Default trimming adapter sequences don't match documentation

[kubu4]

Adapter trimming documentation shows much longer adapter sequences than what the is shown when running the pipeline.

Adapter Trimming
By default the pipeline will assume that pre-trimmed reads have been given to the --input parameter, and will therefore skip the trimming process unless specified. Trimmimg will be performed with cutadapt which takes into consideration a number of additional parameters:

--trim

Specify to enable trimming. [default: off]

--forward

The forward adapter sequence. [default: AGATCGGAAGAGCACACGTCTGAAC]

--reverse

The reverse adapter sequence. [default: AGATCGGAAGAGCGTCGTGTAGGGA]

Pipeline defaults show as this: