cutting by restriction enzymes with asymmetric target

[mzaki-jp]

Bio::RestrictionEnzyme.cut detects restriction sites only on the sense strand for an enzyme with asymmetric target (e.g. BsmAI, MboII, etc.).

For example, MboII recognizes and cuts GAAGA (8/7) cf. REBASE.

> seq = Bio::Sequence::NA.new('aGAAGAttaggattgatgat')
> Bio::RestrictionEnzyme.cut(seq, 'MboII').primary rescue [seq]
=> ["agaagattaggatt", "gatgat"]
> seq = seq.reverse_complement
> Bio::RestrictionEnzyme.cut(seq, 'MboII').primary rescue [seq]
=> ["atcatcaatcctaatcttct"]

I think it should detect the sites on both strands, per semantics in bioinformatics.

[mzaki-jp]

A quick hack to Bio::RestrictionEnzyme::Analysis#create_enzyme_actions resolved my problem.
The patch is attached, but please note that I don't know whether this is OK for general users.

[ngoto]

Thank you very much.
I think the behavior of Bio::RestrictionEnzyme refers that of other programs/libraries such as tacg, EMBOSS, and BioPerl. I'd like to check them before merging the patch.