EnglishTestData.xml

<?xml version="1.0" encoding="utf-8"?>
<tests>
  <test>
    <input>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc (“Company A”), and PragmaticSegmenterExampleCompanyB Inc (“Company B”)</input>
    <expected>
      <sentence>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc (“Company A”), and PragmaticSegmenterExampleCompanyB Inc (“Company B”)</sentence>
    </expected>
  </test>
  <test>
    <input>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc., a fake corporation (“Company A”), and PragmaticSegmenterExampleCompanyB Inc., a fake corporation (“Company B”).</input>
    <expected>
      <sentence>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc., a fake corporation (“Company A”), and PragmaticSegmenterExampleCompanyB Inc., a fake corporation (“Company B”).</sentence>
    </expected>
  </test>
  <test>
    <input>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc. a fake corporation (“Company A”), and PragmaticSegmenterExampleCompanyB Inc. a fake corporation (“Company B”).</input>
    <expected>
      <sentence>The parties to this Agreement are PragmaticSegmenterExampleCompanyA Inc. a fake corporation (“Company A”), and PragmaticSegmenterExampleCompanyB Inc. a fake corporation (“Company B”).</sentence>
    </expected>
  </test>
  <test>
    <input>The details from Pragmatic Segmenter Inc. (PS or "Pragmatic") (PSX) are as follows, one, two and three. Furthermore there are some other details.</input>
    <expected>
      <sentence>The details from Pragmatic Segmenter Inc. (PS or "Pragmatic") (PSX) are as follows, one, two and three.</sentence>
      <sentence>Furthermore there are some other details.</sentence>
    </expected>
  </test>
  <test>
    <input>
      <![CDATA[
      DOWN THE RABBIT-HOLE

        Alice was beginning to get very tired of sitting by her sister on the bank, and of having nothing to do. Once or twice she had peeped into the book her sister was reading, but it had no pictures or conversations in it, "and what is the use of a book," thought Alice, "without pictures or conversations?"

        So she was considering in her own mind (as well as she could, for the day made her feel very sleepy and stupid), whether the pleasure of making a daisy-chain would be worth the trouble of getting up and picking the daisies, when suddenly a White Rabbit with pink eyes ran close by her.

        There was nothing so very remarkable in that, nor did Alice think it so very much out of the way to hear the Rabbit say to itself, "Oh dear! Oh dear! I shall be too late!" But when the Rabbit actually took a watch out of its waistcoat-pocket and looked at it and then hurried on, Alice started to her feet, for it flashed across her mind that she had never before seen a rabbit with either a waistcoat-pocket, or a watch to take out of it, and, burning with curiosity, she ran across the field after it and was just in time to see it pop down a large rabbit-hole, under the hedge. In another moment, down went Alice after it!

        The rabbit-hole went straight on like a tunnel for some way and then dipped suddenly down, so suddenly that Alice had not a moment to think about stopping herself before she found herself falling down what seemed to be a very deep well.

        Either the well was very deep, or she fell very slowly, for she had plenty of time, as she went down, to look about her. First, she tried to make out what she was coming to, but it was too dark to see anything; then she looked at the sides of the well and noticed that they were filled with cupboards and book-shelves; here and there she saw maps and pictures hung upon pegs. She took down a jar from one of the shelves as she passed. It was labeled "ORANGE MARMALADE," but, to her great disappointment, it was empty; she did not like to drop the jar, so managed to put it into one of the cupboards as she fell past it.

        Down, down, down! Would the fall never come to an end? There was nothing else to do, so Alice soon began talking to herself. "Dinah'll miss me very much to-night, I should think!" (Dinah was the cat.) "I hope they'll remember her saucer of milk at tea-time. Dinah, my dear, I wish you were down here with me!" Alice felt that she was dozing off, when suddenly, thump! thump! down she came upon a heap of sticks and dry leaves, and the fall was over.

        Alice was not a bit hurt, and she jumped up in a moment. She looked up, but it was all dark overhead; before her was another long passage and the White Rabbit was still in sight, hurrying down it. There was not a moment to be lost. Away went Alice like the wind and was just in time to hear it say, as it turned a corner, "Oh, my ears and whiskers, how late it's getting!" She was close behind it when she turned the corner, but the Rabbit was no longer to be seen.

        She found herself in a long, low hall, which was lit up by a row of lamps hanging from the roof. There were doors all 'round the hall, but they were all locked; and when Alice had been all the way down one side and up the other, trying every door, she walked sadly down the middle, wondering how she was ever to get out again.

        Suddenly she came upon a little table, all made of solid glass. There was nothing on it but a tiny golden key, and Alice's first idea was that this might belong to one of the doors of the hall; but, alas! either the locks were too large, or the key was too small, but, at any rate, it would not open any of them. However, on the second time 'round, she came upon a low curtain she had not noticed before, and behind it was a little door about fifteen inches high. She tried the little golden key in the lock, and to her great delight, it fitted!

        Alice opened the door and found that it led into a small passage, not much larger than a rat-hole; she knelt down and looked along the passage into the loveliest garden you ever saw. How she longed to get out of that dark hall and wander about among those beds of bright flowers and those cool fountains, but she could not even get her head through the doorway. "Oh," said Alice, "how I wish I could shut up like a telescope! I think I could, if I only knew how to begin."

        Alice went back to the table, half hoping she might find another key on it, or at any rate, a book of rules for shutting people up like telescopes. This time she found a little bottle on it ("which certainly was not here before," said Alice), and tied 'round the neck of the bottle was a paper label, with the words "DRINK ME" beautifully printed on it in large letters.

        "No, I'll look first," she said, "and see whether it's marked '_poison_' or not," for she had never forgotten that, if you drink from a bottle marked "poison," it is almost certain to disagree with you, sooner or later. However, this bottle was _not_ marked "poison," so Alice ventured to taste it, and, finding it very nice (it had a sort of mixed flavor of cherry-tart, custard, pineapple, roast turkey, toffy and hot buttered toast), she very soon finished it off.

               *       *       *       *       *

        "What a curious feeling!" said Alice. "I must be shutting up like a telescope!"

        And so it was indeed! She was now only ten inches high, and her face brightened up at the thought that she was now the right size for going through the little door into that lovely garden.

        After awhile, finding that nothing more happened, she decided on going into the garden at once; but, alas for poor Alice! When she got to the door, she found she had forgotten the little golden key, and when she went back to the table for it, she found she could not possibly reach it: she could see it quite plainly through the glass and she tried her best to climb up one of the legs of the table, but it was too slippery, and when she had tired herself out with trying, the poor little thing sat down and cried.

        "Come, there's no use in crying like that!" said Alice to herself rather sharply. "I advise you to leave off this minute!" She generally gave herself very good advice (though she very seldom followed it), and sometimes she scolded herself so severely as to bring tears into her eyes.

        Soon her eye fell on a little glass box that was lying under the table: she opened it and found in it a very small cake, on which the words "EAT ME" were beautifully marked in currants. "Well, I'll eat it," said Alice, "and if it makes me grow larger, I can reach the key; and if it makes me grow smaller, I can creep under the door: so either way I'll get into the garden, and I don't care which happens!"

        She ate a little bit and said anxiously to herself, "Which way? Which way?" holding her hand on the top of her head to feel which way she was growing; and she was quite surprised to find that she remained the same size. So she set to work and very soon finished off the cake.

        II--THE POOL OF TEARS

        "Curiouser and curiouser!" cried Alice (she was so much surprised that for the moment she quite forgot how to speak good English). "Now I'm opening out like the largest telescope that ever was! Good-by, feet! Oh, my poor little feet, I wonder who will put on your shoes and stockings for you now, dears? I shall be a great deal too far off to trouble myself about you."

        Just at this moment her head struck against the roof of the hall; in fact, she was now rather more than nine feet high, and she at once took up the little golden key and hurried off to the garden door.

        Poor Alice! It was as much as she could do, lying down on one side, to look through into the garden with one eye; but to get through was more hopeless than ever. She sat down and began to cry again.

        She went on shedding gallons of tears, until there was a large pool all 'round her and reaching half down the hall.

        After a time, she heard a little pattering of feet in the distance and she hastily dried her eyes to see what was coming. It was the White Rabbit returning, splendidly dressed, with a pair of white kid-gloves in one hand and a large fan in the other. He came trotting along in a great hurry, muttering to himself, "Oh! the Duchess, the Duchess! Oh! _won't_ she be savage if I've kept her waiting!"

        When the Rabbit came near her, Alice began, in a low, timid voice, "If you please, sir--" The Rabbit started violently, dropped the white kid-gloves and the fan and skurried away into the darkness as hard as he could go.

        Alice took up the fan and gloves and she kept fanning herself all the time she went on talking. "Dear, dear! How queer everything is to-day! And yesterday things went on just as usual. _Was_ I the same when I got up this morning? But if I'm not the same, the next question is, 'Who in the world am I?' Ah, _that's_ the great puzzle!"

        As she said this, she looked down at her hands and was surprised to see that she had put on one of the Rabbit's little white kid-gloves while she was talking. "How _can_ I have done that?" she thought. "I must be growing small again." She got up and went to the table to measure herself by it and found that she was now about two feet high and was going on shrinking rapidly. She soon found out that the cause of this was the fan she was holding and she dropped it hastily, just in time to save herself from shrinking away altogether.

        "That _was_ a narrow escape!" said Alice, a good deal frightened at the sudden change, but very glad to find herself still in existence. "And now for the garden!" And she ran with all speed back to the little door; but, alas! the little door was shut again and the little golden key was lying on the glass table as before. "Things are worse than ever," thought the poor child, "for I never was so small as this before, never!"

        As she said these words, her foot slipped, and in another moment, splash! she was up to her chin in salt-water. Her first idea was that she had somehow fallen into the sea. However, she soon made out that she was in the pool of tears which she had wept when she was nine feet high.

        Just then she heard something splashing about in the pool a little way off, and she swam nearer to see what it was: she soon made out that it was only a mouse that had slipped in like herself.

        "Would it be of any use, now," thought Alice, "to speak to this mouse? Everything is so out-of-the-way down here that I should think very likely it can talk; at any rate, there's no harm in trying." So she began, "O Mouse, do you know the way out of this pool? I am very tired of swimming about here, O Mouse!" The Mouse looked at her rather inquisitively and seemed to her to wink with one of its little eyes, but it said nothing.

        "Perhaps it doesn't understand English," thought Alice. "I dare say it's a French mouse, come over with William the Conqueror." So she began again: "Où est ma chatte?" which was the first sentence in her French lesson-book. The Mouse gave a sudden leap out of the water and seemed to quiver all over with fright. "Oh, I beg your pardon!" cried Alice hastily, afraid that she had hurt the poor animal's feelings. "I quite forgot you didn't like cats."

        "Not like cats!" cried the Mouse in a shrill, passionate voice. "Would _you_ like cats, if you were me?"

        "Well, perhaps not," said Alice in a soothing tone; "don't be angry about it. And yet I wish I could show you our cat Dinah. I think you'd take a fancy to cats, if you could only see her. She is such a dear, quiet thing." The Mouse was bristling all over and she felt certain it must be really offended. "We won't talk about her any more, if you'd rather not."

        "We, indeed!" cried the Mouse, who was trembling down to the end of its tail. "As if _I_ would talk on such a subject! Our family always _hated_ cats--nasty, low, vulgar things! Don't let me hear the name again!"

        "I won't indeed!" said Alice, in a great hurry to change the subject of conversation. "Are you--are you fond--of--of dogs? There is such a nice little dog near our house, I should like to show you! It kills all the rats and--oh, dear!" cried Alice in a sorrowful tone. "I'm afraid I've offended it again!" For the Mouse was swimming away from her as hard as it could go, and making quite a commotion in the pool as it went.

        So she called softly after it, "Mouse dear! Do come back again, and we won't talk about cats, or dogs either, if you don't like them!" When the Mouse heard this, it turned 'round and swam slowly back to her; its face was quite pale, and it said, in a low, trembling voice, "Let us get to the shore and then I'll tell you my history and you'll understand why it is I hate cats and dogs."

        It was high time to go, for the pool was getting quite crowded with the birds and animals that had fallen into it; there were a Duck and a Dodo, a Lory and an Eaglet, and several other curious creatures. Alice led the way and the whole party swam to the shore.

        III--A CAUCUS-RACE AND A LONG TALE

        They were indeed a queer-looking party that assembled on the bank--the birds with draggled feathers, the animals with their fur clinging close to them, and all dripping wet, cross and uncomfortable.

        The first question, of course, was how to get dry again. They had a consultation about this and after a few minutes, it seemed quite natural to Alice to find herself talking familiarly with them, as if she had known them all her life.

        At last the Mouse, who seemed to be a person of some authority among them, called out, "Sit down, all of you, and listen to me! _I'll_ soon make you dry enough!" They all sat down at once, in a large ring, with the Mouse in the middle.

        "Ahem!" said the Mouse with an important air. "Are you all ready? This is the driest thing I know. Silence all 'round, if you please! 'William the Conqueror, whose cause was favored by the pope, was soon submitted to by the English, who wanted leaders, and had been of late much accustomed to usurpation and conquest. Edwin and Morcar, the Earls of Mercia and Northumbria'--"

        "Ugh!" said the Lory, with a shiver.

        "--'And even Stigand, the patriotic archbishop of Canterbury, found it advisable'--"

        "Found _what_?" said the Duck.

        "Found _it_," the Mouse replied rather crossly; "of course, you know what 'it' means."

        "I know what 'it' means well enough, when _I_ find a thing," said the Duck; "it's generally a frog or a worm. The question is, what did the archbishop find?"

        The Mouse did not notice this question, but hurriedly went on, "'--found it advisable to go with Edgar Atheling to meet William and offer him the crown.'--How are you getting on now, my dear?" it continued, turning to Alice as it spoke.

        "As wet as ever," said Alice in a melancholy tone; "it doesn't seem to dry me at all."

        "In that case," said the Dodo solemnly, rising to its feet, "I move that the meeting adjourn, for the immediate adoption of more energetic remedies--"

        "Speak English!" said the Eaglet. "I don't know the meaning of half those long words, and, what's more, I don't believe you do either!"

        "What I was going to say," said the Dodo in an offended tone, "is that the best thing to get us dry would be a Caucus-race."

        "What _is_ a Caucus-race?" said Alice.

        "Why," said the Dodo, "the best way to explain it is to do it." First it marked out a race-course, in a sort of circle, and then all the party were placed along the course, here and there. There was no "One, two, three and away!" but they began running when they liked and left off when they liked, so that it was not easy to know when the race was over. However, when they had been running half an hour or so and were quite dry again, the Dodo suddenly called out, "The race is over!" and they all crowded 'round it, panting and asking, "But who has won?"

        This question the Dodo could not answer without a great deal of thought. At last it said, "_Everybody_ has won, and _all_ must have prizes."

        "But who is to give the prizes?" quite a chorus of voices asked.

        "Why, _she_, of course," said the Dodo, pointing to Alice with one finger; and the whole party at once crowded 'round her, calling out, in a confused way, "Prizes! Prizes!"

        Alice had no idea what to do, and in despair she put her hand into her pocket and pulled out a box of comfits (luckily the salt-water had not got into it) and handed them 'round as prizes. There was exactly one a-piece, all 'round.

        The next thing was to eat the comfits; this caused some noise and confusion, as the large birds complained that they could not taste theirs, and the small ones choked and had to be patted on the back. However, it was over at last and they sat down again in a ring and begged the Mouse to tell them something more.

        "You promised to tell me your history, you know," said Alice, "and why it is you hate--C and D," she added in a whisper, half afraid that it would be offended again.

        "Mine is a long and a sad tale!" said the Mouse, turning to Alice and sighing.

        "It _is_ a long tail, certainly," said Alice, looking down with wonder at the Mouse's tail, "but why do you call it sad?" And she kept on puzzling about it while the Mouse was speaking, so that her idea of the tale was something like this:--

        "You are not attending!" said the Mouse to Alice, severely. "What are you thinking of?"

        "I beg your pardon," said Alice very humbly, "you had got to the fifth bend, I think?"

        "You insult me by talking such nonsense!" said the Mouse, getting up and walking away.

        "Please come back and finish your story!" Alice called after it. And the others all joined in chorus, "Yes, please do!" But the Mouse only shook its head impatiently and walked a little quicker.

        "I wish I had Dinah, our cat, here!" said Alice. This caused a remarkable sensation among the party. Some of the birds hurried off at once, and a Canary called out in a trembling voice, to its children, "Come away, my dears! It's high time you were all in bed!" On various pretexts they all moved off and Alice was soon left alone.

        "I wish I hadn't mentioned Dinah! Nobody seems to like her down here and I'm sure she's the best cat in the world!" Poor Alice began to cry again, for she felt very lonely and low-spirited. In a little while, however, she again heard a little pattering of footsteps in the distance and she looked up eagerly.

        IV--THE RABBIT SENDS IN A LITTLE BILL

        It was the White Rabbit, trotting slowly back again and looking anxiously about as it went, as if it had lost something; Alice heard it muttering to itself, "The Duchess! The Duchess! Oh, my dear paws! Oh, my fur and whiskers! She'll get me executed, as sure as ferrets are ferrets! Where _can_ I have dropped them, I wonder?" Alice guessed in a moment that it was looking for the fan and the pair of white kid-gloves and she very good-naturedly began hunting about for them, but they were nowhere to be seen--everything seemed to have changed since her swim in the pool, and the great hall, with the glass table and the little door, had vanished completely.

        Very soon the Rabbit noticed Alice, and called to her, in an angry tone, "Why, Mary Ann, what _are_ you doing out here? Run home this moment and fetch me a pair of gloves and a fan! Quick, now!"

        "He took me for his housemaid!" said Alice, as she ran off. "How surprised he'll be when he finds out who I am!" As she said this, she came upon a neat little house, on the door of which was a bright brass plate with the name "W. RABBIT" engraved upon it. She went in without knocking and hurried upstairs, in great fear lest she should meet the real Mary Ann and be turned out of the house before she had found the fan and gloves.

        By this time, Alice had found her way into a tidy little room with a table in the window, and on it a fan and two or three pairs of tiny white kid-gloves; she took up the fan and a pair of the gloves and was just going to leave the room, when her eyes fell upon a little bottle that stood near the looking-glass. She uncorked it and put it to her lips, saying to herself, "I do hope it'll make me grow large again, for, really, I'm quite tired of being such a tiny little thing!"

        Before she had drunk half the bottle, she found her head pressing against the ceiling, and had to stoop to save her neck from being broken. She hastily put down the bottle, remarking, "That's quite enough--I hope I sha'n't grow any more."

        Alas! It was too late to wish that! She went on growing and growing and very soon she had to kneel down on the floor. Still she went on growing, and, as a last resource, she put one arm out of the window and one foot up the chimney, and said to herself, "Now I can do no more, whatever happens. What _will_ become of me?"

        Luckily for Alice, the little magic bottle had now had its full effect and she grew no larger. After a few minutes she heard a voice outside and stopped to listen.

        "Mary Ann! Mary Ann!" said the voice. "Fetch me my gloves this moment!" Then came a little pattering of feet on the stairs. Alice knew it was the Rabbit coming to look for her and she trembled till she shook the house, quite forgetting that she was now about a thousand times as large as the Rabbit and had no reason to be afraid of it.

        Presently the Rabbit came up to the door and tried to open it; but as the door opened inwards and Alice's elbow was pressed hard against it, that attempt proved a failure. Alice heard it say to itself, "Then I'll go 'round and get in at the window."

        "_That_ you won't!" thought Alice; and after waiting till she fancied she heard the Rabbit just under the window, she suddenly spread out her hand and made a snatch in the air. She did not get hold of anything, but she heard a little shriek and a fall and a crash of broken glass, from which she concluded that it was just possible it had fallen into a cucumber-frame or something of that sort.

        Next came an angry voice--the Rabbit's--"Pat! Pat! Where are you?" And then a voice she had never heard before, "Sure then, I'm here! Digging for apples, yer honor!"

        "Here! Come and help me out of this! Now tell me, Pat, what's that in the window?"

        "Sure, it's an arm, yer honor!"

        "Well, it's got no business there, at any rate; go and take it away!"

        There was a long silence after this and Alice could only hear whispers now and then, and at last she spread out her hand again and made another snatch in the air. This time there were _two_ little shrieks and more sounds of broken glass. "I wonder what they'll do next!" thought Alice. "As for pulling me out of the window, I only wish they _could_!"

        She waited for some time without hearing anything more. At last came a rumbling of little cart-wheels and the sound of a good many voices all talking together. She made out the words: "Where's the other ladder? Bill's got the other--Bill! Here, Bill! Will the roof bear?--Who's to go down the chimney?--Nay, _I_ sha'n't! _You_ do it! Here, Bill! The master says you've got to go down the chimney!"

        Alice drew her foot as far down the chimney as she could and waited till she heard a little animal scratching and scrambling about in the chimney close above her; then she gave one sharp kick and waited to see what would happen next.

        The first thing she heard was a general chorus of "There goes Bill!" then the Rabbit's voice alone--"Catch him, you by the hedge!" Then silence and then another confusion of voices--"Hold up his head--Brandy now--Don't choke him--What happened to you?"

        Last came a little feeble, squeaking voice, "Well, I hardly know--No more, thank ye. I'm better now--all I know is, something comes at me like a Jack-in-the-box and up I goes like a sky-rocket!"

        After a minute or two of silence, they began moving about again, and Alice heard the Rabbit say, "A barrowful will do, to begin with."

        "A barrowful of _what_?" thought Alice. But she had not long to doubt, for the next moment a shower of little pebbles came rattling in at the window and some of them hit her in the face. Alice noticed, with some surprise, that the pebbles were all turning into little cakes as they lay on the floor and a bright idea came into her head. "If I eat one of these cakes," she thought, "it's sure to make _some_ change in my size."

        So she swallowed one of the cakes and was delighted to find that she began shrinking directly. As soon as she was small enough to get through the door, she ran out of the house and found quite a crowd of little animals and birds waiting outside. They all made a rush at Alice the moment she appeared, but she ran off as hard as she could and soon found herself safe in a thick wood.

        "The first thing I've got to do," said Alice to herself, as she wandered about in the wood, "is to grow to my right size again; and the second thing is to find my way into that lovely garden. I suppose I ought to eat or drink something or other, but the great question is 'What?'"

        Alice looked all around her at the flowers and the blades of grass, but she could not see anything that looked like the right thing to eat or drink under the circumstances. There was a large mushroom growing near her, about the same height as herself. She stretched herself up on tiptoe and peeped over the edge and her eyes immediately met those of a large blue caterpillar, that was sitting on the top, with its arms folded, quietly smoking a long hookah and taking not the smallest notice of her or of anything else.

        V--ADVICE FROM A CATERPILLAR

        At last the Caterpillar took the hookah out of its mouth and addressed Alice in a languid, sleepy voice.

        "Who are _you_?" said the Caterpillar.

        Alice replied, rather shyly, "I--I hardly know, sir, just at present--at least I know who I _was_ when I got up this morning, but I think I must have changed several times since then."

        "What do you mean by that?" said the Caterpillar, sternly. "Explain yourself!"

        "I can't explain _myself_, I'm afraid, sir," said Alice, "because I'm not myself, you see--being so many different sizes in a day is very confusing." She drew herself up and said very gravely, "I think you ought to tell me who _you_ are, first."

        "Why?" said the Caterpillar.

        As Alice could not think of any good reason and the Caterpillar seemed to be in a _very_ unpleasant state of mind, she turned away.

        "Come back!" the Caterpillar called after her. "I've something important to say!" Alice turned and came back again.

        "Keep your temper," said the Caterpillar.

        "Is that all?" said Alice, swallowing down her anger as well as she could.

        "No," said the Caterpillar.

        It unfolded its arms, took the hookah out of its mouth again, and said, "So you think you're changed, do you?"

        "I'm afraid, I am, sir," said Alice. "I can't remember things as I used--and I don't keep the same size for ten minutes together!"

        "What size do you want to be?" asked the Caterpillar.

        "Oh, I'm not particular as to size," Alice hastily replied, "only one doesn't like changing so often, you know. I should like to be a _little_ larger, sir, if you wouldn't mind," said Alice. "Three inches is such a wretched height to be."

        "It is a very good height indeed!" said the Caterpillar angrily, rearing itself upright as it spoke (it was exactly three inches high).

        In a minute or two, the Caterpillar got down off the mushroom and crawled away into the grass, merely remarking, as it went, "One side will make you grow taller, and the other side will make you grow shorter."

        "One side of _what_? The other side of _what_?" thought Alice to herself.

        "Of the mushroom," said the Caterpillar, just as if she had asked it aloud; and in another moment, it was out of sight.

        Alice remained looking thoughtfully at the mushroom for a minute, trying to make out which were the two sides of it. At last she stretched her arms 'round it as far as they would go, and broke off a bit of the edge with each hand.

        "And now which is which?" she said to herself, and nibbled a little of the right-hand bit to try the effect. The next moment she felt a violent blow underneath her chin--it had struck her foot!

        She was a good deal frightened by this very sudden change, as she was shrinking rapidly; so she set to work at once to eat some of the other bit. Her chin was pressed so closely against her foot that there was hardly room to open her mouth; but she did it at last and managed to swallow a morsel of the left-hand bit....

        "Come, my head's free at last!" said Alice; but all she could see, when she looked down, was an immense length of neck, which seemed to rise like a stalk out of a sea of green leaves that lay far below her.

        "Where _have_ my shoulders got to? And oh, my poor hands, how is it I can't see you?" She was delighted to find that her neck would bend about easily in any direction, like a serpent. She had just succeeded in curving it down into a graceful zigzag and was going to dive in among the leaves, when a sharp hiss made her draw back in a hurry--a large pigeon had flown into her face and was beating her violently with its wings.

        "Serpent!" cried the Pigeon.

        "I'm _not_ a serpent!" said Alice indignantly. "Let me alone!"

        "I've tried the roots of trees, and I've tried banks, and I've tried hedges," the Pigeon went on, "but those serpents! There's no pleasing them!"

        Alice was more and more puzzled.

        "As if it wasn't trouble enough hatching the eggs," said the Pigeon, "but I must be on the look-out for serpents, night and day! And just as I'd taken the highest tree in the wood," continued the Pigeon, raising its voice to a shriek, "and just as I was thinking I should be free of them at last, they must needs come wriggling down from the sky! Ugh, Serpent!"

        "But I'm _not_ a serpent, I tell you!" said Alice. "I'm a--I'm a--I'm a little girl," she added rather doubtfully, as she remembered the number of changes she had gone through that day.

        "You're looking for eggs, I know _that_ well enough," said the Pigeon; "and what does it matter to me whether you're a little girl or a serpent?"

        "It matters a good deal to _me_," said Alice hastily; "but I'm not looking for eggs, as it happens, and if I was, I shouldn't want _yours_--I don't like them raw."

        "Well, be off, then!" said the Pigeon in a sulky tone, as it settled down again into its nest. Alice crouched down among the trees as well as she could, for her neck kept getting entangled among the branches, and every now and then she had to stop and untwist it. After awhile she remembered that she still held the pieces of mushroom in her hands, and she set to work very carefully, nibbling first at one and then at the other, and growing sometimes taller and sometimes shorter, until she had succeeded in bringing herself down to her usual height.

        It was so long since she had been anything near the right size that it felt quite strange at first. "The next thing is to get into that beautiful garden--how _is_ that to be done, I wonder?" As she said this, she came suddenly upon an open place, with a little house in it about four feet high. "Whoever lives there," thought Alice, "it'll never do to come upon them _this_ size; why, I should frighten them out of their wits!" She did not venture to go near the house till she had brought herself down to nine inches high.

        VI--PIG AND PEPPER

        For a minute or two she stood looking at the house, when suddenly a footman in livery came running out of the wood (judging by his face only, she would have called him a fish)--and rapped loudly at the door with his knuckles. It was opened by another footman in livery, with a round face and large eyes like a frog.

        The Fish-Footman began by producing from under his arm a great letter, and this he handed over to the other, saying, in a solemn tone, "For the Duchess. An invitation from the Queen to play croquet." The Frog-Footman repeated, in the same solemn tone, "From the Queen. An invitation for the Duchess to play croquet." Then they both bowed low and their curls got entangled together.

        When Alice next peeped out, the Fish-Footman was gone, and the other was sitting on the ground near the door, staring stupidly up into the sky. Alice went timidly up to the door and knocked.

