Skip to content
/ vidhop Public

VIDHOP is a virus host predicting tool. Its able to predict influenza A virus, rabies lyssavirus and rotavirus A.

Notifications You must be signed in to change notification settings

rnajena/vidhop

Folders and files

NameName
Last commit message
Last commit date

Latest commit

4c5e115 · Nov 17, 2021

History

50 Commits
Jun 4, 2021
Nov 17, 2021
Jul 14, 2020
Jul 14, 2020
Jul 13, 2020

Repository files navigation

VIDHOP

VIDHOP is a virus host predicting tool. Its able to predict influenza A virus, rabies lyssavirus and rotavirus A. Furthermore the user can train its own models for other viruses and use them with VIDHOP.

Install:

We recommend to use linux and miniconda for the enviroment management

  1. Download and install Conda.

  2. Create a Conda environment with a Python 3.7

    conda create -n vidhop python=3.7
  3. Activate the Conda environment. You will need to activate the Conda environment in each terminal in which you want to use VIDHOP.

    conda activate vidhop
  4. Install vidhop via conda

    conda install -c flomock -c anaconda vidhop=0.9

How to use:

VIDHOP has three different commands each with its own parameter set.

make_dataset: create the data structure needed for training

training: train a model on your training files generated with make_dataset

predict: predict the host of the viral sequence given

Use vidhop --help to see this summary of all three methods.

Likely you'll mainly use predict, see below various examples:

examples for vidhop predict:

vidhop predict -i /home/user/fasta/influenza.fna -v influ

present only hosts which reach a threshold of 0.2

vidhop predict -i /home/user/fasta/influenza.fna -v influ -t 0.2

if you want the output in a file

vidhop predict -i /home/user/fasta/influenza.fna -v influ -o /home/user/vidhop_result.txt

use multiple fasta-files in directory

vidhop predict -i /home/user/fasta/ -v rabies

use multiple fasta-files in directory and only present top 3 host predictions per sequence

vidhop predict -i /home/user/fasta/ -v rabies -n_hosts

Use your own trained models generated with vidhop training. You need to specify the path to the .model file you want to use. It's located in the output directory of vidhop training. You can choose between the model with the lowest loss and the model with the highest accuracy while training.

vidhop predict -v /home/user/out_training/model_best_acc_testname.model -i /home/user/fasta/my_favourite_virus.fna

Options:

command what it does
-i, --input either raw sequences or path to fasta file or directory with multiple files. [required]
-v, --virus select virus species (influ, rabies, rota) [required]
-o, --outpath path where to save the output
-n, --n_hosts show only -n most likely hosts
-t, --thresh show only hosts with higher likeliness then --thresh
--auto_filter automatically filters output to present most relevant host
--help show this message and exit.
--version show version number from vidhop

Example output and what it means:

per autofilter selected host of interest
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742

all hosts
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742
Cairina moschata: 0.14039446413516998
Anas acuta: 0.0806809589266777
Anas platyrhynchos: 0.0766301080584526
Anas clypeata: 0.06576793640851974
Anas rubripes: 0.01164703257381916
Mareca strepera: 0.009029239416122437
Gallus gallus: 0.005793101154267788
Anas discors: 0.0032478864304721355
Tadorna ferruginea: 0.0021137858275324106
Struthio camelus: 0.0017334294971078634
Chroicocephalus ridibundus: 0.001212031696923077
Anas carolinensis: 0.0011747170938178897
Cygnus columbianus: 0.0009851191425696015

The output is a list of potential hosts sorted by probability. For example an value of 0.368 represents a likelihood of 36.8% that this is the correct host, according to VIDHOP. The autofilter selects hosts the most promissing candidates.

Train and use your own model:

If you like to skip ahead see toy-example.

Train your own model for other viruses than the provided ones (influenza A virus, rabies lyssavirus and rotavirus A) is simple. The workflow consists of three steps:

  1. vidhop make_dataset

  2. vidhop training

  3. vidhop predict

vidhop make_dataset

To generate the data sets needed for training you need to provide two input files.

  1. A sequence file containing in each line a DNA sequence.

  2. A host file containing the name of the host corresponding to the DNA sequence at identical line number in the sequence file.

example input

sequences.txt hosts.txt
AAATTT human
CGTATA swine
CGTATT swine

examples for vidhop make_dataset:

Example: set input and output parameter

vidhop make_dataset -x /home/user/input/seq.txt -y /home/user/input/host.txt -o /home/user/trainingdata/

change the validation set size and provide datastructure for repeated undersampling

vidhop make_dataset -x /home/user/input/seq.txt -y /home/user/input/host.txt -v 0.1 -r
command what it does
-x, --sequences Path to the file containing sequence list [required].
-y, --hosts Path to the file containing corresponding host list [required].
-o, --outpath Path where to save the output.
-n, --n_hosts Show only -n most likely hosts.
-v, --val_split_size Select the portion of the data which is used for the validation set.
-t, --test_split_size Select the portion of the data which is used for the test set.
-r, --repeated_undersampling Generate training files needed for reapeted undersampling while training.
--help Show this message and exit.

