Skip to content
Browse files

README fixups

  • Loading branch information...
1 parent 838f6b6 commit a71a6e613c7c15460b5809d7cf7190382e8ce657 @wwood committed Jun 27, 2012
Showing with 1 addition and 18 deletions.
  1. +1 −18 README.md
View
19 README.md
@@ -29,23 +29,6 @@ results[0].target #=> "gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella
```
A full anatomy of a parsed iPCRess result:
-
- assert_equal 'AE12_pmid21856836_16S', res.experiment_name
- assert_equal 'A B', res.primers
- assert_equal 'gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence',
- res.target
- assert_equal '19/20 14/15', res.matches
- assert_equal '502 bp (range 2-10000)', res.product
- assert_equal 'forward', res.result_type
- assert_equal 'AAACTTAAAGGAATTGGCGG', res.forward_matching_sequence
- assert_equal 'AAACTYAAAKGAATTGRCGG', res.forward_primer_sequence
- assert_equal 'CRTGTGTGGCGGGCA', res.reverse_primer_sequence
- assert_equal 'CGTGTGTGGCGGGCA', res.reverse_matching_sequence
- assert_equal 502, res.length
- assert_equal 826, res.start
- assert_equal 1, res.forward_mismatches
- assert_equal 1, res.reverse_mismatches
-
```
** Message: Loaded [1] experiments
@@ -89,7 +72,7 @@ bio-ipcress is currently unpublished. However, if you use this software, perhaps
## Biogems.info
-This Biogem is published at [#bio-ipcress](http://biogems.info/index.html)
+This Biogem is published at http://biogems.info/index.html#bio-ipcress
## Copyright

0 comments on commit a71a6e6

Please sign in to comment.
Something went wrong with that request. Please try again.