        "There's no sort of use in knocking," said the Footman, "and that for two reasons. First, because I'm on the same side of the door as you are; secondly, because they're making such a noise inside, no one could possibly hear you." And certainly there _was_ a most extraordinary noise going on within--a constant howling and sneezing, and every now and then a great crash, as if a dish or kettle had been broken to pieces.

        "How am I to get in?" asked Alice.

        "_Are_ you to get in at all?" said the Footman. "That's the first question, you know."

        Alice opened the door and went in. The door led right into a large kitchen, which was full of smoke from one end to the other; the Duchess was sitting on a three-legged stool in the middle, nursing a baby; the cook was leaning over the fire, stirring a large caldron which seemed to be full of soup.

        "There's certainly too much pepper in that soup!" Alice said to herself, as well as she could for sneezing. Even the Duchess sneezed occasionally; and as for the baby, it was sneezing and howling alternately without a moment's pause. The only two creatures in the kitchen that did _not_ sneeze were the cook and a large cat, which was grinning from ear to ear.

        "Please would you tell me," said Alice, a little timidly, "why your cat grins like that?"

        "It's a Cheshire-Cat," said the Duchess, "and that's why."

        "I didn't know that Cheshire-Cats always grinned; in fact, I didn't know that cats _could_ grin," said Alice.

        "You don't know much," said the Duchess, "and that's a fact."

        Just then the cook took the caldron of soup off the fire, and at once set to work throwing everything within her reach at the Duchess and the baby--the fire-irons came first; then followed a shower of saucepans, plates and dishes. The Duchess took no notice of them, even when they hit her, and the baby was howling so much already that it was quite impossible to say whether the blows hurt it or not.

        "Oh, _please_ mind what you're doing!" cried Alice, jumping up and down in an agony of terror.

        "Here! You may nurse it a bit, if you like!" the Duchess said to Alice, flinging the baby at her as she spoke. "I must go and get ready to play croquet with the Queen," and she hurried out of the room.

        Alice caught the baby with some difficulty, as it was a queer-shaped little creature and held out its arms and legs in all directions. "If I don't take this child away with me," thought Alice, "they're sure to kill it in a day or two. Wouldn't it be murder to leave it behind?" She said the last words out loud and the little thing grunted in reply.

        "If you're going to turn into a pig, my dear," said Alice, "I'll have nothing more to do with you. Mind now!"

        Alice was just beginning to think to herself, "Now, what am I to do with this creature, when I get it home?" when it grunted again so violently that Alice looked down into its face in some alarm. This time there could be _no_ mistake about it--it was neither more nor less than a pig; so she set the little creature down and felt quite relieved to see it trot away quietly into the wood.

        Alice was a little startled by seeing the Cheshire-Cat sitting on a bough of a tree a few yards off. The Cat only grinned when it saw her. "Cheshire-Puss," began Alice, rather timidly, "would you please tell me which way I ought to go from here?"

        "In _that_ direction," the Cat said, waving the right paw 'round, "lives a Hatter; and in _that_ direction," waving the other paw, "lives a March Hare. Visit either you like; they're both mad."

        "But I don't want to go among mad people," Alice remarked.

        "Oh, you can't help that," said the Cat; "we're all mad here. Do you play croquet with the Queen to-day?"

        "I should like it very much," said Alice, "but I haven't been invited yet."

        "You'll see me there," said the Cat, and vanished.

        Alice had not gone much farther before she came in sight of the house of the March Hare; it was so large a house that she did not like to go near till she had nibbled some more of the left-hand bit of mushroom.

        VII--A MAD TEA-PARTY

        There was a table set out under a tree in front of the house, and the March Hare and the Hatter were having tea at it; a Dormouse was sitting between them, fast asleep.

        The table was a large one, but the three were all crowded together at one corner of it. "No room! No room!" they cried out when they saw Alice coming. "There's _plenty_ of room!" said Alice indignantly, and she sat down in a large arm-chair at one end of the table.

        The Hatter opened his eyes very wide on hearing this, but all he said was "Why is a raven like a writing-desk?"

        "I'm glad they've begun asking riddles--I believe I can guess that," she added aloud.

        "Do you mean that you think you can find out the answer to it?" said the March Hare.

        "Exactly so," said Alice.

        "Then you should say what you mean," the March Hare went on.

        "I do," Alice hastily replied; "at least--at least I mean what I say--that's the same thing, you know."

        "You might just as well say," added the Dormouse, which seemed to be talking in its sleep, "that 'I breathe when I sleep' is the same thing as 'I sleep when I breathe!'"

        "It _is_ the same thing with you," said the Hatter, and he poured a little hot tea upon its nose. The Dormouse shook its head impatiently and said, without opening its eyes, "Of course, of course; just what I was going to remark myself."

        "Have you guessed the riddle yet?" the Hatter said, turning to Alice again.

        "No, I give it up," Alice replied. "What's the answer?"

        "I haven't the slightest idea," said the Hatter.

        "Nor I," said the March Hare.

        Alice gave a weary sigh. "I think you might do something better with the time," she said, "than wasting it in asking riddles that have no answers."

        "Take some more tea," the March Hare said to Alice, very earnestly.

        "I've had nothing yet," Alice replied in an offended tone, "so I can't take more."

        "You mean you can't take _less_," said the Hatter; "it's very easy to take _more_ than nothing."

        At this, Alice got up and walked off. The Dormouse fell asleep instantly and neither of the others took the least notice of her going, though she looked back once or twice; the last time she saw them, they were trying to put the Dormouse into the tea-pot.

        "At any rate, I'll never go _there_ again!" said Alice, as she picked her way through the wood. "It's the stupidest tea-party I ever was at in all my life!" Just as she said this, she noticed that one of the trees had a door leading right into it. "That's very curious!" she thought. "I think I may as well go in at once." And in she went.

        Once more she found herself in the long hall and close to the little glass table. Taking the little golden key, she unlocked the door that led into the garden. Then she set to work nibbling at the mushroom (she had kept a piece of it in her pocket) till she was about a foot high; then she walked down the little passage; and _then_--she found herself at last in the beautiful garden, among the bright flower-beds and the cool fountains.

        VIII--THE QUEEN'S CROQUET GROUND

        A large rose-tree stood near the entrance of the garden; the roses growing on it were white, but there were three gardeners at it, busily painting them red. Suddenly their eyes chanced to fall upon Alice, as she stood watching them. "Would you tell me, please," said Alice, a little timidly, "why you are painting those roses?"

        Five and Seven said nothing, but looked at Two. Two began, in a low voice, "Why, the fact is, you see, Miss, this here ought to have been a _red_ rose-tree, and we put a white one in by mistake; and, if the Queen was to find it out, we should all have our heads cut off, you know. So you see, Miss, we're doing our best, afore she comes, to--" At this moment, Five, who had been anxiously looking across the garden, called out, "The Queen! The Queen!" and the three gardeners instantly threw themselves flat upon their faces. There was a sound of many footsteps and Alice looked 'round, eager to see the Queen.

        First came ten soldiers carrying clubs, with their hands and feet at the corners: next the ten courtiers; these were ornamented all over with diamonds. After these came the royal children; there were ten of them, all ornamented with hearts. Next came the guests, mostly Kings and Queens, and among them Alice recognized the White Rabbit. Then followed the Knave of Hearts, carrying the King's crown on a crimson velvet cushion; and last of all this grand procession came THE KING AND THE QUEEN OF HEARTS.

        When the procession came opposite to Alice, they all stopped and looked at her, and the Queen said severely, "Who is this?" She said it to the Knave of Hearts, who only bowed and smiled in reply.

        "My name is Alice, so please Your Majesty," said Alice very politely; but she added to herself, "Why, they're only a pack of cards, after all!"

        "Can you play croquet?" shouted the Queen. The question was evidently meant for Alice.

        "Yes!" said Alice loudly.

        "Come on, then!" roared the Queen.

        "It's--it's a very fine day!" said a timid voice to Alice. She was walking by the White Rabbit, who was peeping anxiously into her face.

        "Very," said Alice. "Where's the Duchess?"

        "Hush! Hush!" said the Rabbit. "She's under sentence of execution."

        "What for?" said Alice.

        "She boxed the Queen's ears--" the Rabbit began.

        "Get to your places!" shouted the Queen in a voice of thunder, and people began running about in all directions, tumbling up against each other. However, they got settled down in a minute or two, and the game began.

        Alice thought she had never seen such a curious croquet-ground in her life; it was all ridges and furrows. The croquet balls were live hedgehogs, and the mallets live flamingos and the soldiers had to double themselves up and stand on their hands and feet, to make the arches.

        The players all played at once, without waiting for turns, quarrelling all the while and fighting for the hedgehogs; and in a very short time, the Queen was in a furious passion and went stamping about and shouting, "Off with his head!" or "Off with her head!" about once in a minute.

        "They're dreadfully fond of beheading people here," thought Alice; "the great wonder is that there's anyone left alive!"

        She was looking about for some way of escape, when she noticed a curious appearance in the air. "It's the Cheshire-Cat," she said to herself; "now I shall have somebody to talk to."

        "How are you getting on?" said the Cat.

        "I don't think they play at all fairly," Alice said, in a rather complaining tone; "and they all quarrel so dreadfully one can't hear oneself speak--and they don't seem to have any rules in particular."

        "How do you like the Queen?" said the Cat in a low voice.

        "Not at all," said Alice.

        Alice thought she might as well go back and see how the game was going on. So she went off in search of her hedgehog. The hedgehog was engaged in a fight with another hedgehog, which seemed to Alice an excellent opportunity for croqueting one of them with the other; the only difficulty was that her flamingo was gone across to the other side of the garden, where Alice could see it trying, in a helpless sort of way, to fly up into a tree. She caught the flamingo and tucked it away under her arm, that it might not escape again.

        Just then Alice ran across the Duchess (who was now out of prison). She tucked her arm affectionately into Alice's and they walked off together. Alice was very glad to find her in such a pleasant temper. She was a little startled, however, when she heard the voice of the Duchess close to her ear. "You're thinking about something, my dear, and that makes you forget to talk."

        "The game's going on rather better now," Alice said, by way of keeping up the conversation a little.

        "'Tis so," said the Duchess; "and the moral of that is--'Oh, 'tis love, 'tis love that makes the world go 'round!'"

        "Somebody said," Alice whispered, "that it's done by everybody minding his own business!"

        "Ah, well! It means much the same thing," said the Duchess, digging her sharp little chin into Alice's shoulder, as she added "and the moral of _that_ is--'Take care of the sense and the sounds will take care of themselves.'"

        To Alice's great surprise, the Duchess's arm that was linked into hers began to tremble. Alice looked up and there stood the Queen in front of them, with her arms folded, frowning like a thunderstorm!

        "Now, I give you fair warning," shouted the Queen, stamping on the ground as she spoke, "either you or your head must be off, and that in about half no time. Take your choice!" The Duchess took her choice, and was gone in a moment.

        "Let's go on with the game," the Queen said to Alice; and Alice was too much frightened to say a word, but slowly followed her back to the croquet-ground.

        All the time they were playing, the Queen never left off quarreling with the other players and shouting, "Off with his head!" or "Off with her head!" By the end of half an hour or so, all the players, except the King, the Queen and Alice, were in custody of the soldiers and under sentence of execution.

        Then the Queen left off, quite out of breath, and walked away with Alice.

        Alice heard the King say in a low voice to the company generally, "You are all pardoned."

        Suddenly the cry "The Trial's beginning!" was heard in the distance, and Alice ran along with the others.

        IX--WHO STOLE THE TARTS?

        The King and Queen of Hearts were seated on their throne when they arrived, with a great crowd assembled about them--all sorts of little birds and beasts, as well as the whole pack of cards: the Knave was standing before them, in chains, with a soldier on each side to guard him; and near the King was the White Rabbit, with a trumpet in one hand and a scroll of parchment in the other. In the very middle of the court was a table, with a large dish of tarts upon it. "I wish they'd get the trial done," Alice thought, "and hand 'round the refreshments!"

        The judge, by the way, was the King and he wore his crown over his great wig. "That's the jury-box," thought Alice; "and those twelve creatures (some were animals and some were birds) I suppose they are the jurors."

        Just then the White Rabbit cried out "Silence in the court!"

        "Herald, read the accusation!" said the King.

        On this, the White Rabbit blew three blasts on the trumpet, then unrolled the parchment-scroll and read as follows:

        "Call the first witness," said the King; and the White Rabbit blew three blasts on the trumpet and called out, "First witness!"

        The first witness was the Hatter. He came in with a teacup in one hand and a piece of bread and butter in the other.

        "You ought to have finished," said the King. "When did you begin?"

        The Hatter looked at the March Hare, who had followed him into the court, arm in arm with the Dormouse. "Fourteenth of March, I _think_ it was," he said.

        "Give your evidence," said the King, "and don't be nervous, or I'll have you executed on the spot."

        This did not seem to encourage the witness at all; he kept shifting from one foot to the other, looking uneasily at the Queen, and, in his confusion, he bit a large piece out of his teacup instead of the bread and butter.

        Just at this moment Alice felt a very curious sensation--she was beginning to grow larger again.

        The miserable Hatter dropped his teacup and bread and butter and went down on one knee. "I'm a poor man, Your Majesty," he began.

        "You're a _very_ poor _speaker_," said the King.

        "You may go," said the King, and the Hatter hurriedly left the court.

        "Call the next witness!" said the King.

        The next witness was the Duchess's cook. She carried the pepper-box in her hand and the people near the door began sneezing all at once.

        "Give your evidence," said the King.

        "Sha'n't," said the cook.

        The King looked anxiously at the White Rabbit, who said, in a low voice, "Your Majesty must cross-examine _this_ witness."

        "Well, if I must, I must," the King said. "What are tarts made of?"

        "Pepper, mostly," said the cook.

        For some minutes the whole court was in confusion and by the time they had settled down again, the cook had disappeared.

        "Never mind!" said the King, "call the next witness."

        Alice watched the White Rabbit as he fumbled over the list. Imagine her surprise when he read out, at the top of his shrill little voice, the name "Alice!"

        X--ALICE'S EVIDENCE

        "Here!" cried Alice. She jumped up in such a hurry that she tipped over the jury-box, upsetting all the jurymen on to the heads of the crowd below.

        "Oh, I _beg_ your pardon!" she exclaimed in a tone of great dismay.

        "The trial cannot proceed," said the King, "until all the jurymen are back in their proper places--_all_," he repeated with great emphasis, looking hard at Alice.

        "What do you know about this business?" the King said to Alice.

        "Nothing whatever," said Alice.

        The King then read from his book: "Rule forty-two. _All persons more than a mile high to leave the court_."

        "_I'm_ not a mile high," said Alice.

        "Nearly two miles high," said the Queen.

        "Well, I sha'n't go, at any rate," said Alice.

        The King turned pale and shut his note-book hastily. "Consider your verdict," he said to the jury, in a low, trembling voice.

        "There's more evidence to come yet, please Your Majesty," said the White Rabbit, jumping up in a great hurry. "This paper has just been picked up. It seems to be a letter written by the prisoner to--to somebody." He unfolded the paper as he spoke and added, "It isn't a letter, after all; it's a set of verses."

        "Please, Your Majesty," said the Knave, "I didn't write it and they can't prove that I did; there's no name signed at the end."

        "You _must_ have meant some mischief, or else you'd have signed your name like an honest man," said the King. There was a general clapping of hands at this.

        "Read them," he added, turning to the White Rabbit.

        There was dead silence in the court whilst the White Rabbit read out the verses.

        "That's the most important piece of evidence we've heard yet," said the King.

        "_I_ don't believe there's an atom of meaning in it," ventured Alice.

        "If there's no meaning in it," said the King, "that saves a world of trouble, you know, as we needn't try to find any. Let the jury consider their verdict."

        "No, no!" said the Queen. "Sentence first--verdict afterwards."

        "Stuff and nonsense!" said Alice loudly. "The idea of having the sentence first!"

        "Hold your tongue!" said the Queen, turning purple.

        "I won't!" said Alice.

        "Off with her head!" the Queen shouted at the top of her voice. Nobody moved.

        "Who cares for _you_?" said Alice (she had grown to her full size by this time). "You're nothing but a pack of cards!"

        At this, the whole pack rose up in the air and came flying down upon her; she gave a little scream, half of fright and half of anger, and tried to beat them off, and found herself lying on the bank, with her head in the lap of her sister, who was gently brushing away some dead leaves that had fluttered down from the trees upon her face.

        "Wake up, Alice dear!" said her sister. "Why, what a long sleep you've had!"