vidhop training

The training of a model is done by providing the output directory of vidhop make_dataset as the input of vidhop training. The user can specify various parameter which change the architecture, training duration, input handling and further more. For further details to different parameters like --extention_variant or --repeated_undersampling see the paper, virus host prediction with deep learning.

examples for vidhop training:

set input output and name of the model

vidhop training -i /home/user/trainingdata/ -o /home/user/model/ --name test

use the LSTM archtecture and the extention variant random repeat

vidhop training -i /home/user/trainingdata/ --architecture 0 --extention_variant 2

use repeated undersampling for training, note that for this the dataset must have been created with repeated undersampling enabled

vidhop training -i /home/user/trainingdata/ -r

train the model for 40 epochs, stop training if for 2 epochs the accuracy did not increase

vidhop train_new_model -i /home/user/trainingdata/ --epochs 40 --early_stopping
command what it does
-i, --inpath Path to the dir with training files, generated with make_dataset [required].
-o, --outpath Path where to save the output.
-n, --name Suffix added to output file names.
-e, --epochs Maximum number of epochs used for training the model.
-a, --architecture Select architecture (0:LSTM, 1:CNN+LSTM).
-v, --extention_variant Select extension variant (0:Normal repeat, 1:Normal repeat with gaps, 2:Random repeat, 3:Random repeat with gaps, 4:Append gaps, 5:Smallest, 6:Online).
-s, --early_stopping Stop training when model accuracy did not improve over time, patience 5% of max epochs.
-r, --repeated_undersampling Use repeated undersampling while training, to be usable the training files must be generated with make_datasets and activated reapeted undersampling parameter.
--help Show this message and exit.

toy-example

Download the test files X.txt (containing all sequences) und Y.txt (containing all corresponding hosts).

wget https://github.com/flomock/vidhop/blob/master/X.txt
wget https://github.com/flomock/vidhop/blob/master/Y.txt

Now we prepare the dataset. As an example we define the size of the validation-set to 10% and the test-set to 20% of the full dataset. Note that the all data sets will be balanced according to their host classes. To use all samples, even from an unbalanced dataset, without biasing towards the most common host class, use the --repeated_undersampling parameter. This effects the samples used while training. The validation and test sets will be unchanged.

vidhop make_dataset -x X.txt -y Y.txt -r -o ./make_dataset_out -v 0.1 -t 0.2

If a host in your dataset is bellow the recommended minimal count of 100 samples, vidhop make_dataset will return a warning. The expected console output:

warning number samples for host Artibeus lituratus low, only 90 samples
warning number samples for host Lasiurus borealis low, only 96 samples
warning number samples for host Cerdocyon thous low, only 82 samples

Now we train a model using the standard parameter. As input we provide the output directory of vidhop make_dataset. Furthermore we name our model "test_standard". To limit training time we use -e to limit the number of epochs to two.

vidhop training -i ./make_dataset_out -n test_standard -e 2 -o ./trained_models

The output printed to the console provides information about the input provided, the current architecture used, the current status of the training. When the actual training is completed two models are saved. One model which represents the model with the lowest loss during training and one model with the highest accuracy during training, both calculated on the validation set. After training and saving these models each model is tested on the test dataset. The results are printed in the console.

Now we are able to predict the host of new sequences. For this we use vidhop predict. You can provide either a fasta file for prediction or a DNA sequence directly. Here we use an DNA sequence. Furthermore we define a the virus to use the path to one of our trained models, either the one with the lowest loss or the one with the highest accuracy while training. If you are not sure which of the both models to use, we experienced the best results working with the model with the highest accuracy.

vidhop predict -v ./trained_models/model_best_acc_test_standard.model -o ./predictions/first_test.txt -i AAATGCTCTGAATTCGACATGAAAAAAACAAGCAACACCACTGATAAGATGAACTTTCTACGCAAGAAATGCTCTGAATTCGACATGAAAAAAACAAGCAACACCACTGATAAGATGAACTTTCTACGCAAG

This results in a prediction similar to:

>user command line input
all hosts
Lasiurus borealis: 0.061880290508270264
Procyon lotor: 0.06131688505411148
Desmodus rotundus: 0.06110725179314613
Mephitis mephitis: 0.060785286128520966
Vulpes vulpes: 0.060404110699892044
Capra hircus: 0.06007476523518562
Vulpes lagopus: 0.059015918523073196
Artibeus lituratus: 0.0590040422976017
Tadarida brasiliensis: 0.05887320265173912
Nyctereutes procyonoides: 0.0584951676428318
Eptesicus fuscus: 0.05815460532903671
Felis catus: 0.05793345347046852
Equus caballus: 0.0575258694589138
Homo sapiens: 0.05704779922962189
Bos taurus: 0.05660048499703407
Canis lupus: 0.056392643600702286
Cerdocyon thous: 0.05538821220397949

(note that the input sequence is more or less random, so don't expect a very meaningful prediction)

Thanks for using VIDHOP.



Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

About

VIDHOP is a virus host predicting tool. Its able to predict influenza A virus, rabies lyssavirus and rotavirus A.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published

Languages