
+ Target: gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence ## target
+ Matches: 19/20 14/15 ## matches
+ Product: 502 bp (range 2-10000) ## product
+Result type: forward ## result_type
+
+...AAACTTAAAGGAATTGGCGG......................... # forward ## forward_matching_sequence ('AAACTTAAAGGAATTGGCGG')
+ ||||| ||| |||||| |||-->
+5'-AAACTYAAAKGAATTGRCGG-3' 3'-CRTGTGTGGCGGGCA-5' # primers ## forward_primer_sequence, reverse_primer_sequence
+ <--| |||||||||||||
+..............................CGTGTGTGGCGGGCA... # revcomp ## reverse_matching_sequence
+--
+ipcress: gi|335929284|gb|JN048683.1|:filter(unmasked) AE12_pmid21856836_16S 502 A 826 1 B 1313 1 forward ## length (502), start (826), forward_mismatches (1), reverse_mismatches (1)
+-- completed ipcress analysis
```
The API doc is online. For more code examples see the test files in
the source tree.
-
+
## Project home page
Information on the source tree, documentation, examples, issues and
@@ -32,7 +82,7 @@ The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
## Cite
-If you use this software, please cite one of
+bio-ipcress is currently unpublished. However, if you use this software, perhaps you would like to cite ipcress itself, as well as BioRuby and Biogem
* [BioRuby: bioinformatics software for the Ruby programming language](http://dx.doi.org/10.1093/bioinformatics/btq475)
* [Biogem: an effective tool-based approach for scaling up open source software development in bioinformatics](http://dx.doi.org/10.1093/bioinformatics/bts080)

0 comments on commit 929f948

Please sign in to comment.