        "Oh, I've had such a curious dream!" said Alice. And she told her sister, as well as she could remember them, all these strange adventures of hers that you have just been reading about. Alice got up and ran off, thinking while she ran, as well she might, what a wonderful dream it had been.
      ]]>
    </input>
    <expected>
      <sentence>DOWN THE RABBIT-HOLE</sentence>
      <sentence>Alice was beginning to get very tired of sitting by her sister on the bank, and of having nothing to do.</sentence>
      <sentence>Once or twice she had peeped into the book her sister was reading, but it had no pictures or conversations in it, "and what is the use of a book," thought Alice, "without pictures or conversations?"</sentence>
      <sentence>So she was considering in her own mind (as well as she could, for the day made her feel very sleepy and stupid), whether the pleasure of making a daisy-chain would be worth the trouble of getting up and picking the daisies, when suddenly a White Rabbit with pink eyes ran close by her.</sentence>
      <sentence>There was nothing so very remarkable in that, nor did Alice think it so very much out of the way to hear the Rabbit say to itself, "Oh dear! Oh dear! I shall be too late!"</sentence>
      <sentence>But when the Rabbit actually took a watch out of its waistcoat-pocket and looked at it and then hurried on, Alice started to her feet, for it flashed across her mind that she had never before seen a rabbit with either a waistcoat-pocket, or a watch to take out of it, and, burning with curiosity, she ran across the field after it and was just in time to see it pop down a large rabbit-hole, under the hedge.</sentence>
      <sentence>In another moment, down went Alice after it!</sentence>
      <sentence>The rabbit-hole went straight on like a tunnel for some way and then dipped suddenly down, so suddenly that Alice had not a moment to think about stopping herself before she found herself falling down what seemed to be a very deep well.</sentence>
      <sentence>Either the well was very deep, or she fell very slowly, for she had plenty of time, as she went down, to look about her.</sentence>
      <sentence>First, she tried to make out what she was coming to, but it was too dark to see anything; then she looked at the sides of the well and noticed that they were filled with cupboards and book-shelves; here and there she saw maps and pictures hung upon pegs.</sentence>
      <sentence>She took down a jar from one of the shelves as she passed.</sentence>
      <sentence>It was labeled "ORANGE MARMALADE," but, to her great disappointment, it was empty; she did not like to drop the jar, so managed to put it into one of the cupboards as she fell past it.</sentence>
      <sentence>Down, down, down!</sentence>
      <sentence>Would the fall never come to an end?</sentence>
      <sentence>There was nothing else to do, so Alice soon began talking to herself.</sentence>
      <sentence>"Dinah'll miss me very much to-night, I should think!"</sentence>
      <sentence>(Dinah was the cat.)</sentence>
      <sentence>"I hope they'll remember her saucer of milk at tea-time. Dinah, my dear, I wish you were down here with me!"</sentence>
      <sentence>Alice felt that she was dozing off, when suddenly, thump! thump! down she came upon a heap of sticks and dry leaves, and the fall was over.</sentence>
      <sentence>Alice was not a bit hurt, and she jumped up in a moment.</sentence>
      <sentence>She looked up, but it was all dark overhead; before her was another long passage and the White Rabbit was still in sight, hurrying down it.</sentence>
      <sentence>There was not a moment to be lost.</sentence>
      <sentence>Away went Alice like the wind and was just in time to hear it say, as it turned a corner, "Oh, my ears and whiskers, how late it's getting!"</sentence>
      <sentence>She was close behind it when she turned the corner, but the Rabbit was no longer to be seen.</sentence>
      <sentence>She found herself in a long, low hall, which was lit up by a row of lamps hanging from the roof.</sentence>
      <sentence>There were doors all 'round the hall, but they were all locked; and when Alice had been all the way down one side and up the other, trying every door, she walked sadly down the middle, wondering how she was ever to get out again.</sentence>
      <sentence>Suddenly she came upon a little table, all made of solid glass.</sentence>
      <sentence>There was nothing on it but a tiny golden key, and Alice's first idea was that this might belong to one of the doors of the hall; but, alas! either the locks were too large, or the key was too small, but, at any rate, it would not open any of them.</sentence>
      <sentence>However, on the second time 'round, she came upon a low curtain she had not noticed before, and behind it was a little door about fifteen inches high.</sentence>
      <sentence>She tried the little golden key in the lock, and to her great delight, it fitted!</sentence>
      <sentence>Alice opened the door and found that it led into a small passage, not much larger than a rat-hole; she knelt down and looked along the passage into the loveliest garden you ever saw.</sentence>
      <sentence>How she longed to get out of that dark hall and wander about among those beds of bright flowers and those cool fountains, but she could not even get her head through the doorway.</sentence>
      <sentence>"Oh," said Alice, "how I wish I could shut up like a telescope! I think I could, if I only knew how to begin."</sentence>
      <sentence>Alice went back to the table, half hoping she might find another key on it, or at any rate, a book of rules for shutting people up like telescopes.</sentence>
      <sentence>This time she found a little bottle on it ("which certainly was not here before," said Alice), and tied 'round the neck of the bottle was a paper label, with the words "DRINK ME" beautifully printed on it in large letters.</sentence>
      <sentence>"No, I'll look first," she said, "and see whether it's marked '_poison_' or not," for she had never forgotten that, if you drink from a bottle marked "poison," it is almost certain to disagree with you, sooner or later.</sentence>
      <sentence>However, this bottle was _not_ marked "poison," so Alice ventured to taste it, and, finding it very nice (it had a sort of mixed flavor of cherry-tart, custard, pineapple, roast turkey, toffy and hot buttered toast), she very soon finished it off.</sentence>
      <sentence>* * * * *</sentence>
      <sentence>"What a curious feeling!" said Alice.</sentence>
      <sentence>"I must be shutting up like a telescope!"</sentence>
      <sentence>And so it was indeed!</sentence>
      <sentence>She was now only ten inches high, and her face brightened up at the thought that she was now the right size for going through the little door into that lovely garden.</sentence>
      <sentence>After awhile, finding that nothing more happened, she decided on going into the garden at once; but, alas for poor Alice!</sentence>
      <sentence>When she got to the door, she found she had forgotten the little golden key, and when she went back to the table for it, she found she could not possibly reach it: she could see it quite plainly through the glass and she tried her best to climb up one of the legs of the table, but it was too slippery, and when she had tired herself out with trying, the poor little thing sat down and cried.</sentence>
      <sentence>"Come, there's no use in crying like that!" said Alice to herself rather sharply.</sentence>
      <sentence>"I advise you to leave off this minute!"</sentence>
      <sentence>She generally gave herself very good advice (though she very seldom followed it), and sometimes she scolded herself so severely as to bring tears into her eyes.</sentence>
      <sentence>Soon her eye fell on a little glass box that was lying under the table: she opened it and found in it a very small cake, on which the words "EAT ME" were beautifully marked in currants.</sentence>
      <sentence>"Well, I'll eat it," said Alice, "and if it makes me grow larger, I can reach the key; and if it makes me grow smaller, I can creep under the door: so either way I'll get into the garden, and I don't care which happens!"</sentence>
      <sentence>She ate a little bit and said anxiously to herself, "Which way? Which way?" holding her hand on the top of her head to feel which way she was growing; and she was quite surprised to find that she remained the same size.</sentence>
      <sentence>So she set to work and very soon finished off the cake.</sentence>
      <sentence>II--THE POOL OF TEARS</sentence>
      <sentence>"Curiouser and curiouser!" cried Alice (she was so much surprised that for the moment she quite forgot how to speak good English).</sentence>
      <sentence>"Now I'm opening out like the largest telescope that ever was! Good-by, feet! Oh, my poor little feet, I wonder who will put on your shoes and stockings for you now, dears? I shall be a great deal too far off to trouble myself about you."</sentence>
      <sentence>Just at this moment her head struck against the roof of the hall; in fact, she was now rather more than nine feet high, and she at once took up the little golden key and hurried off to the garden door.</sentence>
      <sentence>Poor Alice!</sentence>
      <sentence>It was as much as she could do, lying down on one side, to look through into the garden with one eye; but to get through was more hopeless than ever.</sentence>
      <sentence>She sat down and began to cry again.</sentence>
      <sentence>She went on shedding gallons of tears, until there was a large pool all 'round her and reaching half down the hall.</sentence>
      <sentence>After a time, she heard a little pattering of feet in the distance and she hastily dried her eyes to see what was coming.</sentence>
      <sentence>It was the White Rabbit returning, splendidly dressed, with a pair of white kid-gloves in one hand and a large fan in the other.</sentence>
      <sentence>He came trotting along in a great hurry, muttering to himself, "Oh! the Duchess, the Duchess! Oh! _won't_ she be savage if I've kept her waiting!"</sentence>
      <sentence>When the Rabbit came near her, Alice began, in a low, timid voice, "If you please, sir--"</sentence>
      <sentence>The Rabbit started violently, dropped the white kid-gloves and the fan and skurried away into the darkness as hard as he could go.</sentence>
      <sentence>Alice took up the fan and gloves and she kept fanning herself all the time she went on talking.</sentence>
      <sentence>"Dear, dear! How queer everything is to-day! And yesterday things went on just as usual. _Was_ I the same when I got up this morning? But if I'm not the same, the next question is, 'Who in the world am I?' Ah, _that's_ the great puzzle!"</sentence>
      <sentence>As she said this, she looked down at her hands and was surprised to see that she had put on one of the Rabbit's little white kid-gloves while she was talking.</sentence>
      <sentence>"How _can_ I have done that?" she thought.</sentence>
      <sentence>"I must be growing small again."</sentence>
      <sentence>She got up and went to the table to measure herself by it and found that she was now about two feet high and was going on shrinking rapidly.</sentence>
      <sentence>She soon found out that the cause of this was the fan she was holding and she dropped it hastily, just in time to save herself from shrinking away altogether.</sentence>
      <sentence>"That _was_ a narrow escape!" said Alice, a good deal frightened at the sudden change, but very glad to find herself still in existence.</sentence>
      <sentence>"And now for the garden!"</sentence>
      <sentence>And she ran with all speed back to the little door; but, alas! the little door was shut again and the little golden key was lying on the glass table as before.</sentence>
      <sentence>"Things are worse than ever," thought the poor child, "for I never was so small as this before, never!"</sentence>
      <sentence>As she said these words, her foot slipped, and in another moment, splash! she was up to her chin in salt-water.</sentence>
      <sentence>Her first idea was that she had somehow fallen into the sea.</sentence>
      <sentence>However, she soon made out that she was in the pool of tears which she had wept when she was nine feet high.</sentence>
      <sentence>Just then she heard something splashing about in the pool a little way off, and she swam nearer to see what it was: she soon made out that it was only a mouse that had slipped in like herself.</sentence>
      <sentence>"Would it be of any use, now," thought Alice, "to speak to this mouse? Everything is so out-of-the-way down here that I should think very likely it can talk; at any rate, there's no harm in trying."</sentence>
      <sentence>So she began, "O Mouse, do you know the way out of this pool? I am very tired of swimming about here, O Mouse!"</sentence>
      <sentence>The Mouse looked at her rather inquisitively and seemed to her to wink with one of its little eyes, but it said nothing.</sentence>
      <sentence>"Perhaps it doesn't understand English," thought Alice.</sentence>
      <sentence>"I dare say it's a French mouse, come over with William the Conqueror."</sentence>
      <sentence>So she began again: "Où est ma chatte?" which was the first sentence in her French lesson-book.</sentence>
      <sentence>The Mouse gave a sudden leap out of the water and seemed to quiver all over with fright.</sentence>
      <sentence>"Oh, I beg your pardon!" cried Alice hastily, afraid that she had hurt the poor animal's feelings.</sentence>
      <sentence>"I quite forgot you didn't like cats."</sentence>
      <sentence>"Not like cats!" cried the Mouse in a shrill, passionate voice.</sentence>
      <sentence>"Would _you_ like cats, if you were me?"</sentence>
      <sentence>"Well, perhaps not," said Alice in a soothing tone; "don't be angry about it. And yet I wish I could show you our cat Dinah. I think you'd take a fancy to cats, if you could only see her. She is such a dear, quiet thing."</sentence>
      <sentence>The Mouse was bristling all over and she felt certain it must be really offended.</sentence>
      <sentence>"We won't talk about her any more, if you'd rather not."</sentence>
      <sentence>"We, indeed!" cried the Mouse, who was trembling down to the end of its tail.</sentence>
      <sentence>"As if _I_ would talk on such a subject! Our family always _hated_ cats--nasty, low, vulgar things! Don't let me hear the name again!"</sentence>
      <sentence>"I won't indeed!" said Alice, in a great hurry to change the subject of conversation.</sentence>
      <sentence>"Are you--are you fond--of--of dogs? There is such a nice little dog near our house, I should like to show you! It kills all the rats and--oh, dear!" cried Alice in a sorrowful tone.</sentence>
      <sentence>"I'm afraid I've offended it again!"</sentence>
      <sentence>For the Mouse was swimming away from her as hard as it could go, and making quite a commotion in the pool as it went.</sentence>
      <sentence>So she called softly after it, "Mouse dear! Do come back again, and we won't talk about cats, or dogs either, if you don't like them!"</sentence>
      <sentence>When the Mouse heard this, it turned 'round and swam slowly back to her; its face was quite pale, and it said, in a low, trembling voice, "Let us get to the shore and then I'll tell you my history and you'll understand why it is I hate cats and dogs."</sentence>
      <sentence>It was high time to go, for the pool was getting quite crowded with the birds and animals that had fallen into it; there were a Duck and a Dodo, a Lory and an Eaglet, and several other curious creatures.</sentence>
      <sentence>Alice led the way and the whole party swam to the shore.</sentence>
      <sentence>III--A CAUCUS-RACE AND A LONG TALE</sentence>
      <sentence>They were indeed a queer-looking party that assembled on the bank--the birds with draggled feathers, the animals with their fur clinging close to them, and all dripping wet, cross and uncomfortable.</sentence>
      <sentence>The first question, of course, was how to get dry again.</sentence>
      <sentence>They had a consultation about this and after a few minutes, it seemed quite natural to Alice to find herself talking familiarly with them, as if she had known them all her life.</sentence>
      <sentence>At last the Mouse, who seemed to be a person of some authority among them, called out, "Sit down, all of you, and listen to me! _I'll_ soon make you dry enough!"</sentence>
      <sentence>They all sat down at once, in a large ring, with the Mouse in the middle.</sentence>
      <sentence>"Ahem!" said the Mouse with an important air.</sentence>
      <sentence>"Are you all ready? This is the driest thing I know. Silence all 'round, if you please! 'William the Conqueror, whose cause was favored by the pope, was soon submitted to by the English, who wanted leaders, and had been of late much accustomed to usurpation and conquest. Edwin and Morcar, the Earls of Mercia and Northumbria'--"</sentence>
      <sentence>"Ugh!" said the Lory, with a shiver.</sentence>
      <sentence>"--'And even Stigand, the patriotic archbishop of Canterbury, found it advisable'--"</sentence>
      <sentence>"Found _what_?" said the Duck.</sentence>
      <sentence>"Found _it_," the Mouse replied rather crossly; "of course, you know what 'it' means."</sentence>
      <sentence>"I know what 'it' means well enough, when _I_ find a thing," said the Duck; "it's generally a frog or a worm. The question is, what did the archbishop find?"</sentence>
      <sentence>The Mouse did not notice this question, but hurriedly went on, "'--found it advisable to go with Edgar Atheling to meet William and offer him the crown.'--How are you getting on now, my dear?" it continued, turning to Alice as it spoke.</sentence>
      <sentence>"As wet as ever," said Alice in a melancholy tone; "it doesn't seem to dry me at all."</sentence>
      <sentence>"In that case," said the Dodo solemnly, rising to its feet, "I move that the meeting adjourn, for the immediate adoption of more energetic remedies--"</sentence>
      <sentence>"Speak English!" said the Eaglet.</sentence>
      <sentence>"I don't know the meaning of half those long words, and, what's more, I don't believe you do either!"</sentence>
      <sentence>"What I was going to say," said the Dodo in an offended tone, "is that the best thing to get us dry would be a Caucus-race."</sentence>
      <sentence>"What _is_ a Caucus-race?" said Alice.</sentence>
      <sentence>"Why," said the Dodo, "the best way to explain it is to do it."</sentence>
      <sentence>First it marked out a race-course, in a sort of circle, and then all the party were placed along the course, here and there.</sentence>
      <sentence>There was no "One, two, three and away!" but they began running when they liked and left off when they liked, so that it was not easy to know when the race was over.</sentence>
      <sentence>However, when they had been running half an hour or so and were quite dry again, the Dodo suddenly called out, "The race is over!" and they all crowded 'round it, panting and asking, "But who has won?"</sentence>
      <sentence>This question the Dodo could not answer without a great deal of thought.</sentence>
      <sentence>At last it said, "_Everybody_ has won, and _all_ must have prizes."</sentence>
      <sentence>"But who is to give the prizes?" quite a chorus of voices asked.</sentence>
      <sentence>"Why, _she_, of course," said the Dodo, pointing to Alice with one finger; and the whole party at once crowded 'round her, calling out, in a confused way, "Prizes! Prizes!"</sentence>
      <sentence>Alice had no idea what to do, and in despair she put her hand into her pocket and pulled out a box of comfits (luckily the salt-water had not got into it) and handed them 'round as prizes.</sentence>
      <sentence>There was exactly one a-piece, all 'round.</sentence>
      <sentence>The next thing was to eat the comfits; this caused some noise and confusion, as the large birds complained that they could not taste theirs, and the small ones choked and had to be patted on the back.</sentence>
      <sentence>However, it was over at last and they sat down again in a ring and begged the Mouse to tell them something more.</sentence>
      <sentence>"You promised to tell me your history, you know," said Alice, "and why it is you hate--C and D," she added in a whisper, half afraid that it would be offended again.</sentence>
      <sentence>"Mine is a long and a sad tale!" said the Mouse, turning to Alice and sighing.</sentence>
      <sentence>"It _is_ a long tail, certainly," said Alice, looking down with wonder at the Mouse's tail, "but why do you call it sad?"</sentence>
      <sentence>And she kept on puzzling about it while the Mouse was speaking, so that her idea of the tale was something like this:--</sentence>
      <sentence>"You are not attending!" said the Mouse to Alice, severely.</sentence>
      <sentence>"What are you thinking of?"</sentence>
      <sentence>"I beg your pardon," said Alice very humbly, "you had got to the fifth bend, I think?"</sentence>
      <sentence>"You insult me by talking such nonsense!" said the Mouse, getting up and walking away.</sentence>
      <sentence>"Please come back and finish your story!"</sentence>
      <sentence>Alice called after it.</sentence>
      <sentence>And the others all joined in chorus, "Yes, please do!"</sentence>
      <sentence>But the Mouse only shook its head impatiently and walked a little quicker.</sentence>
      <sentence>"I wish I had Dinah, our cat, here!" said Alice.</sentence>
      <sentence>This caused a remarkable sensation among the party.</sentence>
      <sentence>Some of the birds hurried off at once, and a Canary called out in a trembling voice, to its children, "Come away, my dears! It's high time you were all in bed!"</sentence>
      <sentence>On various pretexts they all moved off and Alice was soon left alone.</sentence>
      <sentence>"I wish I hadn't mentioned Dinah! Nobody seems to like her down here and I'm sure she's the best cat in the world!"</sentence>
      <sentence>Poor Alice began to cry again, for she felt very lonely and low-spirited.</sentence>
      <sentence>In a little while, however, she again heard a little pattering of footsteps in the distance and she looked up eagerly.</sentence>
      <sentence>IV--THE RABBIT SENDS IN A LITTLE BILL</sentence>
      <sentence>It was the White Rabbit, trotting slowly back again and looking anxiously about as it went, as if it had lost something; Alice heard it muttering to itself, "The Duchess! The Duchess! Oh, my dear paws! Oh, my fur and whiskers! She'll get me executed, as sure as ferrets are ferrets! Where _can_ I have dropped them, I wonder?"</sentence>
      <sentence>Alice guessed in a moment that it was looking for the fan and the pair of white kid-gloves and she very good-naturedly began hunting about for them, but they were nowhere to be seen--everything seemed to have changed since her swim in the pool, and the great hall, with the glass table and the little door, had vanished completely.</sentence>
      <sentence>Very soon the Rabbit noticed Alice, and called to her, in an angry tone, "Why, Mary Ann, what _are_ you doing out here? Run home this moment and fetch me a pair of gloves and a fan! Quick, now!"</sentence>
      <sentence>"He took me for his housemaid!" said Alice, as she ran off.</sentence>
      <sentence>"How surprised he'll be when he finds out who I am!"</sentence>
      <sentence>As she said this, she came upon a neat little house, on the door of which was a bright brass plate with the name "W. RABBIT" engraved upon it.</sentence>
      <sentence>She went in without knocking and hurried upstairs, in great fear lest she should meet the real Mary Ann and be turned out of the house before she had found the fan and gloves.</sentence>
      <sentence>By this time, Alice had found her way into a tidy little room with a table in the window, and on it a fan and two or three pairs of tiny white kid-gloves; she took up the fan and a pair of the gloves and was just going to leave the room, when her eyes fell upon a little bottle that stood near the looking-glass.</sentence>
      <sentence>She uncorked it and put it to her lips, saying to herself, "I do hope it'll make me grow large again, for, really, I'm quite tired of being such a tiny little thing!"</sentence>
      <sentence>Before she had drunk half the bottle, she found her head pressing against the ceiling, and had to stoop to save her neck from being broken.</sentence>
      <sentence>She hastily put down the bottle, remarking, "That's quite enough--I hope I sha'n't grow any more."</sentence>
      <sentence>Alas!</sentence>
      <sentence>It was too late to wish that!</sentence>
      <sentence>She went on growing and growing and very soon she had to kneel down on the floor.</sentence>
      <sentence>Still she went on growing, and, as a last resource, she put one arm out of the window and one foot up the chimney, and said to herself, "Now I can do no more, whatever happens. What _will_ become of me?"</sentence>
      <sentence>Luckily for Alice, the little magic bottle had now had its full effect and she grew no larger.</sentence>
      <sentence>After a few minutes she heard a voice outside and stopped to listen.</sentence>
      <sentence>"Mary Ann! Mary Ann!" said the voice.</sentence>
      <sentence>"Fetch me my gloves this moment!"</sentence>
      <sentence>Then came a little pattering of feet on the stairs.</sentence>
      <sentence>Alice knew it was the Rabbit coming to look for her and she trembled till she shook the house, quite forgetting that she was now about a thousand times as large as the Rabbit and had no reason to be afraid of it.</sentence>
      <sentence>Presently the Rabbit came up to the door and tried to open it; but as the door opened inwards and Alice's elbow was pressed hard against it, that attempt proved a failure.</sentence>
      <sentence>Alice heard it say to itself, "Then I'll go 'round and get in at the window."</sentence>
      <sentence>"_That_ you won't!" thought Alice; and after waiting till she fancied she heard the Rabbit just under the window, she suddenly spread out her hand and made a snatch in the air.</sentence>
      <sentence>She did not get hold of anything, but she heard a little shriek and a fall and a crash of broken glass, from which she concluded that it was just possible it had fallen into a cucumber-frame or something of that sort.</sentence>
      <sentence>Next came an angry voice--the Rabbit's--"Pat! Pat! Where are you?"</sentence>
      <sentence>And then a voice she had never heard before, "Sure then, I'm here! Digging for apples, yer honor!"</sentence>
      <sentence>"Here! Come and help me out of this! Now tell me, Pat, what's that in the window?"</sentence>
      <sentence>"Sure, it's an arm, yer honor!"</sentence>
      <sentence>"Well, it's got no business there, at any rate; go and take it away!"</sentence>
      <sentence>There was a long silence after this and Alice could only hear whispers now and then, and at last she spread out her hand again and made another snatch in the air.</sentence>
      <sentence>This time there were _two_ little shrieks and more sounds of broken glass.</sentence>
      <sentence>"I wonder what they'll do next!" thought Alice.</sentence>
      <sentence>"As for pulling me out of the window, I only wish they _could_!"</sentence>
      <sentence>She waited for some time without hearing anything more.</sentence>
      <sentence>At last came a rumbling of little cart-wheels and the sound of a good many voices all talking together.</sentence>
      <sentence>She made out the words: "Where's the other ladder? Bill's got the other--Bill! Here, Bill! Will the roof bear?--Who's to go down the chimney?--Nay, _I_ sha'n't! _You_ do it! Here, Bill! The master says you've got to go down the chimney!"</sentence>
      <sentence>Alice drew her foot as far down the chimney as she could and waited till she heard a little animal scratching and scrambling about in the chimney close above her; then she gave one sharp kick and waited to see what would happen next.</sentence>
      <sentence>The first thing she heard was a general chorus of "There goes Bill!" then the Rabbit's voice alone--"Catch him, you by the hedge!"</sentence>
      <sentence>Then silence and then another confusion of voices--"Hold up his head--Brandy now--Don't choke him--What happened to you?"</sentence>
      <sentence>Last came a little feeble, squeaking voice, "Well, I hardly know--No more, thank ye. I'm better now--all I know is, something comes at me like a Jack-in-the-box and up I goes like a sky-rocket!"</sentence>
      <sentence>After a minute or two of silence, they began moving about again, and Alice heard the Rabbit say, "A barrowful will do, to begin with."</sentence>
      <sentence>"A barrowful of _what_?" thought Alice.</sentence>
      <sentence>But she had not long to doubt, for the next moment a shower of little pebbles came rattling in at the window and some of them hit her in the face.</sentence>
      <sentence>Alice noticed, with some surprise, that the pebbles were all turning into little cakes as they lay on the floor and a bright idea came into her head.</sentence>
      <sentence>"If I eat one of these cakes," she thought, "it's sure to make _some_ change in my size."</sentence>
      <sentence>So she swallowed one of the cakes and was delighted to find that she began shrinking directly.</sentence>
      <sentence>As soon as she was small enough to get through the door, she ran out of the house and found quite a crowd of little animals and birds waiting outside.</sentence>
      <sentence>They all made a rush at Alice the moment she appeared, but she ran off as hard as she could and soon found herself safe in a thick wood.</sentence>
      <sentence>"The first thing I've got to do," said Alice to herself, as she wandered about in the wood, "is to grow to my right size again; and the second thing is to find my way into that lovely garden. I suppose I ought to eat or drink something or other, but the great question is 'What?'"</sentence>
      <sentence>Alice looked all around her at the flowers and the blades of grass, but she could not see anything that looked like the right thing to eat or drink under the circumstances.</sentence>
      <sentence>There was a large mushroom growing near her, about the same height as herself.</sentence>
      <sentence>She stretched herself up on tiptoe and peeped over the edge and her eyes immediately met those of a large blue caterpillar, that was sitting on the top, with its arms folded, quietly smoking a long hookah and taking not the smallest notice of her or of anything else.</sentence>
      <sentence>V--ADVICE FROM A CATERPILLAR</sentence>
      <sentence>At last the Caterpillar took the hookah out of its mouth and addressed Alice in a languid, sleepy voice.</sentence>
      <sentence>"Who are _you_?" said the Caterpillar.</sentence>
      <sentence>Alice replied, rather shyly, "I--I hardly know, sir, just at present--at least I know who I _was_ when I got up this morning, but I think I must have changed several times since then."</sentence>
      <sentence>"What do you mean by that?" said the Caterpillar, sternly.</sentence>
      <sentence>"Explain yourself!"</sentence>
      <sentence>"I can't explain _myself_, I'm afraid, sir," said Alice, "because I'm not myself, you see--being so many different sizes in a day is very confusing."</sentence>
      <sentence>She drew herself up and said very gravely, "I think you ought to tell me who _you_ are, first."</sentence>
      <sentence>"Why?" said the Caterpillar.</sentence>
      <sentence>As Alice could not think of any good reason and the Caterpillar seemed to be in a _very_ unpleasant state of mind, she turned away.</sentence>
      <sentence>"Come back!" the Caterpillar called after her.</sentence>
      <sentence>"I've something important to say!"</sentence>
      <sentence>Alice turned and came back again.</sentence>
      <sentence>"Keep your temper," said the Caterpillar.</sentence>
      <sentence>"Is that all?" said Alice, swallowing down her anger as well as she could.</sentence>
      <sentence>"No," said the Caterpillar.</sentence>
      <sentence>It unfolded its arms, took the hookah out of its mouth again, and said, "So you think you're changed, do you?"</sentence>
      <sentence>"I'm afraid, I am, sir," said Alice.</sentence>
      <sentence>"I can't remember things as I used--and I don't keep the same size for ten minutes together!"</sentence>
      <sentence>"What size do you want to be?" asked the Caterpillar.</sentence>
      <sentence>"Oh, I'm not particular as to size," Alice hastily replied, "only one doesn't like changing so often, you know. I should like to be a _little_ larger, sir, if you wouldn't mind," said Alice.</sentence>
      <sentence>"Three inches is such a wretched height to be."</sentence>
      <sentence>"It is a very good height indeed!" said the Caterpillar angrily, rearing itself upright as it spoke (it was exactly three inches high).</sentence>
      <sentence>In a minute or two, the Caterpillar got down off the mushroom and crawled away into the grass, merely remarking, as it went, "One side will make you grow taller, and the other side will make you grow shorter."</sentence>
      <sentence>"One side of _what_? The other side of _what_?" thought Alice to herself.</sentence>
      <sentence>"Of the mushroom," said the Caterpillar, just as if she had asked it aloud; and in another moment, it was out of sight.</sentence>
      <sentence>Alice remained looking thoughtfully at the mushroom for a minute, trying to make out which were the two sides of it.</sentence>
      <sentence>At last she stretched her arms 'round it as far as they would go, and broke off a bit of the edge with each hand.</sentence>
      <sentence>"And now which is which?" she said to herself, and nibbled a little of the right-hand bit to try the effect.</sentence>
      <sentence>The next moment she felt a violent blow underneath her chin--it had struck her foot!</sentence>
      <sentence>She was a good deal frightened by this very sudden change, as she was shrinking rapidly; so she set to work at once to eat some of the other bit.</sentence>
      <sentence>Her chin was pressed so closely against her foot that there was hardly room to open her mouth; but she did it at last and managed to swallow a morsel of the left-hand bit....</sentence>
      <sentence>"Come, my head's free at last!" said Alice; but all she could see, when she looked down, was an immense length of neck, which seemed to rise like a stalk out of a sea of green leaves that lay far below her.</sentence>
      <sentence>"Where _have_ my shoulders got to? And oh, my poor hands, how is it I can't see you?"</sentence>
      <sentence>She was delighted to find that her neck would bend about easily in any direction, like a serpent.</sentence>
      <sentence>She had just succeeded in curving it down into a graceful zigzag and was going to dive in among the leaves, when a sharp hiss made her draw back in a hurry--a large pigeon had flown into her face and was beating her violently with its wings.</sentence>
      <sentence>"Serpent!" cried the Pigeon.</sentence>
      <sentence>"I'm _not_ a serpent!" said Alice indignantly.</sentence>
      <sentence>"Let me alone!"</sentence>
      <sentence>"I've tried the roots of trees, and I've tried banks, and I've tried hedges," the Pigeon went on, "but those serpents! There's no pleasing them!"</sentence>
      <sentence>Alice was more and more puzzled.</sentence>
      <sentence>"As if it wasn't trouble enough hatching the eggs," said the Pigeon, "but I must be on the look-out for serpents, night and day! And just as I'd taken the highest tree in the wood," continued the Pigeon, raising its voice to a shriek, "and just as I was thinking I should be free of them at last, they must needs come wriggling down from the sky! Ugh, Serpent!"</sentence>
      <sentence>"But I'm _not_ a serpent, I tell you!" said Alice.</sentence>
      <sentence>"I'm a--I'm a--I'm a little girl," she added rather doubtfully, as she remembered the number of changes she had gone through that day.</sentence>
      <sentence>"You're looking for eggs, I know _that_ well enough," said the Pigeon; "and what does it matter to me whether you're a little girl or a serpent?"</sentence>
      <sentence>"It matters a good deal to _me_," said Alice hastily; "but I'm not looking for eggs, as it happens, and if I was, I shouldn't want _yours_--I don't like them raw."</sentence>
      <sentence>"Well, be off, then!" said the Pigeon in a sulky tone, as it settled down again into its nest.</sentence>
      <sentence>Alice crouched down among the trees as well as she could, for her neck kept getting entangled among the branches, and every now and then she had to stop and untwist it.</sentence>
      <sentence>After awhile she remembered that she still held the pieces of mushroom in her hands, and she set to work very carefully, nibbling first at one and then at the other, and growing sometimes taller and sometimes shorter, until she had succeeded in bringing herself down to her usual height.</sentence>
      <sentence>It was so long since she had been anything near the right size that it felt quite strange at first.</sentence>
      <sentence>"The next thing is to get into that beautiful garden--how _is_ that to be done, I wonder?"</sentence>
      <sentence>As she said this, she came suddenly upon an open place, with a little house in it about four feet high.</sentence>
      <sentence>"Whoever lives there," thought Alice, "it'll never do to come upon them _this_ size; why, I should frighten them out of their wits!"</sentence>
      <sentence>She did not venture to go near the house till she had brought herself down to nine inches high.</sentence>
      <sentence>VI--PIG AND PEPPER</sentence>
      <sentence>For a minute or two she stood looking at the house, when suddenly a footman in livery came running out of the wood (judging by his face only, she would have called him a fish)--and rapped loudly at the door with his knuckles.</sentence>
      <sentence>It was opened by another footman in livery, with a round face and large eyes like a frog.</sentence>
      <sentence>The Fish-Footman began by producing from under his arm a great letter, and this he handed over to the other, saying, in a solemn tone, "For the Duchess. An invitation from the Queen to play croquet."</sentence>
      <sentence>The Frog-Footman repeated, in the same solemn tone, "From the Queen. An invitation for the Duchess to play croquet."</sentence>
      <sentence>Then they both bowed low and their curls got entangled together.</sentence>
      <sentence>When Alice next peeped out, the Fish-Footman was gone, and the other was sitting on the ground near the door, staring stupidly up into the sky.</sentence>
      <sentence>Alice went timidly up to the door and knocked.</sentence>
      <sentence>"There's no sort of use in knocking," said the Footman, "and that for two reasons. First, because I'm on the same side of the door as you are; secondly, because they're making such a noise inside, no one could possibly hear you."</sentence>
      <sentence>And certainly there _was_ a most extraordinary noise going on within--a constant howling and sneezing, and every now and then a great crash, as if a dish or kettle had been broken to pieces.</sentence>
      <sentence>"How am I to get in?" asked Alice.</sentence>
      <sentence>"_Are_ you to get in at all?" said the Footman.</sentence>
      <sentence>"That's the first question, you know."</sentence>
      <sentence>Alice opened the door and went in.</sentence>
      <sentence>The door led right into a large kitchen, which was full of smoke from one end to the other; the Duchess was sitting on a three-legged stool in the middle, nursing a baby; the cook was leaning over the fire, stirring a large caldron which seemed to be full of soup.</sentence>
      <sentence>"There's certainly too much pepper in that soup!"</sentence>
      <sentence>Alice said to herself, as well as she could for sneezing.</sentence>
      <sentence>Even the Duchess sneezed occasionally; and as for the baby, it was sneezing and howling alternately without a moment's pause.</sentence>
      <sentence>The only two creatures in the kitchen that did _not_ sneeze were the cook and a large cat, which was grinning from ear to ear.</sentence>
      <sentence>"Please would you tell me," said Alice, a little timidly, "why your cat grins like that?"</sentence>
      <sentence>"It's a Cheshire-Cat," said the Duchess, "and that's why."</sentence>
      <sentence>"I didn't know that Cheshire-Cats always grinned; in fact, I didn't know that cats _could_ grin," said Alice.</sentence>
      <sentence>"You don't know much," said the Duchess, "and that's a fact."</sentence>
      <sentence>Just then the cook took the caldron of soup off the fire, and at once set to work throwing everything within her reach at the Duchess and the baby--the fire-irons came first; then followed a shower of saucepans, plates and dishes.</sentence>
      <sentence>The Duchess took no notice of them, even when they hit her, and the baby was howling so much already that it was quite impossible to say whether the blows hurt it or not.</sentence>
      <sentence>"Oh, _please_ mind what you're doing!" cried Alice, jumping up and down in an agony of terror.</sentence>
      <sentence>"Here! You may nurse it a bit, if you like!" the Duchess said to Alice, flinging the baby at her as she spoke.</sentence>
      <sentence>"I must go and get ready to play croquet with the Queen," and she hurried out of the room.</sentence>
      <sentence>Alice caught the baby with some difficulty, as it was a queer-shaped little creature and held out its arms and legs in all directions.</sentence>
      <sentence>"If I don't take this child away with me," thought Alice, "they're sure to kill it in a day or two. Wouldn't it be murder to leave it behind?"</sentence>
      <sentence>She said the last words out loud and the little thing grunted in reply.</sentence>
      <sentence>"If you're going to turn into a pig, my dear," said Alice, "I'll have nothing more to do with you. Mind now!"</sentence>
      <sentence>Alice was just beginning to think to herself, "Now, what am I to do with this creature, when I get it home?" when it grunted again so violently that Alice looked down into its face in some alarm.</sentence>
      <sentence>This time there could be _no_ mistake about it--it was neither more nor less than a pig; so she set the little creature down and felt quite relieved to see it trot away quietly into the wood.</sentence>
      <sentence>Alice was a little startled by seeing the Cheshire-Cat sitting on a bough of a tree a few yards off.</sentence>
      <sentence>The Cat only grinned when it saw her.</sentence>
      <sentence>"Cheshire-Puss," began Alice, rather timidly, "would you please tell me which way I ought to go from here?"</sentence>
      <sentence>"In _that_ direction," the Cat said, waving the right paw 'round, "lives a Hatter; and in _that_ direction," waving the other paw, "lives a March Hare. Visit either you like; they're both mad."</sentence>
      <sentence>"But I don't want to go among mad people," Alice remarked.</sentence>
      <sentence>"Oh, you can't help that," said the Cat; "we're all mad here. Do you play croquet with the Queen to-day?"</sentence>
      <sentence>"I should like it very much," said Alice, "but I haven't been invited yet."</sentence>
      <sentence>"You'll see me there," said the Cat, and vanished.</sentence>
      <sentence>Alice had not gone much farther before she came in sight of the house of the March Hare; it was so large a house that she did not like to go near till she had nibbled some more of the left-hand bit of mushroom.</sentence>
      <sentence>VII--A MAD TEA-PARTY</sentence>
      <sentence>There was a table set out under a tree in front of the house, and the March Hare and the Hatter were having tea at it; a Dormouse was sitting between them, fast asleep.</sentence>
      <sentence>The table was a large one, but the three were all crowded together at one corner of it.</sentence>
      <sentence>"No room! No room!" they cried out when they saw Alice coming.</sentence>
      <sentence>"There's _plenty_ of room!" said Alice indignantly, and she sat down in a large arm-chair at one end of the table.</sentence>
      <sentence>The Hatter opened his eyes very wide on hearing this, but all he said was "Why is a raven like a writing-desk?"</sentence>
      <sentence>"I'm glad they've begun asking riddles--I believe I can guess that," she added aloud.</sentence>
      <sentence>"Do you mean that you think you can find out the answer to it?" said the March Hare.</sentence>
      <sentence>"Exactly so," said Alice.</sentence>
      <sentence>"Then you should say what you mean," the March Hare went on.</sentence>
      <sentence>"I do," Alice hastily replied; "at least--at least I mean what I say--that's the same thing, you know."</sentence>
      <sentence>"You might just as well say," added the Dormouse, which seemed to be talking in its sleep, "that 'I breathe when I sleep' is the same thing as 'I sleep when I breathe!'"</sentence>
      <sentence>"It _is_ the same thing with you," said the Hatter, and he poured a little hot tea upon its nose.</sentence>
      <sentence>The Dormouse shook its head impatiently and said, without opening its eyes, "Of course, of course; just what I was going to remark myself."</sentence>
      <sentence>"Have you guessed the riddle yet?" the Hatter said, turning to Alice again.</sentence>
      <sentence>"No, I give it up," Alice replied.</sentence>
      <sentence>"What's the answer?"</sentence>
      <sentence>"I haven't the slightest idea," said the Hatter.</sentence>
