Skip to content

Latest commit

 

History

History
152 lines (122 loc) · 5.88 KB

README.md

File metadata and controls

152 lines (122 loc) · 5.88 KB

Novel_virus_analyse

The complete genome of Vo narna-like virus and raw data used for this analysis can be downloaded from NCBI(PRJNA1053647), and the intermediate files can be found on Zonodo.

DOI

Technical route

image

Step1 We assembled the chloroplast genome using GetOrganelle version (1.7.7.0)

#Maximum number of reads to be used per file
--max-reads inf
#Soft bound for maximum number of reads to be used according to target-hitting base coverage
--reduce-reads-for-coverage inf 
get_organelle_from_reads.py -1 JPSH_1.fq.gz -2 JPSH_2.fq.gz -t 96 -o JPSH.plastome.deep -F embplant_pt -R 15 --max-reads inf --reduce-reads-for-coverage inf

Step2 To remove adapter sequences and low-quality reads, use Trimmomatic version (0.39)

trimmomatic PE ./JPSH_1.fq.gz  ./JPSH_2.fq.gz  -phred33 out_read1.fq read1_unpaired.fq  out_read2.fq read2_unpaired.fq ILLUMINACLIP:./TruSeq3-PE.fa:2:30:10:8:TRUE  LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 -threads 20

Step3

Assembled the reads using Trinity version (2.15.110) with default parameters using Singularity version (3.10.0)

singularity exec -e trinityrnaseq.v2.15.1.simg Trinity --seqType fq --left out_read1.fq --right out_read2.fq --output trinity.JPSH.Trinity.fasta --max_memory 100G --CPU 40

Step4_BLASTX

Performing BLASTX alignment using DIAMOND version (2.1.6) and set --max-targer-seqs 1 and --evalue 1e-20. The database is NCBI NR database (last accessed on 22 JUN 2023)

diamond blastx --db ./nr.dmnd -q trinity.JPSH.Trinity.fasta -o trinity.nr.JPSH --evalue 1e-20  --threads 96 --outfmt 6 qseqid qlen sseqid pident slen qcovhsp scovhsp evalue bitscore sscinames sskingdoms staxids stitle --max-target-seqs 1

Set a threshold to filter for novel viruses: pident <= 80%, scovhsp >=75

grep  'Viruses' trinity.nr.JPSH | awk '$4<=80 && $7>=75' | sort -k4nr > trinity.nr.JPSH.filter

Step5 bowite2_metatrans

Reads were mapped back to the viral genomes using Bowtie2 version (2.2.5 12) and SAMtools version (1.6)

bowtie2-build  ./virus_merge.fasta ./index/JPSH_trans
bowtie2 -p 40  -x ./index/JPSH_trans -q -1 JPSH_1.fq.gz -2 JPSH_2.fq.gz -S JPSH.sam
samtools view -bS -h JPSH.sam -o JPSH.bam -@ 20
samtools sort JPSH.bam -o JPSH.sort.bam -@ 20
samtools index JPSH.sort.bam
samtools depth -d 300000 JPSH.sort.bam > JPSH.sort.depth

Step6 bowtie_siRNA

Cutadapt version (4.4 15) played a role in the removal of adapter sequences and low-quality reads from raw data The sequence "GTTCAGAGTTCTACAGTCCGACGATC" is the 5' end adapter sequence.

 cutadapt -a GTTCAGAGTTCTACAGTCCGACGATC JPSH.clean.fa.gz > JPSH.fq.cutadapt.gz

Alignment of resulting sequences to the viral genome was performed using Bowtie version (1.3.1)

bowtie-build  ./virus_merge.fasta ./index/JPSH_siRNA
bowtie -p 40 -n 1 -l 10 -m 100 -k 1 --best --strata  -x ./index/JPSH_siRNA -q JPSH.fq.cutadapt.gz -S JPSH_siRNA.sam
samtools view -bS -h JPSH_siRNA.sam -o JPSH_siRNA.bam -@ 20
samtools sort JPSH_siRNA.bam -o JPSH_siRNA.sort.bam -@ 20
samtools index JPSH_siRNA.sort.bam
samtools depth -d 300000 JPSH_siRNA.sort.bam > JPSH_siRNA.sort.depth

Step7 phylogenetic

The phylogenetic analysis hinged on the amino acid sequences of the predicted RNA-dependent RNA polymerase (RdRP) region and the Coat peotein

Code examples for virus5:

mafft --auto virus5_rdrp.fasta > virus5_rdrp.mafft.fasta
trimal -in virus5_rdrp.mafft.fasta -out virus5_rdrp.mafft.trimal.fasta -automated1
iqtree -s virus5_rdrp.mafft.trimal.fasta -T auto -m MFP -b 1000 -redo

Python script usage:

bam_flag.py To obtain the forward and reverse depth for each virus sequence.

bam_file=the path of JPSH_siRNA.sort.bam
output_dir=the path of output files
reference_names=The names of potentially novel virus sequences

Result file of bam_flag.py:

forward_output_file = f"{output_dir}{reference_name}_forward.bam[TRINITY_DN787_c0_g1_i1.txt](https://github.com/Gyoungwe/novel_virus_analyse/files/12568205/TRINITY_DN787_c0_g1_i1.txt)

reverse_output_file = f"{output_dir}{reference_name}_reverse.bam

sRNA_analyse.py In order to obtain the distribution of siRNAs from 18nt to 30nt for each virus sequence, as well as the 5' end nucleotide preference.

bam_file=the path of JPSH_siRNA.sort.bam
output_dir=the path of output files
reference_names=The names of potentially novel virus sequences

Result of sRNA_analyse.py: Counts of siRNA

#the siRNA counts of TRINITY_DN787_c0_g1_i1:
18	95	169 sRNA
19	296	396 sRNA
20	982	893 sRNA
21	9956	8310 sRNA
22	8824	5076 sRNA
23	935	663 sRNA
24	517	239 sRNA
25	284	93 sRNA
26	229	40 sRNA
27	235	53 sRNA
28	210	22 sRNA
29	190	29 sRNA
30	178	10 sRNA
#The first column represents the length of siRNA, the second column represents the counts of forward siRNAs, and the third column represents the counts of reverse siRNAs.

5' end base counts of siRNA

#The results require manually changing the thymine (T) bases to uracil (U) bases.
A	3242	5096
G	678	7454
C	8203	355
U	10808	3088

R_script usage :

base_counts.R" and "sRNA_peak.R" only require you to set the working directory to the location where the output files of "sRNA_analyse.py" are located, and set "file_names" to the prefix of the files for them to function properly

setwd("where/the/output/files/of/'sRNA_analyse.py'")

Example:

file_names <- c("TRINITY_DN787_c0_g1_i1", "TRINITY_DN5_c0_g1_i1","TRINITY_DN66897_c0_g1_i1","virus5","TRINITY_DN773_c0_g2_i1","TRINITY_DN773_c0_g1_i1")

gene_structure.R

Manually input the predicted loci, along with the depth file generated using SAMtools, as inputs

sRNA_depth.R

Calculate the forward and reverse depth for each sequence using SAMools depth, and use it as an input file