      <sentence>"Nor I," said the March Hare.</sentence>
      <sentence>Alice gave a weary sigh.</sentence>
      <sentence>"I think you might do something better with the time," she said, "than wasting it in asking riddles that have no answers."</sentence>
      <sentence>"Take some more tea," the March Hare said to Alice, very earnestly.</sentence>
      <sentence>"I've had nothing yet," Alice replied in an offended tone, "so I can't take more."</sentence>
      <sentence>"You mean you can't take _less_," said the Hatter; "it's very easy to take _more_ than nothing."</sentence>
      <sentence>At this, Alice got up and walked off.</sentence>
      <sentence>The Dormouse fell asleep instantly and neither of the others took the least notice of her going, though she looked back once or twice; the last time she saw them, they were trying to put the Dormouse into the tea-pot.</sentence>
      <sentence>"At any rate, I'll never go _there_ again!" said Alice, as she picked her way through the wood.</sentence>
      <sentence>"It's the stupidest tea-party I ever was at in all my life!"</sentence>
      <sentence>Just as she said this, she noticed that one of the trees had a door leading right into it.</sentence>
      <sentence>"That's very curious!" she thought.</sentence>
      <sentence>"I think I may as well go in at once."</sentence>
      <sentence>And in she went.</sentence>
      <sentence>Once more she found herself in the long hall and close to the little glass table.</sentence>
      <sentence>Taking the little golden key, she unlocked the door that led into the garden.</sentence>
      <sentence>Then she set to work nibbling at the mushroom (she had kept a piece of it in her pocket) till she was about a foot high; then she walked down the little passage; and _then_--she found herself at last in the beautiful garden, among the bright flower-beds and the cool fountains.</sentence>
      <sentence>VIII--THE QUEEN'S CROQUET GROUND</sentence>
      <sentence>A large rose-tree stood near the entrance of the garden; the roses growing on it were white, but there were three gardeners at it, busily painting them red.</sentence>
      <sentence>Suddenly their eyes chanced to fall upon Alice, as she stood watching them.</sentence>
      <sentence>"Would you tell me, please," said Alice, a little timidly, "why you are painting those roses?"</sentence>
      <sentence>Five and Seven said nothing, but looked at Two.</sentence>
      <sentence>Two began, in a low voice, "Why, the fact is, you see, Miss, this here ought to have been a _red_ rose-tree, and we put a white one in by mistake; and, if the Queen was to find it out, we should all have our heads cut off, you know. So you see, Miss, we're doing our best, afore she comes, to--"</sentence>
      <sentence>At this moment, Five, who had been anxiously looking across the garden, called out, "The Queen! The Queen!" and the three gardeners instantly threw themselves flat upon their faces.</sentence>
      <sentence>There was a sound of many footsteps and Alice looked 'round, eager to see the Queen.</sentence>
      <sentence>First came ten soldiers carrying clubs, with their hands and feet at the corners: next the ten courtiers; these were ornamented all over with diamonds.</sentence>
      <sentence>After these came the royal children; there were ten of them, all ornamented with hearts.</sentence>
      <sentence>Next came the guests, mostly Kings and Queens, and among them Alice recognized the White Rabbit.</sentence>
      <sentence>Then followed the Knave of Hearts, carrying the King's crown on a crimson velvet cushion; and last of all this grand procession came THE KING AND THE QUEEN OF HEARTS.</sentence>
      <sentence>When the procession came opposite to Alice, they all stopped and looked at her, and the Queen said severely, "Who is this?"</sentence>
      <sentence>She said it to the Knave of Hearts, who only bowed and smiled in reply.</sentence>
      <sentence>"My name is Alice, so please Your Majesty," said Alice very politely; but she added to herself, "Why, they're only a pack of cards, after all!"</sentence>
      <sentence>"Can you play croquet?" shouted the Queen.</sentence>
      <sentence>The question was evidently meant for Alice.</sentence>
      <sentence>"Yes!" said Alice loudly.</sentence>
      <sentence>"Come on, then!" roared the Queen.</sentence>
      <sentence>"It's--it's a very fine day!" said a timid voice to Alice.</sentence>
      <sentence>She was walking by the White Rabbit, who was peeping anxiously into her face.</sentence>
      <sentence>"Very," said Alice.</sentence>
      <sentence>"Where's the Duchess?"</sentence>
      <sentence>"Hush! Hush!" said the Rabbit.</sentence>
      <sentence>"She's under sentence of execution."</sentence>
      <sentence>"What for?" said Alice.</sentence>
      <sentence>"She boxed the Queen's ears--" the Rabbit began.</sentence>
      <sentence>"Get to your places!" shouted the Queen in a voice of thunder, and people began running about in all directions, tumbling up against each other.</sentence>
      <sentence>However, they got settled down in a minute or two, and the game began.</sentence>
      <sentence>Alice thought she had never seen such a curious croquet-ground in her life; it was all ridges and furrows.</sentence>
      <sentence>The croquet balls were live hedgehogs, and the mallets live flamingos and the soldiers had to double themselves up and stand on their hands and feet, to make the arches.</sentence>
      <sentence>The players all played at once, without waiting for turns, quarrelling all the while and fighting for the hedgehogs; and in a very short time, the Queen was in a furious passion and went stamping about and shouting, "Off with his head!" or "Off with her head!" about once in a minute.</sentence>
      <sentence>"They're dreadfully fond of beheading people here," thought Alice; "the great wonder is that there's anyone left alive!"</sentence>
      <sentence>She was looking about for some way of escape, when she noticed a curious appearance in the air.</sentence>
      <sentence>"It's the Cheshire-Cat," she said to herself; "now I shall have somebody to talk to."</sentence>
      <sentence>"How are you getting on?" said the Cat.</sentence>
      <sentence>"I don't think they play at all fairly," Alice said, in a rather complaining tone; "and they all quarrel so dreadfully one can't hear oneself speak--and they don't seem to have any rules in particular."</sentence>
      <sentence>"How do you like the Queen?" said the Cat in a low voice.</sentence>
      <sentence>"Not at all," said Alice.</sentence>
      <sentence>Alice thought she might as well go back and see how the game was going on.</sentence>
      <sentence>So she went off in search of her hedgehog.</sentence>
      <sentence>The hedgehog was engaged in a fight with another hedgehog, which seemed to Alice an excellent opportunity for croqueting one of them with the other; the only difficulty was that her flamingo was gone across to the other side of the garden, where Alice could see it trying, in a helpless sort of way, to fly up into a tree.</sentence>
      <sentence>She caught the flamingo and tucked it away under her arm, that it might not escape again.</sentence>
      <sentence>Just then Alice ran across the Duchess (who was now out of prison).</sentence>
      <sentence>She tucked her arm affectionately into Alice's and they walked off together.</sentence>
      <sentence>Alice was very glad to find her in such a pleasant temper.</sentence>
      <sentence>She was a little startled, however, when she heard the voice of the Duchess close to her ear.</sentence>
      <sentence>"You're thinking about something, my dear, and that makes you forget to talk."</sentence>
      <sentence>"The game's going on rather better now," Alice said, by way of keeping up the conversation a little.</sentence>
      <sentence>"'Tis so," said the Duchess; "and the moral of that is--'Oh, 'tis love, 'tis love that makes the world go 'round!'"</sentence>
      <sentence>"Somebody said," Alice whispered, "that it's done by everybody minding his own business!"</sentence>
      <sentence>"Ah, well! It means much the same thing," said the Duchess, digging her sharp little chin into Alice's shoulder, as she added "and the moral of _that_ is--'Take care of the sense and the sounds will take care of themselves.'"</sentence>
      <sentence>To Alice's great surprise, the Duchess's arm that was linked into hers began to tremble.</sentence>
      <sentence>Alice looked up and there stood the Queen in front of them, with her arms folded, frowning like a thunderstorm!</sentence>
      <sentence>"Now, I give you fair warning," shouted the Queen, stamping on the ground as she spoke, "either you or your head must be off, and that in about half no time. Take your choice!"</sentence>
      <sentence>The Duchess took her choice, and was gone in a moment.</sentence>
      <sentence>"Let's go on with the game," the Queen said to Alice; and Alice was too much frightened to say a word, but slowly followed her back to the croquet-ground.</sentence>
      <sentence>All the time they were playing, the Queen never left off quarreling with the other players and shouting, "Off with his head!" or "Off with her head!"</sentence>
      <sentence>By the end of half an hour or so, all the players, except the King, the Queen and Alice, were in custody of the soldiers and under sentence of execution.</sentence>
      <sentence>Then the Queen left off, quite out of breath, and walked away with Alice.</sentence>
      <sentence>Alice heard the King say in a low voice to the company generally, "You are all pardoned."</sentence>
      <sentence>Suddenly the cry "The Trial's beginning!" was heard in the distance, and Alice ran along with the others.</sentence>
      <sentence>IX--WHO STOLE THE TARTS?</sentence>
      <sentence>The King and Queen of Hearts were seated on their throne when they arrived, with a great crowd assembled about them--all sorts of little birds and beasts, as well as the whole pack of cards: the Knave was standing before them, in chains, with a soldier on each side to guard him; and near the King was the White Rabbit, with a trumpet in one hand and a scroll of parchment in the other.</sentence>
      <sentence>In the very middle of the court was a table, with a large dish of tarts upon it.</sentence>
      <sentence>"I wish they'd get the trial done," Alice thought, "and hand 'round the refreshments!"</sentence>
      <sentence>The judge, by the way, was the King and he wore his crown over his great wig.</sentence>
      <sentence>"That's the jury-box," thought Alice; "and those twelve creatures (some were animals and some were birds) I suppose they are the jurors."</sentence>
      <sentence>Just then the White Rabbit cried out "Silence in the court!"</sentence>
      <sentence>"Herald, read the accusation!" said the King.</sentence>
      <sentence>On this, the White Rabbit blew three blasts on the trumpet, then unrolled the parchment-scroll and read as follows:</sentence>
      <sentence>"Call the first witness," said the King; and the White Rabbit blew three blasts on the trumpet and called out, "First witness!"</sentence>
      <sentence>The first witness was the Hatter.</sentence>
      <sentence>He came in with a teacup in one hand and a piece of bread and butter in the other.</sentence>
      <sentence>"You ought to have finished," said the King.</sentence>
      <sentence>"When did you begin?"</sentence>
      <sentence>The Hatter looked at the March Hare, who had followed him into the court, arm in arm with the Dormouse.</sentence>
      <sentence>"Fourteenth of March, I _think_ it was," he said.</sentence>
      <sentence>"Give your evidence," said the King, "and don't be nervous, or I'll have you executed on the spot."</sentence>
      <sentence>This did not seem to encourage the witness at all; he kept shifting from one foot to the other, looking uneasily at the Queen, and, in his confusion, he bit a large piece out of his teacup instead of the bread and butter.</sentence>
      <sentence>Just at this moment Alice felt a very curious sensation--she was beginning to grow larger again.</sentence>
      <sentence>The miserable Hatter dropped his teacup and bread and butter and went down on one knee.</sentence>
      <sentence>"I'm a poor man, Your Majesty," he began.</sentence>
      <sentence>"You're a _very_ poor _speaker_," said the King.</sentence>
      <sentence>"You may go," said the King, and the Hatter hurriedly left the court.</sentence>
      <sentence>"Call the next witness!" said the King.</sentence>
      <sentence>The next witness was the Duchess's cook.</sentence>
      <sentence>She carried the pepper-box in her hand and the people near the door began sneezing all at once.</sentence>
      <sentence>"Give your evidence," said the King.</sentence>
      <sentence>"Sha'n't," said the cook.</sentence>
      <sentence>The King looked anxiously at the White Rabbit, who said, in a low voice, "Your Majesty must cross-examine _this_ witness."</sentence>
      <sentence>"Well, if I must, I must," the King said.</sentence>
      <sentence>"What are tarts made of?"</sentence>
      <sentence>"Pepper, mostly," said the cook.</sentence>
      <sentence>For some minutes the whole court was in confusion and by the time they had settled down again, the cook had disappeared.</sentence>
      <sentence>"Never mind!" said the King, "call the next witness."</sentence>
      <sentence>Alice watched the White Rabbit as he fumbled over the list.</sentence>
      <sentence>Imagine her surprise when he read out, at the top of his shrill little voice, the name "Alice!"</sentence>
      <sentence>X--ALICE'S EVIDENCE</sentence>
      <sentence>"Here!" cried Alice.</sentence>
      <sentence>She jumped up in such a hurry that she tipped over the jury-box, upsetting all the jurymen on to the heads of the crowd below.</sentence>
      <sentence>"Oh, I _beg_ your pardon!" she exclaimed in a tone of great dismay.</sentence>
      <sentence>"The trial cannot proceed," said the King, "until all the jurymen are back in their proper places--_all_," he repeated with great emphasis, looking hard at Alice.</sentence>
      <sentence>"What do you know about this business?" the King said to Alice.</sentence>
      <sentence>"Nothing whatever," said Alice.</sentence>
      <sentence>The King then read from his book: "Rule forty-two. _All persons more than a mile high to leave the court_."</sentence>
      <sentence>"_I'm_ not a mile high," said Alice.</sentence>
      <sentence>"Nearly two miles high," said the Queen.</sentence>
      <sentence>"Well, I sha'n't go, at any rate," said Alice.</sentence>
      <sentence>The King turned pale and shut his note-book hastily.</sentence>
      <sentence>"Consider your verdict," he said to the jury, in a low, trembling voice.</sentence>
      <sentence>"There's more evidence to come yet, please Your Majesty," said the White Rabbit, jumping up in a great hurry.</sentence>
      <sentence>"This paper has just been picked up. It seems to be a letter written by the prisoner to--to somebody."</sentence>
      <sentence>He unfolded the paper as he spoke and added, "It isn't a letter, after all; it's a set of verses."</sentence>
      <sentence>"Please, Your Majesty," said the Knave, "I didn't write it and they can't prove that I did; there's no name signed at the end."</sentence>
      <sentence>"You _must_ have meant some mischief, or else you'd have signed your name like an honest man," said the King.</sentence>
      <sentence>There was a general clapping of hands at this.</sentence>
      <sentence>"Read them," he added, turning to the White Rabbit.</sentence>
      <sentence>There was dead silence in the court whilst the White Rabbit read out the verses.</sentence>
      <sentence>"That's the most important piece of evidence we've heard yet," said the King.</sentence>
      <sentence>"_I_ don't believe there's an atom of meaning in it," ventured Alice.</sentence>
      <sentence>"If there's no meaning in it," said the King, "that saves a world of trouble, you know, as we needn't try to find any. Let the jury consider their verdict."</sentence>
      <sentence>"No, no!" said the Queen.</sentence>
      <sentence>"Sentence first--verdict afterwards."</sentence>
      <sentence>"Stuff and nonsense!" said Alice loudly.</sentence>
      <sentence>"The idea of having the sentence first!"</sentence>
      <sentence>"Hold your tongue!" said the Queen, turning purple.</sentence>
      <sentence>"I won't!" said Alice.</sentence>
      <sentence>"Off with her head!" the Queen shouted at the top of her voice.</sentence>
      <sentence>Nobody moved.</sentence>
      <sentence>"Who cares for _you_?" said Alice (she had grown to her full size by this time).</sentence>
      <sentence>"You're nothing but a pack of cards!"</sentence>
      <sentence>At this, the whole pack rose up in the air and came flying down upon her; she gave a little scream, half of fright and half of anger, and tried to beat them off, and found herself lying on the bank, with her head in the lap of her sister, who was gently brushing away some dead leaves that had fluttered down from the trees upon her face.</sentence>
      <sentence>"Wake up, Alice dear!" said her sister.</sentence>
      <sentence>"Why, what a long sleep you've had!"</sentence>
      <sentence>"Oh, I've had such a curious dream!" said Alice.</sentence>
      <sentence>And she told her sister, as well as she could remember them, all these strange adventures of hers that you have just been reading about.</sentence>
      <sentence>Alice got up and ran off, thinking while she ran, as well she might, what a wonderful dream it had been.</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>
      Furthermore, two development trends in NLP pose new challenges for SBD, viz. (a) a shift of emphasis from formal, edited text towards more spontaneous language samples, e.g. Web content; and (b) a gradual move from ‘bare’ ASCII to rich text, exploiting the much wider Unicode character range as well as mark-up of text structure. The impact of such textual variation on SBD is hardly explored, and off-the-shelf technologies may perform poorly on text that is not very newswire-like, i.e. different from the venerable Wall Street Journal (WSJ) collection of the Penn Treebank (PTB; Marcus et al., 1993).
    </input>
    <expected>
      <sentence>Furthermore, two development trends in NLP pose new challenges for SBD, viz. (a) a shift of emphasis from formal, edited text towards more spontaneous language samples, e.g. Web content; and (b) a gradual move from ‘bare’ ASCII to rich text, exploiting the much wider Unicode character range as well as mark-up of text structure.</sentence>
      <sentence>The impact of such textual variation on SBD is hardly explored, and off-the-shelf technologies may perform poorly on text that is not very newswire-like, i.e. different from the venerable Wall Street Journal (WSJ) collection of the Penn Treebank (PTB; Marcus et al., 1993).</sentence>
    </expected>
  </test>
  <test>
    <input>Unlike the abbreviations i.e. and e.g., viz. is used to indicate a detailed description of something stated before.</input>
    <expected>
      <sentence>Unlike the abbreviations i.e. and e.g., viz. is used to indicate a detailed description of something stated before.</sentence>
    </expected>
  </test>
  <test>
    <input>
      Located at the junction of the Missouri, Illinois and Mississippi Rivers, St. Louis was a major port and commercial center with a rapidly growing industrial base by the time of the Civil War. The population reached 160,000 in 1860 and consisted mostly of recent immigrants, especially Catholic German Americans and Irish Americans. Early Union volunteer regiments in St. Louis were composed largely of the dominant German immigrants.
      The only major city west of the Mississippi River in the geographic center of the country, St. Louis had also emerged as the gateway to the new American frontier. It had long served as the starting point for voyages of exploration and emigration into the unsettled West and as the westernmost terminus of many early efforts to construct transcontinental lines of transportation and communication.
    </input>
    <expected>
      <sentence>Located at the junction of the Missouri, Illinois and Mississippi Rivers, St. Louis was a major port and commercial center with a rapidly growing industrial base by the time of the Civil War.</sentence>
      <sentence>The population reached 160,000 in 1860 and consisted mostly of recent immigrants, especially Catholic German Americans and Irish Americans.</sentence>
      <sentence>Early Union volunteer regiments in St. Louis were composed largely of the dominant German immigrants.</sentence>
      <sentence>The only major city west of the Mississippi River in the geographic center of the country, St. Louis had also emerged as the gateway to the new American frontier.</sentence>
      <sentence>It had long served as the starting point for voyages of exploration and emigration into the unsettled West and as the westernmost terminus of many early efforts to construct transcontinental lines of transportation and communication.</sentence>
    </expected>
  </test>
  <test>
    <input>
      The slow-moving storm, at less than 5mph, dumped nearly 4ft of rain on the Big Island and about a foot on Maui before it was downgraded Friday to a tropical storm from a hurricane. The storm was about 110 miles south of Honolulu, but the state’s most populous city was largely spared from any impacts. The National Weather Service recorded about 2.3in of rain on Oahu in a 24-hour period ending early on Saturday. Shops along the famed Waikiki beach in Honolulu were reopening for the tourists. Forecasters had said as much as 10 more inches of rain could fall on parts of Oahu and Maui. “Don’t let your guard down,” Brock Long, administrator of the Federal Emergency Management Agency, said during a telephone briefing early on Saturday in Washington.
    </input>
    <expected>
      <sentence>The slow-moving storm, at less than 5mph, dumped nearly 4ft of rain on the Big Island and about a foot on Maui before it was downgraded Friday to a tropical storm from a hurricane.</sentence>
      <sentence>The storm was about 110 miles south of Honolulu, but the state’s most populous city was largely spared from any impacts.</sentence>
      <sentence>The National Weather Service recorded about 2.3in of rain on Oahu in a 24-hour period ending early on Saturday.</sentence>
      <sentence>Shops along the famed Waikiki beach in Honolulu were reopening for the tourists.</sentence>
      <sentence>Forecasters had said as much as 10 more inches of rain could fall on parts of Oahu and Maui.</sentence>
      <sentence>“Don’t let your guard down,” Brock Long, administrator of the Federal Emergency Management Agency, said during a telephone briefing early on Saturday in Washington.</sentence>
    </expected>
  </test>
  <test>
    <input>“I agree with the young feller,” put in Tall Jim, “and I’ll not go another foot on this car.” That settled it, for Wilson and Hughes fell into our way of thinking also; and for the first time I scored one against Jack Utley, though at the moment it did not enter my head. We had been moving at a fair rate of speed while this talk was going on, and had rounded several sharp curves, blind to what we were to meet beyond them, when my strong protest bore fruit. The car was stopped and dumped over the bank with a “heave ho”; whereupon I came to the fore again, which must have seemed very much the upstart in me, and proposed what next we’d better do.</input>
    <expected>
      <sentence>“I agree with the young feller,” put in Tall Jim, “and I’ll not go another foot on this car.”</sentence>
      <sentence>That settled it, for Wilson and Hughes fell into our way of thinking also; and for the first time I scored one against Jack Utley, though at the moment it did not enter my head.</sentence>
      <sentence>We had been moving at a fair rate of speed while this talk was going on, and had rounded several sharp curves, blind to what we were to meet beyond them, when my strong protest bore fruit.</sentence>
      <sentence>The car was stopped and dumped over the bank with a “heave ho”; whereupon I came to the fore again, which must have seemed very much the upstart in me, and proposed what next we’d better do.</sentence>
    </expected>
  </test>
  <test>
    <input>
      One, Nautilus pompilius, is the most widespread of all the nautiluses across their vast Pacific and Indian Ocean range. The second, Nautilus stenomphalus, is found only on the Great Barrier Reef. It differs from the more common N. pompilius in having a hole right at the center of its shell. (In N. pompilius, there is a thick calcareous plug.) There are also marked differences in shell coloration and pattern of stripes on the shell. But when the Australian species was first brought up from its 1,000-foot habitat alive, in the late 20th century, scientists were astonished to find that N. stenomphalus has markedly different anatomy as well on its thick “hood,” a large fleshy area that protects the interior guts and other anatomical soft parts when the animal pulls into its shell. In N. pompilius the hood is covered with low bumps of flesh, like warts. Meanwhile the N. stenomphalus hood is covered with a forest of brushy projections that rise above the hood like a thick carpet of twiggy moss, or tiny trees of flesh; the coloration of the hood is also radically different.
    </input>
    <expected>
      <sentence>One, Nautilus pompilius, is the most widespread of all the nautiluses across their vast Pacific and Indian Ocean range.</sentence>
      <sentence>The second, Nautilus stenomphalus, is found only on the Great Barrier Reef.</sentence>
      <sentence>It differs from the more common N. pompilius in having a hole right at the center of its shell.</sentence>
      <sentence>(In N. pompilius, there is a thick calcareous plug.)</sentence>
      <sentence>There are also marked differences in shell coloration and pattern of stripes on the shell.</sentence>
      <sentence>But when the Australian species was first brought up from its 1,000-foot habitat alive, in the late 20th century, scientists were astonished to find that N. stenomphalus has markedly different anatomy as well on its thick “hood,” a large fleshy area that protects the interior guts and other anatomical soft parts when the animal pulls into its shell.</sentence>
      <sentence>In N. pompilius the hood is covered with low bumps of flesh, like warts.</sentence>
      <sentence>Meanwhile the N. stenomphalus hood is covered with a forest of brushy projections that rise above the hood like a thick carpet of twiggy moss, or tiny trees of flesh; the coloration of the hood is also radically different.</sentence>
    </expected>
  </test>
  <test>
    <input>
      This is particularly true in mathematics. One of the crowning scientific achievements of the 20th century was the development of set theory as a precise language for all of mathematics, thanks to the efforts of Cantor, Dedekind, Frege, Peano, Russell and Whitehead, Zermelo, Fraenkel, Skolem, Hilbert, von Neumann, Godel, Bernays, Cohen, and others. This achievement has been so important and definitive that it led David Hilbert to say, already in 1925, that “no one will drive us from the paradise which Cantor created for us” (see [47], 367–392, pg. 376). It was of course possible to think mathematically before set theory, but in a considerably more awkward and quite restricted way, because the levels of generality, rigor and abstraction made possible by set theory are much greater than at any other previous time. In fact, many key mathematical concepts we now take for granted, such a those of an abstract group or a topological space, could only be formulated after set theory, precisely because the language needed to conceive and articulate those concepts was not available before
    </input>
    <expected>
      <sentence>This is particularly true in mathematics.</sentence>
      <sentence>One of the crowning scientific achievements of the 20th century was the development of set theory as a precise language for all of mathematics, thanks to the efforts of Cantor, Dedekind, Frege, Peano, Russell and Whitehead, Zermelo, Fraenkel, Skolem, Hilbert, von Neumann, Godel, Bernays, Cohen, and others.</sentence>
      <sentence>This achievement has been so important and definitive that it led David Hilbert to say, already in 1925, that “no one will drive us from the paradise which Cantor created for us” (see [47], 367–392, pg. 376).</sentence>
      <sentence>It was of course possible to think mathematically before set theory, but in a considerably more awkward and quite restricted way, because the levels of generality, rigor and abstraction made possible by set theory are much greater than at any other previous time.</sentence>
      <sentence>In fact, many key mathematical concepts we now take for granted, such a those of an abstract group or a topological space, could only be formulated after set theory, precisely because the language needed to conceive and articulate those concepts was not available before</sentence>
    </expected>
  </test>
  <test>
    <input>The tight turns can be further classified into alpha-turns, beta-turns, gamma-turns, delta-turns, and pi-turns (Rose et al., 1985). Among these tights turns, beta-turns represent the most abundant type in proteins. For example, in the BT6376 (Singh et al., 2015) data set, we found 126,016 beta-turns (9%) out of 1,397,857 amino acids. By definition, a beta-turn contains four consecutive residues (denoted by i, i+1, i+2, i+3) if the distance between the Ca atom of residue i and the Ca atom of residue i+3 is less than 7 Å and if the central two residues are not helical (Lewis et al., 1973)</input>
    <expected>
      <sentence>The tight turns can be further classified into alpha-turns, beta-turns, gamma-turns, delta-turns, and pi-turns (Rose et al., 1985).</sentence>
      <sentence>Among these tights turns, beta-turns represent the most abundant type in proteins.</sentence>
      <sentence>For example, in the BT6376 (Singh et al., 2015) data set, we found 126,016 beta-turns (9%) out of 1,397,857 amino acids.</sentence>
      <sentence>By definition, a beta-turn contains four consecutive residues (denoted by i, i+1, i+2, i+3) if the distance between the Ca atom of residue i and the Ca atom of residue i+3 is less than 7 Å and if the central two residues are not helical (Lewis et al., 1973)</sentence>
    </expected>
  </test>
  <test>
    <input>In One Company Co. v Assurant Maatschappii "De Zeven Provincien" N.V. [1987] 1 AC 24 the defendants to an English action sought an order for production of documents under section 1782 from a court in the United States. The English claimants sought an injunction to restrain the pursuit of this application which succeeded in this court and in the Court of Appeal, but the injunction thus granted was set aside by the House of Lords. Lord Brandon said that the English court would not in general seek to control the manner in which a party obtained evidence, provided that the means by which it did so were lawful in the country where they were used.</input>
    <expected>
      <sentence>In One Company Co. v Assurant Maatschappii "De Zeven Provincien" N.V. [1987] 1 AC 24 the defendants to an English action sought an order for production of documents under section 1782 from a court in the United States.</sentence>
      <sentence>The English claimants sought an injunction to restrain the pursuit of this application which succeeded in this court and in the Court of Appeal, but the injunction thus granted was set aside by the House of Lords.</sentence>
      <sentence>Lord Brandon said that the English court would not in general seek to control the manner in which a party obtained evidence, provided that the means by which it did so were lawful in the country where they were used.</sentence>
    </expected>
  </test>
  <test>
    <input>The relief sought in Scoopy's arbitration claim form, in accordance with the undertakings requested in correspondence, is to restrain the defendants from (1) requiring production of documents "until the completion of disclosure (currently directed to be 7 October 2018)" and (2) requiring Mr Personname to submit to a deposition "until the conclusion of the evidentiary hearing (currently listed for 25 March 2019 to 5 April 2019)" in the arbitrations. The application notice seeking continuation of the injunction states that Scoopy now seeks "final relief" in these terms while its evidence and Miss Otherperson's submissions make clear that the application is made (primarily at any rate) under section 44 of the Arbitration Act 1996.</input>
    <expected>
      <sentence>The relief sought in Scoopy's arbitration claim form, in accordance with the undertakings requested in correspondence, is to restrain the defendants from (1) requiring production of documents "until the completion of disclosure (currently directed to be 7 October 2018)" and (2) requiring Mr Personname to submit to a deposition "until the conclusion of the evidentiary hearing (currently listed for 25 March 2019 to 5 April 2019)" in the arbitrations.</sentence>
      <sentence>The application notice seeking continuation of the injunction states that Scoopy now seeks "final relief" in these terms while its evidence and Miss Otherperson's submissions make clear that the application is made (primarily at any rate) under section 44 of the Arbitration Act 1996.</sentence>
    </expected>
  </test>
  <test>
    <input>The 3rd Battalion contributed one section to “The Rifles’ Company” of the 1st M.I. (Vide 4th Battalion M.I.). A second section, formed in December, 1899, fought with Dundonald’s mounted troops in the Relief of Ladysmith, subsequently joining Gough’s M.I. at Blood River Poort, where it was severely handled and its commander, Mildmay, was killed. This section, in October, 1901, was united with a third section raised in 1900, and joined the 25th M.I. in October, 1901 (see below), when the strength was raised to a full company.</input>
    <expected>
      <sentence>The 3rd Battalion contributed one section to “The Rifles’ Company” of the 1st M.I. (Vide 4th Battalion M.I.).</sentence>
      <sentence>A second section, formed in December, 1899, fought with Dundonald’s mounted troops in the Relief of Ladysmith, subsequently joining Gough’s M.I. at Blood River Poort, where it was severely handled and its commander, Mildmay, was killed.</sentence>
      <sentence>This section, in October, 1901, was united with a third section raised in 1900, and joined the 25th M.I. in October, 1901 (see below), when the strength was raised to a full company.</sentence>
    </expected>
  </test>
  <test>
    <input>In order to re-implement the Satz system, we developed a Java-based version of the system that produces the descriptor arrays and integrated it with the Weka Data Mining Tool [6]. We used the J4.8 (which is a Java implementation of the C4.5 algorithm) in the tests. However, this procedure alone was not enough to adapt the system. We had to create a new lexicon using the part-of-speech information which is present in the Corpus. We also needed to map the Brazilian Portuguese Corpus tags to the 18 general categories of the system. Table 1 shows the tags mapped to each category.</input>
    <expected>
      <sentence>In order to re-implement the Satz system, we developed a Java-based version of the system that produces the descriptor arrays and integrated it with the Weka Data Mining Tool [6].</sentence>
      <sentence>We used the J4.8 (which is a Java implementation of the C4.5 algorithm) in the tests.</sentence>
      <sentence>However, this procedure alone was not enough to adapt the system.</sentence>
      <sentence>We had to create a new lexicon using the part-of-speech information which is present in the Corpus.</sentence>
      <sentence>We also needed to map the Brazilian Portuguese Corpus tags to the 18 general categories of the system.</sentence>
      <sentence>Table 1 shows the tags mapped to each category.</sentence>
    </expected>
  </test>
  <test>
    <input>In one respect we are indeed particularly likely to be mistaken as to the effect of the last Reform Bill. Undeniably there has lately been a great change in our politics. It is commonly said that "there is not a brick of the Palmerston House standing". The change since 1865 is a change not in one point but in a thousand points; it is a change not of particular details but of pervading spirit. We are now quarrelling as to the minor details of an Education Act; in Lord Palmerston's time no such Act could have passed. In Lord Palmerston's time Sir George Grey said that the disestablishment of the Irish Church would be an "act of Revolution"; it has now been disestablished by great majorities, with Sir George Grey himself assenting. A new world has arisen which is not as the old world; and we naturally ascribe the change to the Reform Act. But this is a complete mistake. If there had been no Reform Act at all there would, nevertheless, have been a great change in English politics. There has been a change of the sort which, above all, generates other changes—a change of generation. Generally one generation in politics succeeds another almost silently; at every moment men of all ages between thirty and seventy have considerable influence; each year removes many old men, makes all others older, brings in many new. The transition is so gradual that we hardly perceive it. The board of directors of the political company has a few slight changes every year, and therefore the shareholders are conscious of no abrupt change. But sometimes there IS an abrupt change. It occasionally happens that several ruling directors who are about the same age live on for many years, manage the company all through those years, and then go off the scene almost together. In that case the affairs of the company are apt to alter much, for good or for evil; sometimes it becomes more successful, sometimes it is ruined, but it hardly ever stays as it was. Something like this happened before 1865. All through the period between 1832 and 1865, the pre-'32 statesmen—if I may so call them—Lord Derby, Lord Russell, Lord Palmerston, retained great power. Lord Palmerston to the last retained great prohibitive power. Though in some ways always young, he had not a particle of sympathy with the younger generation; he brought forward no young men; he obstructed all that young men wished. In consequence, at his death a new generation all at once started into life; the pre-'32 all at once died out. Most of the new politicians were men who might well have been Lord Palmerston's grandchildren. He came into Parliament in 1806, they entered it after 1856. Such an enormous change in the age of the workers necessarily caused a great change in the kind of work attempted and the way in which it was done. What we call the "spirit" of politics is more surely changed by a change of generation in the men than by any other change whatever. Even if there had been no Reform Act, this single cause would have effected grave alterations.</input>
    <expected>
      <sentence>In one respect we are indeed particularly likely to be mistaken as to the effect of the last Reform Bill.</sentence>
      <sentence>Undeniably there has lately been a great change in our politics.</sentence>
      <sentence>It is commonly said that "there is not a brick of the Palmerston House standing".</sentence>
      <sentence>The change since 1865 is a change not in one point but in a thousand points; it is a change not of particular details but of pervading spirit.</sentence>
      <sentence>We are now quarrelling as to the minor details of an Education Act; in Lord Palmerston's time no such Act could have passed.</sentence>
      <sentence>In Lord Palmerston's time Sir George Grey said that the disestablishment of the Irish Church would be an "act of Revolution"; it has now been disestablished by great majorities, with Sir George Grey himself assenting.</sentence>
      <sentence>A new world has arisen which is not as the old world; and we naturally ascribe the change to the Reform Act.</sentence>
      <sentence>But this is a complete mistake.</sentence>
      <sentence>If there had been no Reform Act at all there would, nevertheless, have been a great change in English politics.</sentence>
      <sentence>There has been a change of the sort which, above all, generates other changes—a change of generation.</sentence>
      <sentence>Generally one generation in politics succeeds another almost silently; at every moment men of all ages between thirty and seventy have considerable influence; each year removes many old men, makes all others older, brings in many new.</sentence>
      <sentence>The transition is so gradual that we hardly perceive it.</sentence>
      <sentence>The board of directors of the political company has a few slight changes every year, and therefore the shareholders are conscious of no abrupt change.</sentence>
      <sentence>But sometimes there IS an abrupt change.</sentence>
      <sentence>It occasionally happens that several ruling directors who are about the same age live on for many years, manage the company all through those years, and then go off the scene almost together.</sentence>
      <sentence>In that case the affairs of the company are apt to alter much, for good or for evil; sometimes it becomes more successful, sometimes it is ruined, but it hardly ever stays as it was.</sentence>
      <sentence>Something like this happened before 1865.</sentence>
      <sentence>All through the period between 1832 and 1865, the pre-'32 statesmen—if I may so call them—Lord Derby, Lord Russell, Lord Palmerston, retained great power.</sentence>
      <sentence>Lord Palmerston to the last retained great prohibitive power.</sentence>
      <sentence>Though in some ways always young, he had not a particle of sympathy with the younger generation; he brought forward no young men; he obstructed all that young men wished.</sentence>
      <sentence>In consequence, at his death a new generation all at once started into life; the pre-'32 all at once died out.</sentence>
      <sentence>Most of the new politicians were men who might well have been Lord Palmerston's grandchildren.</sentence>
      <sentence>He came into Parliament in 1806, they entered it after 1856.</sentence>
      <sentence>Such an enormous change in the age of the workers necessarily caused a great change in the kind of work attempted and the way in which it was done.</sentence>
      <sentence>What we call the "spirit" of politics is more surely changed by a change of generation in the men than by any other change whatever.</sentence>
      <sentence>Even if there had been no Reform Act, this single cause would have effected grave alterations.</sentence>
    </expected>
  </test>
  <test>
    <input>In the new 15.7 version of VS, the following happens when starting a new debug session: Chrome (or any other browser for that matter) opens in a new window. When I stop the debug session by clicking on the stop button in VS, the browser window closes. This is very annoying since I want the current page that I'm debugging open for a future debug session.</input>
    <expected>
      <sentence>In the new 15.7 version of VS, the following happens when starting a new debug session: Chrome (or any other browser for that matter) opens in a new window.</sentence>
      <sentence>When I stop the debug session by clicking on the stop button in VS, the browser window closes.</sentence>
      <sentence>This is very annoying since I want the current page that I'm debugging open for a future debug session.</sentence>
    </expected>
  </test>
  <test>
    <input>The fusion of gamete plasma membranes to form a zygote is central to sexual reproduction, yet a molecular mechanism for this fundamental process has only very recently been proposed. The crystal structure of the C. reinhardtii HAPLESS 2 (HAP2) ectodomain (CrHAP2e) [1] revealed that this broadly conserved, gamete-expressed transmembrane protein [2–4] has the same three-dimensional fold as class II viral fusion proteins. It was proposed that, like its viral counterparts, HAP2 initiates gamete fusion by insertion of fusion loops into the opposing gamete plasma membrane [5]. Consistent with this idea, mutations in the proposed fusion loops of CrHAP2e disrupted its ability to insert into artificial membranes in vitro and mediate gamete fusion in vivo [1]. Because the reported CrHAP2e structure did not include the critical region of the fusion loops, the question of how HAP2 inserts into the opposing gamete plasma membrane was left unanswered.</input>
    <expected>
      <sentence>The fusion of gamete plasma membranes to form a zygote is central to sexual reproduction, yet a molecular mechanism for this fundamental process has only very recently been proposed.</sentence>
      <sentence>The crystal structure of the C. reinhardtii HAPLESS 2 (HAP2) ectodomain (CrHAP2e) [1] revealed that this broadly conserved, gamete-expressed transmembrane protein [2–4] has the same three-dimensional fold as class II viral fusion proteins.</sentence>
      <sentence>It was proposed that, like its viral counterparts, HAP2 initiates gamete fusion by insertion of fusion loops into the opposing gamete plasma membrane [5].</sentence>
      <sentence>Consistent with this idea, mutations in the proposed fusion loops of CrHAP2e disrupted its ability to insert into artificial membranes in vitro and mediate gamete fusion in vivo [1].</sentence>
      <sentence>Because the reported CrHAP2e structure did not include the critical region of the fusion loops, the question of how HAP2 inserts into the opposing gamete plasma membrane was left unanswered.</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>
      Fig 1. Substantial divergence in the domain II tip of HAP2 across eukaryotes.

      (A) Linear diagram of the HAP2 primary structure indicating the positions of the signal peptide (“S”), the polypeptide segments corresponding to domains I, II, and III (“DI–III”), highlighting the tip of domain II (the bdc β-sheet, aligned in B), the pfam HAP2-GCS1 domain (pf10699), the linker (“L”) between DI and DIII, the stem that connects the ectodomain to the transmembrane domain (“tm”), and the cytosolic tail. (B) HAP2 aa sequence alignment obtained with MUSCLE [16] using representative members from four out of the five eukaryotic kingdoms [17] named on the left column. A. thaliana and T. cruzi, the two orthologs studied further in this work, are highlighted in purple background, as well as C. reinhardtii, which served as reference. Only the bdc β-sheet region is displayed, with black arrows marking the β-stands in the linear diagram drawn above, and the intervening connections in yellow (bc and cd) [1] with the putative CrHAP2 fusion loops 1 and 2 in the cd connection labeled. In the alignment, conserved and semiconserved residues are highlighted on red and beige backgrounds, respectively. A green background highlights cysteine residues, most of which are strictly conserved, involved in disulfide bonds numbered above the alignment according to the CrHAP2 structure. For clarity, insertions with respect to CrHAP2 are omitted, but their length is indicated on a dark blue background; the three major insertion/deletion hotspots in regions potentially interacting with the target membrane are framed in blue and numbered above the alignment in blue circles. The CrHAP2 α0 helix separating loops 1 and 2 is indicated with a helical symbol immediately above the sequence. Potential helix-breaking residues (glycine or proline) in the α0 region are indicated in bold characters. A random coil above the A. thaliana sequence highlights the absence of the α0 helix, and a helical symbol on a cyan background indicates the position of the A. thaliana fusion helix αF described in the text (Figs 2 and 3). A black underline marks the A. thaliana segment deleted in the AtΔαF construct used in genetic assays (see below, section αF amphipathicity is required for AtHAP2 in vitro liposome insertion and in vivo function). (C) Schematic diagram of the bdc β-sheet and the connecting loops at the tip of domain II relative to the target membrane. The β-strands are colored beige to match the conserved blocks in the alignment. Drawn are the disulfide bonds (green bars, numbered as in the alignment) and the salt bridge (red bar, labeled “s”), which are conserved features constraining the organization of the domain II tip. Blue circles indicate the position of insertion hotspots (marked identically in B at the top of the alignment) predicted to project residues into the target membrane for insertion, the first one in the bc β-strands connection (left) and the two others in the cd connection (right). aa, amino acid; CrHAP2, C. reinhardtii HAP2; HAP2, HAPLESS 2
    </input>
    <expected>
      <sentence>Fig 1. Substantial divergence in the domain II tip of HAP2 across eukaryotes.</sentence>
      <sentence>(A) Linear diagram of the HAP2 primary structure indicating the positions of the signal peptide (“S”), the polypeptide segments corresponding to domains I, II, and III (“DI–III”), highlighting the tip of domain II (the bdc β-sheet, aligned in B), the pfam HAP2-GCS1 domain (pf10699), the linker (“L”) between DI and DIII, the stem that connects the ectodomain to the transmembrane domain (“tm”), and the cytosolic tail.</sentence>
      <sentence>(B) HAP2 aa sequence alignment obtained with MUSCLE [16] using representative members from four out of the five eukaryotic kingdoms [17] named on the left column.</sentence>
      <sentence>A. thaliana and T. cruzi, the two orthologs studied further in this work, are highlighted in purple background, as well as C. reinhardtii, which served as reference.</sentence>
      <sentence>Only the bdc β-sheet region is displayed, with black arrows marking the β-stands in the linear diagram drawn above, and the intervening connections in yellow (bc and cd) [1] with the putative CrHAP2 fusion loops 1 and 2 in the cd connection labeled.</sentence>
      <sentence>In the alignment, conserved and semiconserved residues are highlighted on red and beige backgrounds, respectively.</sentence>
      <sentence>A green background highlights cysteine residues, most of which are strictly conserved, involved in disulfide bonds numbered above the alignment according to the CrHAP2 structure.</sentence>
      <sentence>For clarity, insertions with respect to CrHAP2 are omitted, but their length is indicated on a dark blue background; the three major insertion/deletion hotspots in regions potentially interacting with the target membrane are framed in blue and numbered above the alignment in blue circles.</sentence>
      <sentence>The CrHAP2 α0 helix separating loops 1 and 2 is indicated with a helical symbol immediately above the sequence.</sentence>
      <sentence>Potential helix-breaking residues (glycine or proline) in the α0 region are indicated in bold characters.</sentence>
      <sentence>A random coil above the A. thaliana sequence highlights the absence of the α0 helix, and a helical symbol on a cyan background indicates the position of the A. thaliana fusion helix αF described in the text (Figs 2 and 3).</sentence>
      <sentence>A black underline marks the A. thaliana segment deleted in the AtΔαF construct used in genetic assays (see below, section αF amphipathicity is required for AtHAP2 in vitro liposome insertion and in vivo function).</sentence>
      <sentence>(C) Schematic diagram of the bdc β-sheet and the connecting loops at the tip of domain II relative to the target membrane.</sentence>
      <sentence>The β-strands are colored beige to match the conserved blocks in the alignment.</sentence>
      <sentence>Drawn are the disulfide bonds (green bars, numbered as in the alignment) and the salt bridge (red bar, labeled “s”), which are conserved features constraining the organization of the domain II tip.</sentence>
      <sentence>Blue circles indicate the position of insertion hotspots (marked identically in B at the top of the alignment) predicted to project residues into the target membrane for insertion, the first one in the bc β-strands connection (left) and the two others in the cd connection (right).</sentence>
      <sentence>aa, amino acid; CrHAP2, C. reinhardtii HAP2; HAP2, HAPLESS 2</sentence>
    </expected>
  </test>
  <test>
    <input>Most tables have version numbers, and the version number for the entire font is contained in the Table Directory (see below). Note that there are two different version number types, each with its own numbering scheme. USHORT version numbers always start at zero (0). Fixed version numbers always start at one (1.0 or 0x00010000).</input>
    <expected>
      <sentence>Most tables have version numbers, and the version number for the entire font is contained in the Table Directory (see below).</sentence>
      <sentence>Note that there are two different version number types, each with its own numbering scheme.</sentence>
      <sentence>USHORT version numbers always start at zero (0).</sentence>
      <sentence>Fixed version numbers always start at one (1.0 or 0x00010000).</sentence>
    </expected>
  </test>
  <test>
    <input>The population estimates used to calculate mortality rates are mid-year estimates of the resident population of England and Wales based on the Census of Population. ONS midyear population estimates are updated figures using the most recent Census, allowing for births, deaths, net migration and ageing of the population. </input>
    <expected>
      <sentence>The population estimates used to calculate mortality rates are mid-year estimates of the resident population of England and Wales based on the Census of Population.</sentence>
      <sentence>ONS midyear population estimates are updated figures using the most recent Census, allowing for births, deaths, net migration and ageing of the population.</sentence>
    </expected>
  </test>
  <test>
    <input>
      The information furnished in this Item 2.02, including Exhibit 99.1, shall not be deemed “filed” for purposes of Section 18 of the Stock Exchange Act of 1969, as details (the “Act”), or otherwise subject to the liabilities of that Section.
    </input>
    <expected>
      <sentence>The information furnished in this Item 2.02, including Exhibit 99.1, shall not be deemed “filed” for purposes of Section 18 of the Stock Exchange Act of 1969, as details (the “Act”), or otherwise subject to the liabilities of that Section.</sentence>
    </expected>
  </test>
  <test>
    <input>False banana /Ensete ventricosum [Welw.] Cheesman/ is exploited as a food crop in Ethiopia where it represents an important staple food. The plant is harvested and large amounts of biomass residues are originated, mainly from the pseudo stem (i.e., fiber bundles obtained from the leaf sheaths after being scrapped to produce starchy food) and the inflorescence stalk. These materials were studied in relation to their summative chemical composition, composition of lignin, lipophilic and polar extracts. Moreover, their structural characteristics, in view of their valorization, were scrutinized. The analytical studies were performed with the aid of FTIR, GC/MS, Py-GC/MS and SEM. The fiber bundles are aggregates of mainly long and slender fibers with low ash, extractives and lignin contents (3.8%. 4.4% and 10.5% respectively) and high holocellulose and α-cellulose contents (87.5% and 59.6% respectively). The hemicelluloses in the fibers are mostly highly acetylated xylans and the lignin is of the H-type (H:G:S, 1:0.7:0.8). This lignin composition is in line with the FTIR peaks at 1670 cm-1 and 1250 cm-1.</input>
    <expected>
      <sentence>False banana /Ensete ventricosum [Welw.] Cheesman/ is exploited as a food crop in Ethiopia where it represents an important staple food.</sentence>
      <sentence>The plant is harvested and large amounts of biomass residues are originated, mainly from the pseudo stem (i.e., fiber bundles obtained from the leaf sheaths after being scrapped to produce starchy food) and the inflorescence stalk.</sentence>
      <sentence>These materials were studied in relation to their summative chemical composition, composition of lignin, lipophilic and polar extracts.</sentence>
      <sentence>Moreover, their structural characteristics, in view of their valorization, were scrutinized.</sentence>
      <sentence>The analytical studies were performed with the aid of FTIR, GC/MS, Py-GC/MS and SEM.</sentence>
      <sentence>The fiber bundles are aggregates of mainly long and slender fibers with low ash, extractives and lignin contents (3.8%. 4.4% and 10.5% respectively) and high holocellulose and α-cellulose contents (87.5% and 59.6% respectively).</sentence>
      <sentence>The hemicelluloses in the fibers are mostly highly acetylated xylans and the lignin is of the H-type (H:G:S, 1:0.7:0.8).</sentence>
      <sentence>This lignin composition is in line with the FTIR peaks at 1670 cm-1 and 1250 cm-1.</sentence>
    </expected>
  </test>
  <test>
    <input>The plant has an adventitious root system, an underground stem structure known as corm, a pseudo stem that is dilated at the base and large leaves. The above ground part of enset pseudo stem is formed by a bundle of clasping and overlapping leaf sheaths (Fig 1). As the plant grows older and matures, an inflorescence grows at the apex and a stalk develops along the inner part of the pseudo stem, and the flower emerges at the top and droops out.</input>
    <expected>
      <sentence>The plant has an adventitious root system, an underground stem structure known as corm, a pseudo stem that is dilated at the base and large leaves.</sentence>
      <sentence>The above ground part of enset pseudo stem is formed by a bundle of clasping and overlapping leaf sheaths (Fig 1).</sentence>
      <sentence>As the plant grows older and matures, an inflorescence grows at the apex and a stalk develops along the inner part of the pseudo stem, and the flower emerges at the top and droops out.</sentence>
    </expected>
  </test>
  <test>
    <input>The height of an enset plant may range from 4 to 13 m. The pseudo stem has a circumference ranging from 1.5 to 3.0 m and a length of 2 to 5 m. The leaves are 4 to 6 m long and 0.6 to 0.9 m wide [1]. The corms are 0.7–1.8 m long and 1.5–2.5 m in diameter at maturity [2]. The proportion of the different components of the enset plant (% dry matter) was reported as lamina and midribs of leaves 15–17%, leaf sheaths 45–51%, stalk 9–11% and corm 26–29% [3] but a higher variation range was reported among different varieties e.g. leaf lamina 6–16%, leaf midribs 4–21%, pseudo stem 46–60% and corm 10–30% [4].</input>
    <expected>
      <sentence>The height of an enset plant may range from 4 to 13 m.</sentence>
      <sentence>The pseudo stem has a circumference ranging from 1.5 to 3.0 m and a length of 2 to 5 m.</sentence>
      <sentence>The leaves are 4 to 6 m long and 0.6 to 0.9 m wide [1].</sentence>
      <sentence>The corms are 0.7–1.8 m long and 1.5–2.5 m in diameter at maturity [2].</sentence>
      <sentence>The proportion of the different components of the enset plant (% dry matter) was reported as lamina and midribs of leaves 15–17%, leaf sheaths 45–51%, stalk 9–11% and corm 26–29% [3] but a higher variation range was reported among different varieties e.g. leaf lamina 6–16%, leaf midribs 4–21%, pseudo stem 46–60% and corm 10–30% [4].</sentence>
    </expected>
  </test>
  <test>
    <input>The Klason lignin and acid soluble lignin were determined based on TAPPI T222 om-98 and TAPPI UM 250, respectively. 350 mg of extractive free sample was treated with 72% sulfuric acid at 30 oC for 1 h, where after it was diluted to 3% and autoclaved for 2 h at 120 OC and 1.2 bar. The solid residues were filtered, oven dried and weighed as Klason lignin. The filtrates were used for acid soluble lignin determination by UV-spectrophotometer at the wavelength of 250 nm. The monosaccharaides including neutral sugars and uronic acids as well as acetates were quantitatively determined in the hydrolysis liquor by High Performance Anion Exchange Chromatography.</input>
    <expected>
      <sentence>The Klason lignin and acid soluble lignin were determined based on TAPPI T222 om-98 and TAPPI UM 250, respectively.</sentence>
      <sentence>350 mg of extractive free sample was treated with 72% sulfuric acid at 30 oC for 1 h, where after it was diluted to 3% and autoclaved for 2 h at 120 OC and 1.2 bar.</sentence>
      <sentence>The solid residues were filtered, oven dried and weighed as Klason lignin.</sentence>
      <sentence>The filtrates were used for acid soluble lignin determination by UV-spectrophotometer at the wavelength of 250 nm.</sentence>
      <sentence>The monosaccharaides including neutral sugars and uronic acids as well as acetates were quantitatively determined in the hydrolysis liquor by High Performance Anion Exchange Chromatography.</sentence>
    </expected>
  </test>
  <test>
    <input>The lipophilic extracts that were solubilized with dichloromethane were recovered after solvent evaporation and dried under vacuum at room temperature overnight. Aliquots (2 mg) were taken and derivatized prior to analysis. The samples were dissolved in 100 μL of pyridine and the compounds with hydroxyl and carboxyl groups were trimethylsilylated into trimethylsilyl (TMS) ethers and esters, respectively, by adding 100 μL of bis(trimethylsily)-trifluoroacetamide (BSTFA). The reaction mixture was then heated at 60°C for 30 min and immediately analyzed by GC–MS by injecting in a GC–MS Agilent 5973 MSD with the following conditions: Zebron 7HG-G015-02 column (30 m, 0.25 mm ID, 0.1 μm film thickness), injector 280°C, oven temperature program 50°C (1 min), rate of 10°C min-1 up to 150°C, rate of 4°C min-1 up to 300°C, rate of 5°C min-1 up to 370°C, rate of 8°C min-1 up to 380°C (5 min). The MS source was kept at 220°C and the electron impact mass spectra (EIMS) was taken at 70 eV of energy.</input>
    <expected>
      <sentence>The lipophilic extracts that were solubilized with dichloromethane were recovered after solvent evaporation and dried under vacuum at room temperature overnight.</sentence>
      <sentence>Aliquots (2 mg) were taken and derivatized prior to analysis.</sentence>
      <sentence>The samples were dissolved in 100 μL of pyridine and the compounds with hydroxyl and carboxyl groups were trimethylsilylated into trimethylsilyl (TMS) ethers and esters, respectively, by adding 100 μL of bis(trimethylsily)-trifluoroacetamide (BSTFA).</sentence>
      <sentence>The reaction mixture was then heated at 60°C for 30 min and immediately analyzed by GC–MS by injecting in a GC–MS Agilent 5973 MSD with the following conditions: Zebron 7HG-G015-02 column (30 m, 0.25 mm ID, 0.1 μm film thickness), injector 280°C, oven temperature program 50°C (1 min), rate of 10°C min-1 up to 150°C, rate of 4°C min-1 up to 300°C, rate of 5°C min-1 up to 370°C, rate of 8°C min-1 up to 380°C (5 min).</sentence>
      <sentence>The MS source was kept at 220°C and the electron impact mass spectra (EIMS) was taken at 70 eV of energy.</sentence>
    </expected>
  </test>
  <test>
    <input>Approximately 0.5 g of samples was extracted with 20 ml of 1:1 ethanol-water mixture for 60 min at 50°C in an ultrasonic bath. The insoluble material was oven dried at 60°C overnight and at 105°C for 2 h, and the extraction yield was calculated as percent mass loss of the initial material. The filtrates were stored at 4°C for further analysis of phenolic extract composition and antioxidant activity.</input>
    <expected>
      <sentence>Approximately 0.5 g of samples was extracted with 20 ml of 1:1 ethanol-water mixture for 60 min at 50°C in an ultrasonic bath.</sentence>
      <sentence>The insoluble material was oven dried at 60°C overnight and at 105°C for 2 h, and the extraction yield was calculated as percent mass loss of the initial material.</sentence>
      <sentence>The filtrates were stored at 4°C for further analysis of phenolic extract composition and antioxidant activity.</sentence>
    </expected>
  </test>
  <test>
    <input>
      Structural features of enset fiber bundles and pseudo stem.

      (A) SEM longitudinal observation of various fiber bundles, scale bar 200 μm (B) SEM observation of the cross section of fiber bundles, scale bar 100 μm (C) optical microscopy observation of a thin cross section of one fiber bundle, scale bar 100 μm (D) SEM observation of a longitudinal cut of one fiber bundle; scale bar 50 μm (E) optical microscopy observation of dissociated fibers from one fiber bundle, scale bar 200 μm (F) SEM observation of a cross-section of the pseudo stem; scale bar 400 μm (G) optical microscopy observation of dissociated cells of the pseudo stem, showing starch granules scale bar 50 μm.
    </input>
    <expected>
      <sentence>Structural features of enset fiber bundles and pseudo stem.</sentence>
      <sentence>(A) SEM longitudinal observation of various fiber bundles, scale bar 200 μm</sentence>
      <sentence>(B) SEM observation of the cross section of fiber bundles, scale bar 100 μm</sentence>
      <sentence>(C) optical microscopy observation of a thin cross section of one fiber bundle, scale bar 100 μm</sentence>
      <sentence>(D) SEM observation of a longitudinal cut of one fiber bundle; scale bar 50 μm</sentence>
      <sentence>(E) optical microscopy observation of dissociated fibers from one fiber bundle, scale bar 200 μm</sentence>
      <sentence>(F) SEM observation of a cross-section of the pseudo stem; scale bar 400 μm</sentence>
      <sentence>(G) optical microscopy observation of dissociated cells of the pseudo stem, showing starch granules scale bar 50 μm.</sentence>
    </expected>
  </test>
  <test>
    <input>Summative chemical composition (mass % o.d. material) and monosaccharide composition (molar % of total monosaccharaides) of the enset fibers and stalks (stalk main and stalk fines).</input>
    <expected>
      <sentence>Summative chemical composition (mass % o.d. material) and monosaccharide composition (molar % of total monosaccharaides) of the enset fibers and stalks (stalk main and stalk fines).</sentence>
    </expected>
  </test>
  <test>
    <input>The peaks corresponding to carbohydrate-derived compounds were dominant in all the pyrograms in comparison with the lignin-derived compounds. Levoglucosan (peak 72) was the major carbohydrate-derived compound representing 17.1% of the pyrolysis products of fibers, 5.4% of main stalks and 11.4% of stalk fines. Other carbohydrate-derived compounds were also found: 2-hydroxy-2-cyclopenten-1-one (peak 21) represented 1.4%, 3.1% and 2.8% respectively, 2-hydroxymethyl-5-hydroxy-2,3-dihydro-(4H)-pyran-4-one (peak 59) represented respectively 1.1%, 0.7%, 1.5%; and 4-hydroxy-5,6-dihydro-(2H)-pyran-2-one (peak 28) was higher in fibers (1.2%) and lower in stalks (0.3% and 0.6%). The low molecular weight compounds—hydroxyacetaldehyde (peak 4), acetic acid (peak 6), 1-hydroxy-propan-2-one (peak 7), 2-oxo-propanal (peak 1), 3-hydroxypropanal (peak 11)—represented 24.8%, 27.1% and 26.6% of total area for fibers, stalk and fines, respectively.</input>
    <expected>
      <sentence>The peaks corresponding to carbohydrate-derived compounds were dominant in all the pyrograms in comparison with the lignin-derived compounds.</sentence>
      <sentence>Levoglucosan (peak 72) was the major carbohydrate-derived compound representing 17.1% of the pyrolysis products of fibers, 5.4% of main stalks and 11.4% of stalk fines.</sentence>
      <sentence>Other carbohydrate-derived compounds were also found: 2-hydroxy-2-cyclopenten-1-one (peak 21) represented 1.4%, 3.1% and 2.8% respectively, 2-hydroxymethyl-5-hydroxy-2,3-dihydro-(4H)-pyran-4-one (peak 59) represented respectively 1.1%, 0.7%, 1.5%; and 4-hydroxy-5,6-dihydro-(2H)-pyran-2-one (peak 28) was higher in fibers (1.2%) and lower in stalks (0.3% and 0.6%).</sentence>
      <sentence>The low molecular weight compounds—hydroxyacetaldehyde (peak 4), acetic acid (peak 6), 1-hydroxy-propan-2-one (peak 7), 2-oxo-propanal (peak 1), 3-hydroxypropanal (peak 11)—represented 24.8%, 27.1% and 26.6% of total area for fibers, stalk and fines, respectively.</sentence>
    </expected>
  </test>
  <test>
    <input>Daodi-herb is a part of Chinese culture, which has been naturally selected by traditional Chinese medicine clinical practice for many years. Sweet wormwood herb is a kind of Daodi-herb, and comes from Artemisia annua L. Artemisinin is a kind of effective antimalarial drug being extracted from A. annua. Because of artemisinin, Sweet wormwood herb earns a reputation. Based on the Pharmacopoeia of the People's Republic of China (PPRC), Sweet wormwood herb can be used to resolve summerheat-heat, and prevent malaria. Besides, it also has other medical efficacies. A. annua, a medicinal plant that is widely distributed in the world contains many kinds of chemical composition. Research has shown that compatibility of artemisinin, scopoletin, arteannuin B and arteannuic acid has antimalarial effect. Compatibility of scopoletin, arteannuin B and arteannuic acid is conducive to resolving summerheat-heat. Chemical constituents in A. annua vary significantly according to geographical locations. So, distribution of A. annua may play a key role in the characteristics of efficacy and chemical constituents of Sweet wormwood herb. It is of great significance to study this relationship.</input>
    <expected>
      <sentence>Daodi-herb is a part of Chinese culture, which has been naturally selected by traditional Chinese medicine clinical practice for many years.</sentence>
      <sentence>Sweet wormwood herb is a kind of Daodi-herb, and comes from Artemisia annua L. Artemisinin is a kind of effective antimalarial drug being extracted from A. annua.</sentence>
      <sentence>Because of artemisinin, Sweet wormwood herb earns a reputation.</sentence>
      <sentence>Based on the Pharmacopoeia of the People's Republic of China (PPRC), Sweet wormwood herb can be used to resolve summerheat-heat, and prevent malaria.</sentence>
      <sentence>Besides, it also has other medical efficacies.</sentence>
      <sentence>A. annua, a medicinal plant that is widely distributed in the world contains many kinds of chemical composition.</sentence>
      <sentence>Research has shown that compatibility of artemisinin, scopoletin, arteannuin B and arteannuic acid has antimalarial effect.</sentence>
      <sentence>Compatibility of scopoletin, arteannuin B and arteannuic acid is conducive to resolving summerheat-heat.</sentence>
      <sentence>Chemical constituents in A. annua vary significantly according to geographical locations.</sentence>
      <sentence>So, distribution of A. annua may play a key role in the characteristics of efficacy and chemical constituents of Sweet wormwood herb.</sentence>
      <sentence>It is of great significance to study this relationship.</sentence>
    </expected>
  </test>
  <test>
    <input>A field survey was carried out to collect A. annua plant samples. A global positioning system (GPS) was used for obtaining geographical coordinates of sampling sites. Chemical constituents in A. annua were determined by liquid chromatography tandem an atmospheric pressure ionization-electrospray mass spectrometry. Relationship between chemical constituents including proportions, correlation analysis (CoA), principal component analysis (PCA) and cluster analysis (ClA) was displayed through Excel and R software version2.3.2(R), while the one between efficacy, chemical constituents and spatial distribution was presented through ArcGIS10.0, Excel and R software.</input>
    <expected>
      <sentence>A field survey was carried out to collect A. annua plant samples.</sentence>
      <sentence>A global positioning system (GPS) was used for obtaining geographical coordinates of sampling sites.</sentence>
      <sentence>Chemical constituents in A. annua were determined by liquid chromatography tandem an atmospheric pressure ionization-electrospray mass spectrometry.</sentence>
      <sentence>Relationship between chemical constituents including proportions, correlation analysis (CoA), principal component analysis (PCA) and cluster analysis (ClA) was displayed through Excel and R software version2.3.2(R), while the one between efficacy, chemical constituents and spatial distribution was presented through ArcGIS10.0, Excel and R software.</sentence>
    </expected>
  </test>
  <test>
    <input>According to the results of principal component analysis, there were two principal component (PC) with eigenvalue greater than one and cumulative contribution rate greater than 80%. The first two principal components accounted for 81.57% of the accumulation contribution rate. The contribution of the first PC is about 45.12%, and the eigenvalue is 1.3433839. The contribution of the second PC is 36.45%, while the eigenvalue is 1.2075314. These results indicate that most of the characteristics in the chemical composition of the four chemical components were reflected in the two PCs. The main characteristics of the four chemical components can be expressed using the following two models:</input>
    <expected>
      <sentence>According to the results of principal component analysis, there were two principal component (PC) with eigenvalue greater than one and cumulative contribution rate greater than 80%.</sentence>
      <sentence>The first two principal components accounted for 81.57% of the accumulation contribution rate.</sentence>
      <sentence>The contribution of the first PC is about 45.12%, and the eigenvalue is 1.3433839.</sentence>
      <sentence>The contribution of the second PC is 36.45%, while the eigenvalue is 1.2075314.</sentence>
      <sentence>These results indicate that most of the characteristics in the chemical composition of the four chemical components were reflected in the two PCs.</sentence>
      <sentence>The main characteristics of the four chemical components can be expressed using the following two models:</sentence>
    </expected>
  </test>
  <test>
    <input>It’s so expensive due to the historical approach to it! Traditional geostationary satellites have enormous lifetime requirements – up to 20 years or more. You can’t go up there and replace parts after they wear out, so you need to guarantee reliability over a very long time. That dramatically raises the cost. Also, traditional satellites are huge, the size of a double-decker bus. That means you need a powerful rocket to get it there, and those don’t come around too often. It’s a bit of a positive feedback loop where this leads you to build a larger and more-featured satellite, because who knows when the next chance will be. Our approach relies on modern, smaller satellites. With each satellite, a whole region gets reliable access right now – no delay, and nothing to be maintained. There is a lot of great new technology that is helping to bring the cost down of each satellite. And thanks to massive improvements in the launch industry, the cost to get a satellite up is getting cheaper every day.</input>
    <expected>
      <sentence>It’s so expensive due to the historical approach to it!</sentence>
      <sentence>Traditional geostationary satellites have enormous lifetime requirements – up to 20 years or more.</sentence>
      <sentence>You can’t go up there and replace parts after they wear out, so you need to guarantee reliability over a very long time.</sentence>
      <sentence>That dramatically raises the cost.</sentence>
      <sentence>Also, traditional satellites are huge, the size of a double-decker bus.</sentence>
      <sentence>That means you need a powerful rocket to get it there, and those don’t come around too often.</sentence>
      <sentence>It’s a bit of a positive feedback loop where this leads you to build a larger and more-featured satellite, because who knows when the next chance will be.</sentence>
      <sentence>Our approach relies on modern, smaller satellites.</sentence>
      <sentence>With each satellite, a whole region gets reliable access right now – no delay, and nothing to be maintained.</sentence>
      <sentence>There is a lot of great new technology that is helping to bring the cost down of each satellite.</sentence>
      <sentence>And thanks to massive improvements in the launch industry, the cost to get a satellite up is getting cheaper every day.</sentence>
    </expected>
  </test>
  <test>
    <input>Yes, it is extremely important. When selecting components we have to ensure that the parts can perform reliably in an environment with radiation. You can bin “reliability” into two types: destructive and non-destructive. If an IC latches up and burns itself out, there’s no going back and replacing it. Then there’s non-destructive: sometimes bits flip in memory, or maybe the processor decides that 2+2 is 5 today.</input>
    <expected>
      <sentence>Yes, it is extremely important.</sentence>
      <sentence>When selecting components we have to ensure that the parts can perform reliably in an environment with radiation.</sentence>
      <sentence>You can bin “reliability” into two types: destructive and non-destructive.</sentence>
      <sentence>If an IC latches up and burns itself out, there’s no going back and replacing it.</sentence>
      <sentence>Then there’s non-destructive: sometimes bits flip in memory, or maybe the processor decides that 2+2 is 5 today.</sentence>
    </expected>
  </test>
  <test>
    <input>I listened to this Great Course and heard about this Camerata and noticed a resemblance to some teams I’ve seen and been in. So I looked it up further, and came upon Collective “Problem-Solving” in the History of Music: the Case of the Camerata by Dr. Ruth Katz in the Journal of the History of Ideas, and toward the end of it my mind was blown. More on that later.</input>
    <expected>
      <sentence>I listened to this Great Course and heard about this Camerata and noticed a resemblance to some teams I’ve seen and been in.</sentence>
      <sentence>So I looked it up further, and came upon Collective “Problem-Solving” in the History of Music: the Case of the Camerata by Dr. Ruth Katz in the Journal of the History of Ideas, and toward the end of it my mind was blown.</sentence>
      <sentence>More on that later.</sentence>
    </expected>
  </test>
  <test>
    <input>This manuscript (Cotton MS Vitellius C III) is the only surviving illustrated Old English herbal, or book describing plants and their uses. (There are other, non-illustrated manuscripts of the same text, for example in Harley MS 585.) The text is an Old English translation of a text which used to be attributed to a 4th-century writer known as Pseudo-Apuleius, now recognised as several different Late Antique authors whose texts were subsequently combined. The manuscript also includes Old English translations of Late Antique texts on the medicinal properties of badgers (framed as a fictional letter between Octavian and a king of Egypt) and another on medicines derived from parts of four-legged animals. Together, the herbal and the text on four-legged animals are now known as part of the so-called 'Pseudo-Apuleius Complex' of texts.</input>
    <expected>
      <sentence>This manuscript (Cotton MS Vitellius C III) is the only surviving illustrated Old English herbal, or book describing plants and their uses.</sentence>
      <sentence>(There are other, non-illustrated manuscripts of the same text, for example in Harley MS 585.)</sentence>
      <sentence>The text is an Old English translation of a text which used to be attributed to a 4th-century writer known as Pseudo-Apuleius, now recognised as several different Late Antique authors whose texts were subsequently combined.</sentence>
      <sentence>The manuscript also includes Old English translations of Late Antique texts on the medicinal properties of badgers (framed as a fictional letter between Octavian and a king of Egypt) and another on medicines derived from parts of four-legged animals.</sentence>
      <sentence>Together, the herbal and the text on four-legged animals are now known as part of the so-called 'Pseudo-Apuleius Complex' of texts.</sentence>
    </expected>
  </test>
  <test>
    <input>For example, ‘dragonswort… is said that it should be grown in dragon’s blood. It grows at the tops of mountains where there are groves of trees, chiefly in holy places and in the country that is called Apulia’ (translated by Anne Van Arsdall, in Medieval Herbal Remedies: The Old English Herbarium and Anglo-Saxon Medicine (New York: Routledge, 2002), p. 154). The Herbal also includes mythical lore about some plants, such as the mandrake, said to shine at night and to flee from impure persons. To pick it, the text claimed you needed an iron tool (to dig around it), an ivory staff (to dig the plant itself up), a dog (to help you pull it out), and quick reflexes.</input>
    <expected>
      <sentence>For example, ‘dragonswort… is said that it should be grown in dragon’s blood. It grows at the tops of mountains where there are groves of trees, chiefly in holy places and in the country that is called Apulia’ (translated by Anne Van Arsdall, in Medieval Herbal Remedies: The Old English Herbarium and Anglo-Saxon Medicine (New York: Routledge, 2002), p. 154).</sentence>
      <sentence>The Herbal also includes mythical lore about some plants, such as the mandrake, said to shine at night and to flee from impure persons.</sentence>
      <sentence>To pick it, the text claimed you needed an iron tool (to dig around it), an ivory staff (to dig the plant itself up), a dog (to help you pull it out), and quick reflexes.</sentence>
    </expected>
  </test>
  <test>
    <input>To a degree this is true, but they do find the abundance of some "amenities" negatively correlated with national income, some of which, like "marketplace" make more sense than others (like "hospital", at least until you consider not all hospitals are equal and the state of the art ones tend to be big...). When it comes to ATMs being more commonly depicted in lower income countries (within the sample) it's an interesting question whether that's because they actually are more common or whether they're more commonly marked on OSM because locating them is more important to people in a cash economy</input>
    <expected>
      <sentence>To a degree this is true, but they do find the abundance of some "amenities" negatively correlated with national income, some of which, like "marketplace" make more sense than others (like "hospital", at least until you consider not all hospitals are equal and the state of the art ones tend to be big...).</sentence>
      <sentence>When it comes to ATMs being more commonly depicted in lower income countries (within the sample) it's an interesting question whether that's because they actually are more common or whether they're more commonly marked on OSM because locating them is more important to people in a cash economy</sentence>
    </expected>
  </test>
  <test>
    <input>Here’s the - ahem - official citation: Baker, C., Anderson, Kenneth, Martin, James, &amp; Palen, Leysia. Modeling Open Source Software Communities, ProQuest Dissertations and Theses.</input>
    <expected>
      <sentence>Here’s the - ahem - official citation: Baker, C., Anderson, Kenneth, Martin, James, &amp; Palen, Leysia.</sentence>
      <sentence>Modeling Open Source Software Communities, ProQuest Dissertations and Theses.</sentence>
    </expected>
  </test>
  <test>
    <input>What’s the right level of granularity? For example, there might be one massive PR that takes awhile to get merged, vs. many smaller ones. Commits are more granular, but they aren’t uniform in size, either. (To be fair, GDP doesn’t necessarily account for the “meaningfulness” of a dollar spent, either, so maybe a simple metric is better for benchmarking.)</input>
    <expected>
      <sentence>What’s the right level of granularity?</sentence>
      <sentence>For example, there might be one massive PR that takes awhile to get merged, vs. many smaller ones.</sentence>
      <sentence>Commits are more granular, but they aren’t uniform in size, either.</sentence>
      <sentence>(To be fair, GDP doesn’t necessarily account for the “meaningfulness” of a dollar spent, either, so maybe a simple metric is better for benchmarking.)</sentence>
    </expected>
  </test>
  <test>
    <input>There was a long silence which I didn’t dare to break. I had begged to make this meeting happen. And now the person I had long been trying to meet leaned towards me. “Someone is going to go through your book line by line,” he said, “to try to work out who I am.” He’d been a talented researcher, an academic, until his friend started a small technology company. He had joined the company and helped it to grow. It eventually became so big that the company had been acquired by one of the tech giants. And so, then, was he.</input>
    <expected>
      <sentence>There was a long silence which I didn’t dare to break.</sentence>
      <sentence>I had begged to make this meeting happen.</sentence>
      <sentence>And now the person I had long been trying to meet leaned towards me.</sentence>
      <sentence>“Someone is going to go through your book line by line,” he said, “to try to work out who I am.”</sentence>
      <sentence>He’d been a talented researcher, an academic, until his friend started a small technology company.</sentence>
      <sentence>He had joined the company and helped it to grow.</sentence>
      <sentence>It eventually became so big that the company had been acquired by one of the tech giants.</sentence>
      <sentence>And so, then, was he.</sentence>
    </expected>
  </test>
  <test>
    <input>This agenda was seen by many to have been put on the back burner, as the Prime Minister and her government busied themselves with Brexit negotiations. Yet collapses at Carillion and BHS brought the issue of so-called "irresponsible capitalism" back onto the front pages, and politicians lined up to poor scorn over the companies' former directors. The firms' downfalls left tens of thousands of workers without jobs, and gaping pension deficits. Combined, they will cost the taxpayer upwards of £180m. Today's proposals are an attempt by the government to rein in the most reckless directors, and stop a practice known as "phoenixing", in which an indebted business becomes insolvent, only to be re-launched under a different name. The question is whether the powers handed to the Insolvency Service - to impose fines and disqualify directors accused of such behaviour - will be enough of a deterrent. Corporate governance, Ms Tolhurst said, was being upgraded to give powers to authorities "to investigate and hold responsible directors who attempt to shy away from their responsibilities"</input>
    <expected>
      <sentence>This agenda was seen by many to have been put on the back burner, as the Prime Minister and her government busied themselves with Brexit negotiations.</sentence>
      <sentence>Yet collapses at Carillion and BHS brought the issue of so-called "irresponsible capitalism" back onto the front pages, and politicians lined up to poor scorn over the companies' former directors.</sentence>
      <sentence>The firms' downfalls left tens of thousands of workers without jobs, and gaping pension deficits.</sentence>
      <sentence>Combined, they will cost the taxpayer upwards of £180m.</sentence>
      <sentence>Today's proposals are an attempt by the government to rein in the most reckless directors, and stop a practice known as "phoenixing", in which an indebted business becomes insolvent, only to be re-launched under a different name.</sentence>
      <sentence>The question is whether the powers handed to the Insolvency Service - to impose fines and disqualify directors accused of such behaviour - will be enough of a deterrent.</sentence>
      <sentence>Corporate governance, Ms Tolhurst said, was being upgraded to give powers to authorities "to investigate and hold responsible directors who attempt to shy away from their responsibilities"</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>Rock stars of the 1970s were not kind to hotels. In Life's Been Good, sometime Eagles guitarist Joe Walsh describes the process bluntly. "I live in hotels, tear out the walls," he confesses: "I have accountants pay for it all." "It all" being a small fortune. In the official history of the band, Walsh recalls a single night at Chicago's Astor Towers in which he and Blues Brothers star John Belushi managed a $28,000 ( £22,000) damage bill. Among other bands, misuse of the hospitality industry was part of the legend - think of Led Zeppelin drummer John Bonham roaring down the corridors of Los Angeles' Continental Hyatt on a Harley Davidson he'd got for his birthday, or The Who's drummer Keith Moon, on his own birthday, ploughing a Lincoln Continental into the swimming pool of Flint Michigan's Holiday Inn. But the Eagles? The laid-back, cleanly-coiffed band who urged America: "We oughta take it easy"?</input>
    <expected>
      <sentence>Rock stars of the 1970s were not kind to hotels.</sentence>
      <sentence>In Life's Been Good, sometime Eagles guitarist Joe Walsh describes the process bluntly.</sentence>
      <sentence>"I live in hotels, tear out the walls," he confesses: "I have accountants pay for it all."</sentence>
      <sentence>"It all" being a small fortune.</sentence>
      <sentence>In the official history of the band, Walsh recalls a single night at Chicago's Astor Towers in which he and Blues Brothers star John Belushi managed a $28,000 ( £22,000) damage bill.</sentence>
      <sentence>Among other bands, misuse of the hospitality industry was part of the legend - think of Led Zeppelin drummer John Bonham roaring down the corridors of Los Angeles' Continental Hyatt on a Harley Davidson he'd got for his birthday, or The Who's drummer Keith Moon, on his own birthday, ploughing a Lincoln Continental into the swimming pool of Flint Michigan's Holiday Inn.</sentence>
      <sentence>But the Eagles?</sentence>
      <sentence>The laid-back, cleanly-coiffed band who urged America: "We oughta take it easy"?</sentence>
    </expected>
  </test>
  <test>
    <input>A British-assembled satellite has been launched into space to make the first truly global maps of wind behaviour. The Aeolus spacecraft will get its data by firing a powerful laser down into the atmosphere to trace the movement of air particles. Meteorologists are hopeful the mission will have a big impact on the quality of medium-range weather forecasts. Aeolus launched on a Vega rocket from French Guiana at 6.20 p.m. local time (22:20 BST). The rocket was due to lift off on Tuesday, but the launch was postponed - ironically - due to high altitude winds. The satellite should begin a programme of testing once it is safely at an altitude of 320km. Team members hope that routine forecasting should be incorporating the laser's information within the year.</input>
    <expected>
      <sentence>A British-assembled satellite has been launched into space to make the first truly global maps of wind behaviour.</sentence>
      <sentence>The Aeolus spacecraft will get its data by firing a powerful laser down into the atmosphere to trace the movement of air particles.</sentence>
      <sentence>Meteorologists are hopeful the mission will have a big impact on the quality of medium-range weather forecasts.</sentence>
      <sentence>Aeolus launched on a Vega rocket from French Guiana at 6.20 p.m. local time (22:20 BST).</sentence>
      <sentence>The rocket was due to lift off on Tuesday, but the launch was postponed - ironically - due to high altitude winds.</sentence>
      <sentence>The satellite should begin a programme of testing once it is safely at an altitude of 320km.</sentence>
      <sentence>Team members hope that routine forecasting should be incorporating the laser's information within the year.</sentence>
    </expected>
  </test>
  <test>
    <input>An international analysis of the global climate of 2017 has been published in the annual report, ‘State of the Climate in 2017’ released yesterday by the American Meteorological Society. The report highlights that 2017 is among the top three warmest years for global temperature since records began in 1850, following on from 2015 and 2016 as the other warmest years. Global surface temperatures were between 0.38 and 0.48 °C above the 1981-2010 average. This places 2017 as the warmest year on record in which El Niño did not play a role in amplifying global surface temperatures.</input>
    <expected>
      <sentence>An international analysis of the global climate of 2017 has been published in the annual report, ‘State of the Climate in 2017’ released yesterday by the American Meteorological Society.</sentence>
      <sentence>The report highlights that 2017 is among the top three warmest years for global temperature since records began in 1850, following on from 2015 and 2016 as the other warmest years.</sentence>
      <sentence>Global surface temperatures were between 0.38 and 0.48 °C above the 1981-2010 average.</sentence>
      <sentence>This places 2017 as the warmest year on record in which El Niño did not play a role in amplifying global surface temperatures.</sentence>
    </expected>
  </test>
  <test>
    <input>Dr Robert Dunn is a Senior Scientist at the Met Office Hadley Centre, and co-edited the global climate chapter of the report. He said: “Despite 2017’s surface temperatures not breaking the absolute record, the fact that it is following the pattern of one warm year after another is concerning and we are seeing impacts of these warmer temperatures around the world”. Atmospheric greenhouse gases reached their highest levels in the instrumental record in 2017, with average CO2 concentrations reaching a record high of 405p.p.m. Glaciers have lost ice for the 38th successive year and with sea surface temperatures close behind the record set in 2016, we are continuing to see severe damage to coral reefs, with one particularly destructive bleaching event lasting three years. The report also describes some of the extreme weather events that occurred in 2017. Dr Dunn added, “Extreme weather events have always been a feature of our climate, and 2017 also experienced some notable events. In 2017 extreme rainfall in Venezuela triggered the most devastating floods in over a decade, whilst Hurricane Harvey set new rainfall records in Texas. In contrast, extreme drought affected at least 3% of global land area each month, a figure matched only in 1984, 1985, and 2016.”</input>
    <expected>
      <sentence>Dr Robert Dunn is a Senior Scientist at the Met Office Hadley Centre, and co-edited the global climate chapter of the report.</sentence>
      <sentence>He said: “Despite 2017’s surface temperatures not breaking the absolute record, the fact that it is following the pattern of one warm year after another is concerning and we are seeing impacts of these warmer temperatures around the world”.</sentence>
      <sentence>Atmospheric greenhouse gases reached their highest levels in the instrumental record in 2017, with average CO2 concentrations reaching a record high of 405p.p.m.</sentence>
      <sentence>Glaciers have lost ice for the 38th successive year and with sea surface temperatures close behind the record set in 2016, we are continuing to see severe damage to coral reefs, with one particularly destructive bleaching event lasting three years.</sentence>
      <sentence>The report also describes some of the extreme weather events that occurred in 2017.</sentence>
      <sentence>Dr Dunn added, “Extreme weather events have always been a feature of our climate, and 2017 also experienced some notable events. In 2017 extreme rainfall in Venezuela triggered the most devastating floods in over a decade, whilst Hurricane Harvey set new rainfall records in Texas. In contrast, extreme drought affected at least 3% of global land area each month, a figure matched only in 1984, 1985, and 2016.”</sentence>
    </expected>
  </test>
  <test>
    <input>The highest temperature recorded so far this year is 35.3 °C at Faversham, Kent on 26 July. The highest temperature recorded in 2017 was 34.5° C at Heathrow on 21st June. Prior to this, the most recent heatwave prior to this was in July 2015 when temperatures peaked at 36.7 °C at Heathrow on 1 July, a temperature that is currently the July all-time maximum record. The all-time record in the UK is 38.5° C at Faversham on 10 August 2003. The dry spell has been most prolonged in East Anglia and Southeast England. Most especially much of East Anglia and Cambridgeshire, extending through Essex into London and also around Bournemouth and Southampton. Parts of the Midlands have also been very dry. The last day of very widespread rainfall for East Anglia and the south-east was 29 May. A Level 3 heat-health watch has been issued in association with Public Health England, for a large part of England. The Heat Health Watch Service is designed to help healthcare professionals manage through periods of extreme temperature. Hot weather, especially when prolonged, with warm nights, can have effects on people's health and on certain infrastructure. To aid preparation and awareness before and during a prolonged hot spell, a heatwave plan has been created by Public Health England in association with the Met Office and other partners. It recommends a series of steps to reduce the risks to health from prolonged exposure to severe heat for:</input>
    <expected>
      <sentence>The highest temperature recorded so far this year is 35.3 °C at Faversham, Kent on 26 July.</sentence>
      <sentence>The highest temperature recorded in 2017 was 34.5° C at Heathrow on 21st June.</sentence>
      <sentence>Prior to this, the most recent heatwave prior to this was in July 2015 when temperatures peaked at 36.7 °C at Heathrow on 1 July, a temperature that is currently the July all-time maximum record.</sentence>
      <sentence>The all-time record in the UK is 38.5° C at Faversham on 10 August 2003.</sentence>
      <sentence>The dry spell has been most prolonged in East Anglia and Southeast England.</sentence>
      <sentence>Most especially much of East Anglia and Cambridgeshire, extending through Essex into London and also around Bournemouth and Southampton.</sentence>
      <sentence>Parts of the Midlands have also been very dry.</sentence>
      <sentence>The last day of very widespread rainfall for East Anglia and the south-east was 29 May.</sentence>
      <sentence>A Level 3 heat-health watch has been issued in association with Public Health England, for a large part of England.</sentence>
      <sentence>The Heat Health Watch Service is designed to help healthcare professionals manage through periods of extreme temperature.</sentence>
      <sentence>Hot weather, especially when prolonged, with warm nights, can have effects on people's health and on certain infrastructure.</sentence>
      <sentence>To aid preparation and awareness before and during a prolonged hot spell, a heatwave plan has been created by Public Health England in association with the Met Office and other partners.</sentence>
      <sentence>It recommends a series of steps to reduce the risks to health from prolonged exposure to severe heat for:</sentence>
    </expected>
  </test>
  <test>
    <input>The Mayor is investing £200m in accessibility and step-free access across the Tube network, the largest investment of its kind in the history of the Underground, in order to bring the total number of step-free stations to more than 100, more than 40 per cent of the network by 2022.</input>
    <expected>
      <sentence>The Mayor is investing £200m in accessibility and step-free access across the Tube network, the largest investment of its kind in the history of the Underground, in order to bring the total number of step-free stations to more than 100, more than 40 per cent of the network by 2022.</sentence>
    </expected>
  </test>
  <test>
    <input>Bond Street station, where an agreement has been signed with Grosvenor Britain &amp; Ireland to develop 110,000 sq ft of floor space above the western ticket hall. The proposed scheme comprises six floors of office accommodation above the station, served by an entrance lobby on Davies Street</input>
    <expected>
      <sentence>Bond Street station, where an agreement has been signed with Grosvenor Britain &amp; Ireland to develop 110,000 sq ft of floor space above the western ticket hall.</sentence>
      <sentence>The proposed scheme comprises six floors of office accommodation above the station, served by an entrance lobby on Davies Street</sentence>
    </expected>
  </test>
  <test>
    <input>Eight schemes are currently under construction, with an expected leasable area totalling 4.1 million sq ft and value of £1.5 billion. (All subjects to possible changes in planning, permitting and construction as well as general market conditions.) With capital exceeding £1.1 billion and a team of 700 people, we're proud to say that HB Reavis is among the European market leaders in real estate.</input>
    <expected>
      <sentence>Eight schemes are currently under construction, with an expected leasable area totalling 4.1 million sq ft and value of £1.5 billion.</sentence>
      <sentence>(All subjects to possible changes in planning, permitting and construction as well as general market conditions.)</sentence>
      <sentence>With capital exceeding £1.1 billion and a team of 700 people, we're proud to say that HB Reavis is among the European market leaders in real estate.</sentence>
    </expected>
  </test>
  <test>
    <input>These include images of various modes of transport, TfL services and members of the senior management team, all available in .jpeg format. Images can be downloaded from the Flickr site: http://www.flickr.com/tflpress</input>
    <expected>
      <sentence>These include images of various modes of transport, TfL services and members of the senior management team, all available in .jpeg format.</sentence>
      <sentence>Images can be downloaded from the Flickr site: http://www.flickr.com/tflpress</sentence>
    </expected>
  </test>
  <test>
    <input>Use your contactless payment or Oyster card to pay as you go all the way to the departures terminal at Gatwick. It's the easiest way to pay for your travel from London, but some National Rail tickets are cheaper - such as returns, season tickets and group tickets.</input>
    <expected>
      <sentence>Use your contactless payment or Oyster card to pay as you go all the way to the departures terminal at Gatwick.</sentence>
      <sentence>It's the easiest way to pay for your travel from London, but some National Rail tickets are cheaper - such as returns, season tickets and group tickets.</sentence>
    </expected>
  </test>
  <test>
    <input>Land monopoly is not the only monopoly, but it is by far the greatest of monopolies -- it is a perpetual monopoly, and it is the mother of all other forms of monopoly. Unearned increments in land are not the only form of unearned or undeserved profit, but they are the principal form of unearned increment, and they are derived from processes which are not merely not beneficial, but positively detrimental to the general public. Land, which is a necessity of human existence, which is the original source of all wealth, which is strictly limited in extent, which is fixed in geographical position -- land, I say, differs from all other forms of property, and the immemorial customs of nearly every modern state have placed the tenure, transfer, and obligations of land in a wholly different category from other classes of property.</input>
    <expected>
      <sentence>Land monopoly is not the only monopoly, but it is by far the greatest of monopolies -- it is a perpetual monopoly, and it is the mother of all other forms of monopoly.</sentence>
      <sentence>Unearned increments in land are not the only form of unearned or undeserved profit, but they are the principal form of unearned increment, and they are derived from processes which are not merely not beneficial, but positively detrimental to the general public.</sentence>
      <sentence>Land, which is a necessity of human existence, which is the original source of all wealth, which is strictly limited in extent, which is fixed in geographical position -- land, I say, differs from all other forms of property, and the immemorial customs of nearly every modern state have placed the tenure, transfer, and obligations of land in a wholly different category from other classes of property.</sentence>
    </expected>
  </test>
  <test>
    <input>Few regions in Middle America are so important zoogeographically as is the Isthmus of Tehuantepec, that neck of land connecting North America with Central America, separating the Pacific Ocean from the Gulf of Mexico by a distance of only about 220 kilometers (airline), and forming a low break between the highlands of México and those of Central America. Before World War II the isthmus could be reached readily only by railroad or by ocean vessel to Salina Cruz or Coatzacoalcos. With the advent of roads, principally the Trans-isthmian Highway, vast areas of the interior of the isthmus became accessible to biologists. Nevertheless, long before roads were built in the isthmian region collectors and biologists visited it, especially the town of Tehuantepec, from which collections date back to the 1870's. Therefore, it is rather surprising that no attempt has been made to present a faunal list of the amphibians or reptiles of the isthmus. Ruthven (1912) summarized his collections from the vicinity of Cuatotolapam, Veracruz, and Hartweg and Oliver (1940) presented an annotated list of the species collected by them in the vicinity of Tehuantepec. In recent years there have been only a few papers reporting species from the isthmus (Fugler and Webb, 1957; Langebartel and Smith, 1959). The zoogeographic significance of the Isthmus of Tehuantepec is exemplified by the works of Burt (1931), Duellman (1958), Gloyd (1940), Oliver (1948), and Stuart (1941), who in their discussions of evolution and dispersal of various genera of reptiles, pointed out that the Isthmus of Tehuantepec was a region of zoogeographic importance.</input>
    <expected>
      <sentence>Few regions in Middle America are so important zoogeographically as is the Isthmus of Tehuantepec, that neck of land connecting North America with Central America, separating the Pacific Ocean from the Gulf of Mexico by a distance of only about 220 kilometers (airline), and forming a low break between the highlands of México and those of Central America.</sentence>
      <sentence>Before World War II the isthmus could be reached readily only by railroad or by ocean vessel to Salina Cruz or Coatzacoalcos.</sentence>
      <sentence>With the advent of roads, principally the Trans-isthmian Highway, vast areas of the interior of the isthmus became accessible to biologists.</sentence>
      <sentence>Nevertheless, long before roads were built in the isthmian region collectors and biologists visited it, especially the town of Tehuantepec, from which collections date back to the 1870's.</sentence>
      <sentence>Therefore, it is rather surprising that no attempt has been made to present a faunal list of the amphibians or reptiles of the isthmus.</sentence>
      <sentence>Ruthven (1912) summarized his collections from the vicinity of Cuatotolapam, Veracruz, and Hartweg and Oliver (1940) presented an annotated list of the species collected by them in the vicinity of Tehuantepec.</sentence>
      <sentence>In recent years there have been only a few papers reporting species from the isthmus (Fugler and Webb, 1957; Langebartel and Smith, 1959).</sentence>
      <sentence>The zoogeographic significance of the Isthmus of Tehuantepec is exemplified by the works of Burt (1931), Duellman (1958), Gloyd (1940), Oliver (1948), and Stuart (1941), who in their discussions of evolution and dispersal of various genera of reptiles, pointed out that the Isthmus of Tehuantepec was a region of zoogeographic importance.</sentence>
    </expected>
  </test>
  <test>
    <input>My extensive field work in the Isthmus of Tehuantepec was made possible by grants from the Penrose Fund of the American Philosophical Society (1956) and the Bache Fund of the National Academy of Sciences (1958). Furthermore, my field work received the hearty support of the Museum of Zoology at the University of Michigan; for their cooperation I am indebted to Norman Hartweg, T. H. Hubbell, and Henry van der Schalie. In the course of my studies I received helpful suggestions from Norman Hartweg, L. C. Stuart, and Charles F. Walker, to whom I am grateful. For permission to examine specimens in their care I thank Doris M. Cochran, Hobart M. Smith, and Richard G. Zweifel. I am deeply indebted to Thomas MacDougall for many suggestions and for aid in preparing the gazetteer. I am most grateful for the efforts of my field companions, Richard E. Etheridge, Jerome B. Tulecke, John Wellman, and especially my wife, Ann S. Duellman, who spent many long days and nights gathering much of the data on which this report is based. Our work in the isthmus was furthered by the generous help and hospitality of many residents, especially the late Wilbur Barker of Tehuantepec, Fortunado Delgado of Rancho Las Hojitas near Acayucan, César Fárjas of Donají, and Juan Mayol of San Andrés Tuxtla. Profesor Jordi Juliá Z. of the Laboratorio de Entomología, Comisión del Papaloapan, Ciudad Alemán, Veracruz, helped make possible my field work in 1959; for this he has my sincere thanks. In conclusion I express my gratitude to Ing. Juan Lozano Franco, Secretaria de Agricultura y Ganadería, for providing me with the necessary permits.</input>
    <expected>
      <sentence>My extensive field work in the Isthmus of Tehuantepec was made possible by grants from the Penrose Fund of the American Philosophical Society (1956) and the Bache Fund of the National Academy of Sciences (1958).</sentence>
      <sentence>Furthermore, my field work received the hearty support of the Museum of Zoology at the University of Michigan; for their cooperation I am indebted to Norman Hartweg, T. H. Hubbell, and Henry van der Schalie.</sentence>
      <sentence>In the course of my studies I received helpful suggestions from Norman Hartweg, L. C. Stuart, and Charles F. Walker, to whom I am grateful.</sentence>
      <sentence>For permission to examine specimens in their care I thank Doris M. Cochran, Hobart M. Smith, and Richard G. Zweifel.</sentence>
      <sentence>I am deeply indebted to Thomas MacDougall for many suggestions and for aid in preparing the gazetteer.</sentence>
      <sentence>I am most grateful for the efforts of my field companions, Richard E. Etheridge, Jerome B. Tulecke, John Wellman, and especially my wife, Ann S. Duellman, who spent many long days and nights gathering much of the data on which this report is based.</sentence>
      <sentence>Our work in the isthmus was furthered by the generous help and hospitality of many residents, especially the late Wilbur Barker of Tehuantepec, Fortunado Delgado of Rancho Las Hojitas near Acayucan, César Fárjas of Donají, and Juan Mayol of San Andrés Tuxtla.</sentence>
      <sentence>Profesor Jordi Juliá Z. of the Laboratorio de Entomología, Comisión del Papaloapan, Ciudad Alemán, Veracruz, helped make possible my field work in 1959; for this he has my sincere thanks.</sentence>
      <sentence>In conclusion I express my gratitude to Ing. Juan Lozano Franco, Secretaria de Agricultura y Ganadería, for providing me with the necessary permits.</sentence>
    </expected>
  </test>
  <test>
    <input>The central ridges extend from the Río Jaltepec southward to within 40 kilometers of the Pacific coast. It is in this area that the continuity of the high ridges and volcanic peaks, which extend nearly the entire length of the Americas, is interrupted at a point almost directly in line with the shortest distance between the two oceans. The northern part of this central region consists of hills dissected by tributaries of the Río Coatzacoalcos; the principal ones from north to south are—Río Jaltepec, Río Tortuguero, Río Sarabia, and Río Malatengo. The plains of Chivela are south of these rivers and lie at an elevation of about 200 meters; at the southern edge of these plains a range of hills rises to 250 to 400 meters above sea level. These hills drop abruptly to the Plains of Tehuantepec. In the northern and central parts of this central region the rocks are granitic; the hills to the south of the Plains of Chivela are limestone.</input>
    <expected>
      <sentence>The central ridges extend from the Río Jaltepec southward to within 40 kilometers of the Pacific coast.</sentence>
      <sentence>It is in this area that the continuity of the high ridges and volcanic peaks, which extend nearly the entire length of the Americas, is interrupted at a point almost directly in line with the shortest distance between the two oceans.</sentence>
      <sentence>The northern part of this central region consists of hills dissected by tributaries of the Río Coatzacoalcos; the principal ones from north to south are—Río Jaltepec, Río Tortuguero, Río Sarabia, and Río Malatengo.</sentence>
      <sentence>The plains of Chivela are south of these rivers and lie at an elevation of about 200 meters; at the southern edge of these plains a range of hills rises to 250 to 400 meters above sea level.</sentence>
      <sentence>These hills drop abruptly to the Plains of Tehuantepec.</sentence>
      <sentence>In the northern and central parts of this central region the rocks are granitic; the hills to the south of the Plains of Chivela are limestone.</sentence>
    </expected>
  </test>
  <test>
    <input>The one-word percent is standard in American English. Percent is not absent from other varieties of English, but most publications still prefer the two-word per cent. The older forms per-cent, per cent. (per cent followed by a period), and the original per centum have mostly disappeared from the language (although the latter sometimes appears in legal writing).</input>
    <expected>
      <sentence>The one-word percent is standard in American English.</sentence>
      <sentence>Percent is not absent from other varieties of English, but most publications still prefer the two-word per cent.</sentence>
      <sentence>The older forms per-cent, per cent. (per cent followed by a period), and the original per centum have mostly disappeared from the language (although the latter sometimes appears in legal writing).</sentence>
    </expected>
  </test>
  <test>
    <input>We generated a mouse model of heart-specific prothrombin overexpression (PT-TG mice). The cDNA encoding mouse prothrombin was subcloned into the αMHC (myosin heavy chain) expression cassette via Xba/EcoRsites and transgenic mice (C57BL/6) were generated and screened by Southern blotting of DNA from tail biopsy specimens using two primer mixtures (5’-CTGAAAAGTTAACCAGGTGAGAATG, 5’- TGAGTTTGGACAAACCACAACTAGA). We used 8-week-old PT-TG mice and wild-type mice. 4-week-old and 8-week-old mice were subjected to transthoracic echocardiography using a Vivid7 echocardiogram unit (General Electric, Tampa, FL). Systolic blood pressure and heart rate of 8-week old wild-type mice were monitored with a tail-cuff system (BP-98A, Softron, Tokyo, Japan). The real-time PCR protocol consisted of one cycle at 95°C for 20 s followed by 40 cycles at 95°C for 1 s and 60°C for 20 s using primers for prothrombin (Applied Biosystems, Mm00438843_m1) and Glyceraldehyde 3- phosphate dehydrogenase (GAPDH) (Applied Biosystems, Mm03302249_g1). The transcriptional levels were determined using the ΔΔCt method, with normalization to the transcriptional level of GAPDH. The results are presented as the mean ± standard error of the mean, and comparisons between two groups were made using the Wilcoxon test. Survival curves were generated using the Kaplan-Meier method (MedCalc Software, Mariakerke, Belgium). P values of &lt;0.05 were considered to indicate statistical significance. All of the statistical analyses (other than the survival curves) were performed using the SPSS software program (version 21, SPSS Japan Inc., Tokyo, Japan).</input>
    <expected>
      <sentence>We generated a mouse model of heart-specific prothrombin overexpression (PT-TG mice).</sentence>
      <sentence>The cDNA encoding mouse prothrombin was subcloned into the αMHC (myosin heavy chain) expression cassette via Xba/EcoRsites and transgenic mice (C57BL/6) were generated and screened by Southern blotting of DNA from tail biopsy specimens using two primer mixtures (5’-CTGAAAAGTTAACCAGGTGAGAATG, 5’- TGAGTTTGGACAAACCACAACTAGA).</sentence>
      <sentence>We used 8-week-old PT-TG mice and wild-type mice.</sentence>
      <sentence>4-week-old and 8-week-old mice were subjected to transthoracic echocardiography using a Vivid7 echocardiogram unit (General Electric, Tampa, FL).</sentence>
      <sentence>Systolic blood pressure and heart rate of 8-week old wild-type mice were monitored with a tail-cuff system (BP-98A, Softron, Tokyo, Japan).</sentence>
      <sentence>The real-time PCR protocol consisted of one cycle at 95°C for 20 s followed by 40 cycles at 95°C for 1 s and 60°C for 20 s using primers for prothrombin (Applied Biosystems, Mm00438843_m1) and Glyceraldehyde 3- phosphate dehydrogenase (GAPDH) (Applied Biosystems, Mm03302249_g1).</sentence>
      <sentence>The transcriptional levels were determined using the ΔΔCt method, with normalization to the transcriptional level of GAPDH.</sentence>
      <sentence>The results are presented as the mean ± standard error of the mean, and comparisons between two groups were made using the Wilcoxon test.</sentence>
      <sentence>Survival curves were generated using the Kaplan-Meier method (MedCalc Software, Mariakerke, Belgium).</sentence>
      <sentence>P values of &lt;0.05 were considered to indicate statistical significance.</sentence>
      <sentence>All of the statistical analyses (other than the survival curves) were performed using the SPSS software program (version 21, SPSS Japan Inc., Tokyo, Japan).</sentence>
    </expected>
  </test>
  <test>
    <input>We examined the prothrombin mRNA in the wild-type mice, however, we could not detect prothrombin mRNA in the heart (Figure 1A). We further analysed the liver prothrombin mRNA in the mice of the wild-type group as positive controls and detected a large amount of prothrombin mRNA (Figure 1B). There were no significant differences in the heart weights between the wild-type mice and the PT-TG mice (Table 1). The echocardiographic investigations showed no significant differences in fractional shortening or in the diameter of the left ventricle (Table 1). Systolic blood pressure and heart rate of 8-week old wild-type mice were 105.3 ± 3.3 mmHg and 611.5 ± 22.4 beats/min, respectively, which means the procedure is not causing changes that could influence the tests (n=6). The heart-specific overexpression of prothrombin did not worsen their life span and no thromboembolic complications were observed (Figure 1C).</input>
    <expected>
      <sentence>We examined the prothrombin mRNA in the wild-type mice, however, we could not detect prothrombin mRNA in the heart (Figure 1A).</sentence>
      <sentence>We further analysed the liver prothrombin mRNA in the mice of the wild-type group as positive controls and detected a large amount of prothrombin mRNA (Figure 1B).</sentence>
      <sentence>There were no significant differences in the heart weights between the wild-type mice and the PT-TG mice (Table 1).</sentence>
      <sentence>The echocardiographic investigations showed no significant differences in fractional shortening or in the diameter of the left ventricle (Table 1).</sentence>
      <sentence>Systolic blood pressure and heart rate of 8-week old wild-type mice were 105.3 ± 3.3 mmHg and 611.5 ± 22.4 beats/min, respectively, which means the procedure is not causing changes that could influence the tests (n=6).</sentence>
      <sentence>The heart-specific overexpression of prothrombin did not worsen their life span and no thromboembolic complications were observed (Figure 1C).</sentence>
    </expected>
  </test>
  <test>
    <input>DHF was first reported in Calcutta (Kolkata), West Bengal in 1963 and 1964 [10,11], and due to the co-circulation of all four DENV (DENV1, DENV2, DENV3 and DENV4) serotypes this region has been designated as hyper-endemic [12]. Several dengue episodes hit Kolkata from time to time [13,14], while reports of dengue hits have currently been available from previously unaffected rural of West Bengal too [13,15,16]. Dengue cases have been detected among populations from different districts of West Bengal, including Kolkata sharing the majority (74.32%) of the cases, during 2010-2012, due to multiple DENV serotypes: DENV1, DENV3, and DENV4 [17]. Currently, reports are available on the emergence of a new antigenically distinct DENV serotype (DENV5) from Malaysian origin [18] and taking this in account Kolkata and many other parts of India, possessing all suitable niches for the virus as well as the vectors, may provide a favourable home for DENV5 too.</input>
    <expected>
      <sentence>DHF was first reported in Calcutta (Kolkata), West Bengal in 1963 and 1964 [10,11], and due to the co-circulation of all four DENV (DENV1, DENV2, DENV3 and DENV4) serotypes this region has been designated as hyper-endemic [12].</sentence>
      <sentence>Several dengue episodes hit Kolkata from time to time [13,14], while reports of dengue hits have currently been available from previously unaffected rural of West Bengal too [13,15,16].</sentence>
      <sentence>Dengue cases have been detected among populations from different districts of West Bengal, including Kolkata sharing the majority (74.32%) of the cases, during 2010-2012, due to multiple DENV serotypes: DENV1, DENV3, and DENV4 [17].</sentence>
      <sentence>Currently, reports are available on the emergence of a new antigenically distinct DENV serotype (DENV5) from Malaysian origin [18] and taking this in account Kolkata and many other parts of India, possessing all suitable niches for the virus as well as the vectors, may provide a favourable home for DENV5 too.</sentence>
    </expected>
  </test>
  <test>
    <input>Agriculture is an integral part of the UK countryside. It matters beyond its economic contribution. Farming makes up over 70% of the UK landscape [EC:14]. It shapes the countryside, influences the quality of our environment, affects the health and abundance of UK wildlife [EC:12] and supports rural communities [EC:04]. Maintaining and improving the economic, environmental and wider benefits derived from farming will be essential as we leave the EU. The UK’s farmed land is rich in social and cultural heritage and significance. The food we eat affects our health and well-being and our connectedness to the world around us. The food production to supply ratio of indigenous food was 76% in 2016 [EC:51]. Food production provides an essential basis for food and drink sector industries and contributes towards the £18 billion of UK food and drink exports. Agriculture is also an important livelihood for many in the UK, employing 1.5% of the UK workforce, or 500,000 people [EC:16]. A number of public goods arise from farming and forestry. This includes contributing to the protection and enhancement of the character of our historic landscapes; biodiversity and environmental provision; climate change mitigation [EC:56]; innovation and development which provide consumers with better, safer, cheaper food; and animal disease surveillance and control.</input>
    <expected>
      <sentence>Agriculture is an integral part of the UK countryside.</sentence>
      <sentence>It matters beyond its economic contribution.</sentence>
      <sentence>Farming makes up over 70% of the UK landscape [EC:14].</sentence>
      <sentence>It shapes the countryside, influences the quality of our environment, affects the health and abundance of UK wildlife [EC:12] and supports rural communities [EC:04].</sentence>
      <sentence>Maintaining and improving the economic, environmental and wider benefits derived from farming will be essential as we leave the EU.</sentence>
      <sentence>The UK’s farmed land is rich in social and cultural heritage and significance.</sentence>
      <sentence>The food we eat affects our health and well-being and our connectedness to the world around us.</sentence>
      <sentence>The food production to supply ratio of indigenous food was 76% in 2016 [EC:51].</sentence>
      <sentence>Food production provides an essential basis for food and drink sector industries and contributes towards the £18 billion of UK food and drink exports.</sentence>
      <sentence>Agriculture is also an important livelihood for many in the UK, employing 1.5% of the UK workforce, or 500,000 people [EC:16].</sentence>
      <sentence>A number of public goods arise from farming and forestry.</sentence>
      <sentence>This includes contributing to the protection and enhancement of the character of our historic landscapes; biodiversity and environmental provision; climate change mitigation [EC:56]; innovation and development which provide consumers with better, safer, cheaper food; and animal disease surveillance and control.</sentence>
    </expected>
  </test>
  <test>
    <input>The museum contains Old Master paintings, miniatures, sculpture, French furniture, porcelain and goldsmiths’ work, European, African and Asian arms and armour, and medieval and Renaissance works of art. All are of the highest quality and of international importance. Its holdings of French eighteenth-century art, European princely arms and armour, and Old Master paintings are internationally outstanding. Lady Wallace’s bequest stipulated that the collection should be preserved as a national museum ‘and shall be kept together unmixed with other works of art’. This has traditionally been understood to mean that the Collection cannot be added to and cannot lend.  </input>
    <expected>
      <sentence>The museum contains Old Master paintings, miniatures, sculpture, French furniture, porcelain and goldsmiths’ work, European, African and Asian arms and armour, and medieval and Renaissance works of art.</sentence>
      <sentence>All are of the highest quality and of international importance.</sentence>
      <sentence>Its holdings of French eighteenth-century art, European princely arms and armour, and Old Master paintings are internationally outstanding.</sentence>
      <sentence>Lady Wallace’s bequest stipulated that the collection should be preserved as a national museum ‘and shall be kept together unmixed with other works of art’.</sentence>
      <sentence>This has traditionally been understood to mean that the Collection cannot be added to and cannot lend.</sentence>
    </expected>
  </test>
  <test>
    <input>As part of the “Views of Venice “ project, Canaletto’s two large views across the Bacino di San Marco were displayed in the Great Gallery after they returned from eight months of conservation treatment. They were enthusiastically received by visitors who enjoyed viewing them in the Great Gallery among the Wallace Collection’s other great pendants by Van Dyck and Rembrandt. Five smaller vedute paintings by followers of Canaletto have also been conserved.</input>
    <expected>
      <sentence>As part of the “Views of Venice “ project, Canaletto’s two large views across the Bacino di San Marco were displayed in the Great Gallery after they returned from eight months of conservation treatment.</sentence>
      <sentence>They were enthusiastically received by visitors who enjoyed viewing them in the Great Gallery among the Wallace Collection’s other great pendants by Van Dyck and Rembrandt.</sentence>
      <sentence>Five smaller vedute paintings by followers of Canaletto have also been conserved.</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>Jacobsen, Helen, ‘Magnificent Display: European Ambassadorial Visitors to Versailles’, in Visitors to Versailles from Louis XIV to the French Revolution, ed. Danielle O. KislukGrosheide and Bertrand Rondot, ex. cat., (Metropolitan Museum of Art, New York) </input>
    <expected>
      <sentence>Jacobsen, Helen, ‘Magnificent Display: European Ambassadorial Visitors to Versailles’, in Visitors to Versailles from Louis XIV to the French Revolution, ed. Danielle O. KislukGrosheide and Bertrand Rondot, ex. cat., (Metropolitan Museum of Art, New York)</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>“Combined application of imaging techniques for the characterization and authentication of ancient weapons”, Filomena Salvemini, Francesco Grazzi, Nikolay Kardjilov, Frank Wieder, Ingo Manke, David Edge, Alan Williams, Marco Zoppi, in The European Physical Journal Plus, online 24 May 2017, pp. 132-228 (Eur. Phys. J. Plus (2017) 132: 228, DOI: 10.1140/epjp/i2017-11496-6)</input>
    <expected>
      <sentence>“Combined application of imaging techniques for the characterization and authentication of ancient weapons”, Filomena Salvemini, Francesco Grazzi, Nikolay Kardjilov, Frank Wieder, Ingo Manke, David Edge, Alan Williams, Marco Zoppi, in The European Physical Journal Plus, online 24 May 2017, pp. 132-228 (Eur. Phys. J. Plus (2017) 132: 228, DOI: 10.1140/epjp/i2017-11496-6)</sentence>
    </expected>
  </test>
  <test>
    <input>The largest source of income was Grant-in-Aid from the Department for Digital, Culture, Media and Sport. Including the additional £1m for Capital projects this was £3.711m (2016–17: £2.711m) which represented 47% of the group’s non-endowment income for the year (2016-17: 43%). Other donations reached £2.416m, an increase on the previous year’s total of £1.897m. This year the Collection raised £1.2m for the new exhibition space, however, prior year donations include £570,000 pro bono consultancy support and £272,000 raised from a Gala dinner; there were no similar donations this year. Trading income increased to £1.409m from £1.367m in 2016-17, largely due to a strong performance by the Collection’s Events department. Expenditure decreased from £6.932m in 2016-17 to £6.825m. The main reason for the slight decrease was the receipt of pro bono support of £570,000 in 2016-17 for which there is no comparable transaction this year. (This support is offset by the inclusion of a pro bono donation of an equal amount in income and the net effect on the result for the year is £nil.). The museum launched an endowment fund in 2015-16 and continued to build the fund in 2017-18 with further donations of £1.054m. The endowment is a permanent one from which the museum can use the income to support its unrestricted and restricted activities.  </input>
    <expected>
      <sentence>The largest source of income was Grant-in-Aid from the Department for Digital, Culture, Media and Sport.</sentence>
      <sentence>Including the additional £1m for Capital projects this was £3.711m (2016–17: £2.711m) which represented 47% of the group’s non-endowment income for the year (2016-17: 43%).</sentence>
      <sentence>Other donations reached £2.416m, an increase on the previous year’s total of £1.897m.</sentence>
      <sentence>This year the Collection raised £1.2m for the new exhibition space, however, prior year donations include £570,000 pro bono consultancy support and £272,000 raised from a Gala dinner; there were no similar donations this year.</sentence>
      <sentence>Trading income increased to £1.409m from £1.367m in 2016-17, largely due to a strong performance by the Collection’s Events department.</sentence>
      <sentence>Expenditure decreased from £6.932m in 2016-17 to £6.825m.</sentence>
      <sentence>The main reason for the slight decrease was the receipt of pro bono support of £570,000 in 2016-17 for which there is no comparable transaction this year.</sentence>
      <sentence>(This support is offset by the inclusion of a pro bono donation of an equal amount in income and the net effect on the result for the year is £nil.).</sentence>
      <sentence>The museum launched an endowment fund in 2015-16 and continued to build the fund in 2017-18 with further donations of £1.054m.</sentence>
      <sentence>The endowment is a permanent one from which the museum can use the income to support its unrestricted and restricted activities.</sentence>
    </expected>
  </test>
  <test>
    <input>Following the establishment of the endowment fund, the museum has financial investments. The investment objectives are to achieve a minimum income yield of 3% and capital growth in real terms over the time horizon of the investment portfolio. There are no specific restrictions on asset types and investment structures subject to their suitability to the portfolio objectives. However, investments in hedge funds, derivative strategies, structured products, real estate and other alternative asset classes are to be considered in the context of the portfolio’s long term objectives and agreed in advance with the museum and its investment advisors. No direct investments are permitted in tobacco or armament companies. Two investment fund managers, Rathbone Investment Management Limited and Troy Asset Management Limited, were appointed in 2015-16 and continued to manage the funds during this year. The total return on the portfolio for the year to March 2018 was 2.23%. The income return was 3.8% and the capital return was 1.21%. The total return underperformed the target of UK RPI plus 3% which was 6.44% in 2017-18. The 12 month income yield to March 2018 was 3.6%, which exceeded the income yield target of 3%.</input>
    <expected>
      <sentence>Following the establishment of the endowment fund, the museum has financial investments.</sentence>
      <sentence>The investment objectives are to achieve a minimum income yield of 3% and capital growth in real terms over the time horizon of the investment portfolio.</sentence>
      <sentence>There are no specific restrictions on asset types and investment structures subject to their suitability to the portfolio objectives.</sentence>
      <sentence>However, investments in hedge funds, derivative strategies, structured products, real estate and other alternative asset classes are to be considered in the context of the portfolio’s long term objectives and agreed in advance with the museum and its investment advisors.</sentence>
      <sentence>No direct investments are permitted in tobacco or armament companies.</sentence>
      <sentence>Two investment fund managers, Rathbone Investment Management Limited and Troy Asset Management Limited, were appointed in 2015-16 and continued to manage the funds during this year.</sentence>
      <sentence>The total return on the portfolio for the year to March 2018 was 2.23%.</sentence>
      <sentence>The income return was 3.8% and the capital return was 1.21%.</sentence>
      <sentence>The total return underperformed the target of UK RPI plus 3% which was 6.44% in 2017-18.</sentence>
      <sentence>The 12 month income yield to March 2018 was 3.6%, which exceeded the income yield target of 3%.</sentence>
    </expected>
  </test>
  <test>
    <input>The Accounts have been prepared in a form directed by the Secretary of State for Digital, Culture, Media and Sport with the consent of HM Treasury in accordance with sections 9(4) and 9(5) of the Museums and Galleries Act 1992. The accounts are compliant with the Charities SORP 2015, Financial Reporting Standard 102, Charities Act 2011, Government Financial Reporting Manual and with Charity Commission guidance. </input>
    <expected>
      <sentence>The Accounts have been prepared in a form directed by the Secretary of State for Digital, Culture, Media and Sport with the consent of HM Treasury in accordance with sections 9(4) and 9(5) of the Museums and Galleries Act 1992.</sentence>
      <sentence>The accounts are compliant with the Charities SORP 2015, Financial Reporting Standard 102, Charities Act 2011, Government Financial Reporting Manual and with Charity Commission guidance.</sentence>
    </expected>
  </test>
  <test>
    <input>For the last three year, from 2015 to 2017, we conduct a cohort observational study, with some interventions. The follow-up and emergencies prehospital cares of these three cohorts of pilgrims was done by a mobile team of health professionals including physicians and nurses. Pilgrims medical triage was done before the travel, based on intellectual capacity and ability to accomplish effort. Retained persons were educated to adopt healthy comportments during their travel. In these three successive years the leadership team was no changed. Interventions done were about rigorous adoption of preventive measures to avoid traumatic accident like what happen in 2015 (The important trampling of Mina) and recommendation of PCV13 vaccination since 2017, after the rise of pneumonia cases observed in 2016. The health group was trained to assure emergency health care on travel, and for that we carried all material needed. A strategic health operating centre (SHOC Room) collect daily data and treated them minutely for making decision and manage sudden events. Because of shortness of information, the SHOC room players use various tools like hospital databases, mobile health applications, social media and administrative travel data to be in aware of event and to monitor occurrence. None minor information was get out before verification by the mobile team who visit daily all residences and all hospitals around the Tunisian’s health care centre.</input>
    <expected>
      <sentence>For the last three year, from 2015 to 2017, we conduct a cohort observational study, with some interventions.</sentence>
      <sentence>The follow-up and emergencies prehospital cares of these three cohorts of pilgrims was done by a mobile team of health professionals including physicians and nurses.</sentence>
      <sentence>Pilgrims medical triage was done before the travel, based on intellectual capacity and ability to accomplish effort.</sentence>
      <sentence>Retained persons were educated to adopt healthy comportments during their travel.</sentence>
      <sentence>In these three successive years the leadership team was no changed.</sentence>
      <sentence>Interventions done were about rigorous adoption of preventive measures to avoid traumatic accident like what happen in 2015 (The important trampling of Mina) and recommendation of PCV13 vaccination since 2017, after the rise of pneumonia cases observed in 2016.</sentence>
      <sentence>The health group was trained to assure emergency health care on travel, and for that we carried all material needed.</sentence>
      <sentence>A strategic health operating centre (SHOC Room) collect daily data and treated them minutely for making decision and manage sudden events.</sentence>
      <sentence>Because of shortness of information, the SHOC room players use various tools like hospital databases, mobile health applications, social media and administrative travel data to be in aware of event and to monitor occurrence.</sentence>
      <sentence>None minor information was get out before verification by the mobile team who visit daily all residences and all hospitals around the Tunisian’s health care centre.</sentence>
    </expected>
  </test>
  <test>
    <input>This frog is abundant throughout the lowlands of the isthmus, where in the dry season individuals were found along streams and beneath rocks at a spring seepage. In the rainy season males were calling from nearly every bit of standing water. The call is a soft clicking sound resembling that made by striking two small stones together. The average snout-vent length of ten adult males is 41.8 mm. There is considerable variation in the extent of the yellowish brown glandular areas on the belly. Some have none, whereas others have a broad area on the chest, a band along the flanks, and a thin band across the lower abdomen. Individuals collected in the dry season vary in the same fashion as do those collected in the rainy season, at which time they were breeding. The glands are equally well-developed in adults of both sexes, and were present in some juveniles with snout-vent lengths of less than 20 mm. Apparently the development of the glands is not associated with maturity, sex, or size.</input>
    <expected>
      <sentence>This frog is abundant throughout the lowlands of the isthmus, where in the dry season individuals were found along streams and beneath rocks at a spring seepage.</sentence>
      <sentence>In the rainy season males were calling from nearly every bit of standing water.</sentence>
      <sentence>The call is a soft clicking sound resembling that made by striking two small stones together.</sentence>
      <sentence>The average snout-vent length of ten adult males is 41.8 mm.</sentence>
      <sentence>There is considerable variation in the extent of the yellowish brown glandular areas on the belly.</sentence>
      <sentence>Some have none, whereas others have a broad area on the chest, a band along the flanks, and a thin band across the lower abdomen.</sentence>
      <sentence>Individuals collected in the dry season vary in the same fashion as do those collected in the rainy season, at which time they were breeding.</sentence>
      <sentence>The glands are equally well-developed in adults of both sexes, and were present in some juveniles with snout-vent lengths of less than 20 mm.</sentence>
      <sentence>Apparently the development of the glands is not associated with maturity, sex, or size.</sentence>
    </expected>
  </test>
  <test>
    <ignored>true</ignored>
    <input>1953. The savanna vegetation of northern tropical America. Ecol. Mono., vol. 23 (2):149-215.</input>
    <expected>
      <sentence>1953. The savanna vegetation of northern tropical America. Ecol. Mono., vol. 23 (2):149-215.</sentence>
    </expected>
  </test>
  <test>
    <input>The largest male has a snout-vent length of 132 mm., the largest female, 114 mm., and the smallest juvenile, 34 mm. The number of dorsal granules at the midbody varies from 91 to 117 (106.2 ± 0.43); the ratio of the number of granules between the paravertebral stripes to the number of granules around the body (PV/GAB) varies from 0.064 to 0.157 (0.097 ±0.007); the number of femoral pores varies from 32 to 49 (41.1 ± 0.20). Usually there are only three enlarged preanals, but 18 specimens have a somewhat enlarged scale anterior to the normal complement of three. In 15 specimens the supraorbital semicircle-series terminate short of the posterior edge of the frontal; in the others the series reach the frontal.</input>
    <expected>
      <sentence>The largest male has a snout-vent length of 132 mm., the largest female, 114 mm., and the smallest juvenile, 34 mm.</sentence>
      <sentence>The number of dorsal granules at the midbody varies from 91 to 117 (106.2 ± 0.43); the ratio of the number of granules between the paravertebral stripes to the number of granules around the body (PV/GAB) varies from 0.064 to 0.157 (0.097 ±0.007); the number of femoral pores varies from 32 to 49 (41.1 ± 0.20).</sentence>
      <sentence>Usually there are only three enlarged preanals, but 18 specimens have a somewhat enlarged scale anterior to the normal complement of three.</sentence>
      <sentence>In 15 specimens the supraorbital semicircle-series terminate short of the posterior edge of the frontal; in the others the series reach the frontal.</sentence>
    </expected>
  </test>
  <test>
    <input>During the dry season (November through May) adult males apparently aestivate; several large series collected in the winter include only subadults and females. This absence of males is corroborated by personal observations in the Tepalcatepec Valley in April and May. In the summer rainy season the lizards are active in the morning and again in the late afternoon; only Cnemidophorus calidipes is active during the heat of the midday. In some [597] areas of the scrub forest Cnemidophorus sacki zweifeli is found in association with Cnemidophorus communis communis. Throughout the scrub forest C. sacki zweifeli occurs with C. deppei infernalis. In some of the more dense scrub forest, where C. sacki zweifeli is not so abundant as in the more open forest, it has been taken with C. lineatissimus exoristus. In the open Acacia-Cercidium associations on the valley floor C. sacki zweifeli occurs with C. calidipes.</input>
    <expected>
      <sentence>During the dry season (November through May) adult males apparently aestivate; several large series collected in the winter include only subadults and females.</sentence>
      <sentence>This absence of males is corroborated by personal observations in the Tepalcatepec Valley in April and May.</sentence>
      <sentence>In the summer rainy season the lizards are active in the morning and again in the late afternoon; only Cnemidophorus calidipes is active during the heat of the midday.</sentence>
      <sentence>In some [597] areas of the scrub forest Cnemidophorus sacki zweifeli is found in association with Cnemidophorus communis communis.</sentence>
      <sentence>Throughout the scrub forest C. sacki zweifeli occurs with C. deppei infernalis.</sentence>
      <sentence>In some of the more dense scrub forest, where C. sacki zweifeli is not so abundant as in the more open forest, it has been taken with C. lineatissimus exoristus.</sentence>
      <sentence>In the open Acacia-Cercidium associations on the valley floor C. sacki zweifeli occurs with C. calidipes.</sentence>
    </expected>
  </test>
  <test>
    <input>Recording, measurement, assessment, and analysis of noise levels in classrooms took place in public elementary schools. Noise measurements were conducted by specialized personnel of the Hellenic Institute for Occupational Health and Safety (HIOHS) with the use of a Bruel and Kjaer 2231 Sound Level Meter. Measurements were taken in May 2017, recording noise levels of empty classrooms, occupied classrooms during teaching, schoolyards, and outside of the school premises. Measurements were conducted during school operation times and were completed within one working day for each school. Each measurement was taken over a period of five minutes. A five minute noise sample in school environments is considered to be satisfactory, even for occupied classrooms [11,12]. For each condition/ location (unoccupied/occupied classroom, school yard, outside of school premises), the following measurements were recorded: the Aweighted equivalent continuous sound level (LAeq), the A-weighted noise level just exceeded for 10% of the measurement period (LA10), the A-weighted noise level just exceeded for 90% of the measurement period (LA90), and the A-weighted maximum and minimum sound levels (LAmax and LAmin respectively). An approximation of Signal to Noise Ratio (SNR) was calculated as Lesson Noise-Occupied Background Noise Level (OBNL) [13]. Depending on whether the measurement referred to an unoccupied or occupied classroom, we use the descriptions Unoccupied Ambient Noise Level (UANL LAeq including noise from other teaching areas of the school), Occupied Background Noise Level (OBNL LAeq90, occupied classroom), Lesson Noise, etc. All terms were derived from Shield et al. [14]. As, to our knowledge, there is no universally accepted and standardized method for recording noise level in schools [7,15], the procedure in the present study was selected in order to obtain the best possible capture of the noise conditions prevailing in Greek classrooms.</input>
    <expected>
      <sentence>Recording, measurement, assessment, and analysis of noise levels in classrooms took place in public elementary schools.</sentence>
      <sentence>Noise measurements were conducted by specialized personnel of the Hellenic Institute for Occupational Health and Safety (HIOHS) with the use of a Bruel and Kjaer 2231 Sound Level Meter.</sentence>
      <sentence>Measurements were taken in May 2017, recording noise levels of empty classrooms, occupied classrooms during teaching, schoolyards, and outside of the school premises.</sentence>
      <sentence>Measurements were conducted during school operation times and were completed within one working day for each school.</sentence>
      <sentence>Each measurement was taken over a period of five minutes.</sentence>
      <sentence>A five minute noise sample in school environments is considered to be satisfactory, even for occupied classrooms [11,12].</sentence>
      <sentence>For each condition/ location (unoccupied/occupied classroom, school yard, outside of school premises), the following measurements were recorded: the Aweighted equivalent continuous sound level (LAeq), the A-weighted noise level just exceeded for 10% of the measurement period (LA10), the A-weighted noise level just exceeded for 90% of the measurement period (LA90), and the A-weighted maximum and minimum sound levels (LAmax and LAmin respectively).</sentence>
      <sentence>An approximation of Signal to Noise Ratio (SNR) was calculated as Lesson Noise-Occupied Background Noise Level (OBNL) [13].</sentence>
      <sentence>Depending on whether the measurement referred to an unoccupied or occupied classroom, we use the descriptions Unoccupied Ambient Noise Level (UANL LAeq including noise from other teaching areas of the school), Occupied Background Noise Level (OBNL LAeq90, occupied classroom), Lesson Noise, etc.</sentence>
      <sentence>All terms were derived from Shield et al. [14].</sentence>
      <sentence>As, to our knowledge, there is no universally accepted and standardized method for recording noise level in schools [7,15], the procedure in the present study was selected in order to obtain the best possible capture of the noise conditions prevailing in Greek classrooms.</sentence>
    </expected>
  </test>
  <test>
    <input>“Tchaw! trouble goes on!” said the man, changing the steel headpiece for a cuirass. “There won’t be no trouble. First time your father gets a sight of the mob of tailors, and shoemakers, and tinkers, with an old patch-work counterpane atop of a clothes-prop for their flag, he’ll ride along the front of his ridgement of cavaliers, and he’ll shout to ’em in that big voice of his as I’ve followed many’s the time; and ‘Don’t draw, gentlemen,’ he’ll say; ‘ride the scum down, and make the rest run;’ and then they’ll all roar with laughing loud enough to drown the trumpet charge. My word, I’d a gi’n something to ha’ been there to see the rebels fly like dead leaves before a wind in November. But it were a mean and a cruel thing, Master Roy. Look at that arm, look at these legs! I’m a better and a stronger man than ever I was, and could sit any horse they’d put me on. But to leave an old soldier, as had followed him as I have, at home here to rust like the rest o’ things, when there was a chance for a bit o’ fun, it went right to my ’art, sir, and it seemed to me as if it warn’t the master as I used to sit with in the ranks.” The old fellow was bending now over the breastplate and rubbing hard, while as Roy listened to his excited words, wondering at the way in which he seemed to resent what he looked upon as a slight, something dropped upon the polished steel with a pat, and spread out; and Roy thought to himself that if that drop of hot salt water stayed there, it would make a deeper rust spot than anything. But it did not stay, for the man hastily rubbed it away, and began with a rough show of indifference to hum over an old Devon song, something about “A morn in May, to hear birds whistle and see lambkins play.” But he ceased as the boy laid a hand upon his shoulder, and bent over the breastplate and rubbed at it very slowly, listening intently the while.</input>
    <expected>
      <sentence>“Tchaw! trouble goes on!” said the man, changing the steel headpiece for a cuirass.</sentence>
      <sentence>“There won’t be no trouble. First time your father gets a sight of the mob of tailors, and shoemakers, and tinkers, with an old patch-work counterpane atop of a clothes-prop for their flag, he’ll ride along the front of his ridgement of cavaliers, and he’ll shout to ’em in that big voice of his as I’ve followed many’s the time; and ‘Don’t draw, gentlemen,’ he’ll say; ‘ride the scum down, and make the rest run;’ and then they’ll all roar with laughing loud enough to drown the trumpet charge. My word, I’d a gi’n something to ha’ been there to see the rebels fly like dead leaves before a wind in November. But it were a mean and a cruel thing, Master Roy. Look at that arm, look at these legs! I’m a better and a stronger man than ever I was, and could sit any horse they’d put me on. But to leave an old soldier, as had followed him as I have, at home here to rust like the rest o’ things, when there was a chance for a bit o’ fun, it went right to my ’art, sir, and it seemed to me as if it warn’t the master as I used to sit with in the ranks.”</sentence>
      <sentence>The old fellow was bending now over the breastplate and rubbing hard, while as Roy listened to his excited words, wondering at the way in which he seemed to resent what he looked upon as a slight, something dropped upon the polished steel with a pat, and spread out; and Roy thought to himself that if that drop of hot salt water stayed there, it would make a deeper rust spot than anything.</sentence>
      <sentence>But it did not stay, for the man hastily rubbed it away, and began with a rough show of indifference to hum over an old Devon song, something about “A morn in May, to hear birds whistle and see lambkins play.”</sentence>
      <sentence>But he ceased as the boy laid a hand upon his shoulder, and bent over the breastplate and rubbed at it very slowly, listening intently the while.</sentence>
    </expected>
  </test>
  <test>
    <input>There won’t be no trouble. First time your father gets a sight of the mob of tailors, and shoemakers, and tinkers, with an old patch-work counterpane atop of a clothes-prop for their flag, he’ll ride along the front of his ridgement of cavaliers, and he’ll shout to ’em in that big voice of his as I’ve followed many’s the time; and ‘Don’t draw, gentlemen,’ he’ll say; ‘ride the scum down, and make the rest run;’ and then they’ll all roar with laughing loud enough to drown the trumpet charge. My word, I’d a gi’n something to ha’ been there to see the rebels fly like dead leaves before a wind in November. But it were a mean and a cruel thing, Master Roy. Look at that arm, look at these legs! I’m a better and a stronger man than ever I was, and could sit any horse they’d put me on. But to leave an old soldier, as had followed him as I have, at home here to rust like the rest o’ things, when there was a chance for a bit o’ fun, it went right to my ’art, sir, and it seemed to me as if it warn’t the master as I used to sit with in the ranks.</input>
    <expected>
      <sentence>There won’t be no trouble.</sentence>
      <sentence>First time your father gets a sight of the mob of tailors, and shoemakers, and tinkers, with an old patch-work counterpane atop of a clothes-prop for their flag, he’ll ride along the front of his ridgement of cavaliers, and he’ll shout to ’em in that big voice of his as I’ve followed many’s the time; and ‘Don’t draw, gentlemen,’ he’ll say; ‘ride the scum down, and make the rest run;’ and then they’ll all roar with laughing loud enough to drown the trumpet charge.</sentence>
      <sentence>My word, I’d a gi’n something to ha’ been there to see the rebels fly like dead leaves before a wind in November.</sentence>
      <sentence>But it were a mean and a cruel thing, Master Roy.</sentence>
      <sentence>Look at that arm, look at these legs!</sentence>
      <sentence>I’m a better and a stronger man than ever I was, and could sit any horse they’d put me on.</sentence>
      <sentence>But to leave an old soldier, as had followed him as I have, at home here to rust like the rest o’ things, when there was a chance for a bit o’ fun, it went right to my ’art, sir, and it seemed to me as if it warn’t the master as I used to sit with in the ranks.</sentence>
    </expected>
  </test>
  <test>
    <input>First, check for red spider mite infestation, which sometimes causes these yellow spots - they are quite difficult to see. Spray with an appropriate pesticide spray if you find them. Second, these plants are said to be sensitive to fluoride in water, so if your tapwater is fluoridated and you've been using that, this might cause those brown tips, though usually the brown tips have a yellow band on the 'live' end so to speak.</input>
    <expected>
      <sentence>First, check for red spider mite infestation, which sometimes causes these yellow spots - they are quite difficult to see.</sentence>
      <sentence>Spray with an appropriate pesticide spray if you find them.</sentence>
      <sentence>Second, these plants are said to be sensitive to fluoride in water, so if your tapwater is fluoridated and you've been using that, this might cause those brown tips, though usually the brown tips have a yellow band on the 'live' end so to speak.</sentence>
    </expected>
  </test>
  <test>
    <input>The other possible cause of the yellow spots is poor drainage - do you leave the plant standing in any outer container which collects water? If so, ensure you empty the container 30 minutes after watering. Water only when the surface of the compost is slightly dry to the touch, but not so dry it's shrunken from the sides of the pot, and water thoroughly. Despite not liking sitting in water, these plants don't like to dry out and do like high humidity in the air - keep away from direct heat sources, and add a pebble tray if you think it's necessary. (Pebble tray - an outer tray larger than the pot, filled with pebbles, that you keep half full of water, so the bottom of the pot is on the pebbles but above the water - the water evaporates and keeps the air round the plant more humid). Keep the plant in an even temperature as far as possible, never below 65 deg F, and, as you've already done, out of direct sunlight.</input>
    <expected>
      <sentence>The other possible cause of the yellow spots is poor drainage - do you leave the plant standing in any outer container which collects water?</sentence>
      <sentence>If so, ensure you empty the container 30 minutes after watering.</sentence>
      <sentence>Water only when the surface of the compost is slightly dry to the touch, but not so dry it's shrunken from the sides of the pot, and water thoroughly.</sentence>
      <sentence>Despite not liking sitting in water, these plants don't like to dry out and do like high humidity in the air - keep away from direct heat sources, and add a pebble tray if you think it's necessary.</sentence>
      <sentence>(Pebble tray - an outer tray larger than the pot, filled with pebbles, that you keep half full of water, so the bottom of the pot is on the pebbles but above the water - the water evaporates and keeps the air round the plant more humid).</sentence>
      <sentence>Keep the plant in an even temperature as far as possible, never below 65 deg F, and, as you've already done, out of direct sunlight.</sentence>
    </expected>
  </test>
  <test>
    <input>There is more to it than just over watering. I have seen these symptoms over and over again with dracaena. The top picture with it's growth rings is symptomatic of a fungus or bacterial disease. The triggering factor for this is normally a period of over watering. This stresses the plants and provides the right environment in the soil for the fungus or bacteria to take hold. As long as wet conditions continue you will see dead or necrotic spots start and grow in semi circular areas or up and down a leaf vein.</input>
    <expected>
      <sentence>There is more to it than just over watering.</sentence>
      <sentence>I have seen these symptoms over and over again with dracaena.</sentence>
      <sentence>The top picture with it's growth rings is symptomatic of a fungus or bacterial disease.</sentence>
      <sentence>The triggering factor for this is normally a period of over watering.</sentence>
      <sentence>This stresses the plants and provides the right environment in the soil for the fungus or bacteria to take hold.</sentence>
      <sentence>As long as wet conditions continue you will see dead or necrotic spots start and grow in semi circular areas or up and down a leaf vein.</sentence>
    </expected>
  </test>
  <test>
    <input>HID, high intensity discharge are sometimes known as Xenon, generate a lot of white spectrum. They are said to generate less heat than halogen but the ones I have will still burn your finger if you touch the exterior glass. They are expensive in comparison to fluorescent but are compact. Lifespan ranges from eight thousand to twenty thousand hours without the lumen output decreasing. They can be dimmed unlike halogens. You would still need to have a fan circulating air inside the vivarium and some kind of humidity control.</input>
    <expected>
      <sentence>HID, high intensity discharge are sometimes known as Xenon, generate a lot of white spectrum.</sentence>
      <sentence>They are said to generate less heat than halogen but the ones I have will still burn your finger if you touch the exterior glass.</sentence>
      <sentence>They are expensive in comparison to fluorescent but are compact.</sentence>
      <sentence>Lifespan ranges from eight thousand to twenty thousand hours without the lumen output decreasing.</sentence>
      <sentence>They can be dimmed unlike halogens.</sentence>
      <sentence>You would still need to have a fan circulating air inside the vivarium and some kind of humidity control.</sentence>
    </expected>
  </test>
  <test>
    <input>
      This phenomenon is called banner blindness. Your labeling looks like a banner advertisement and is therefore subconciously skipped. Users have been conditioned to ignore complete sections of content if their previous experience taught them that it always contains irrelevant stuff. The more attention the banner tries to pull, the more it's ignored. If you want people to notice a label like "homebrew" or "official", you need to place it somewhere that users are scanning for naturally.

      In your case, consider putting it next to the page title. You may also want to work with alert icons, as these tend not to be ignored by users if they are used sparsely. Preferably a contrasting colour with the rest of your colour scheme.
    </input>
    <expected>
      <sentence>This phenomenon is called banner blindness.</sentence>
      <sentence>Your labeling looks like a banner advertisement and is therefore subconciously skipped.</sentence>
      <sentence>Users have been conditioned to ignore complete sections of content if their previous experience taught them that it always contains irrelevant stuff.</sentence>
      <sentence>The more attention the banner tries to pull, the more it's ignored.</sentence>
      <sentence>If you want people to notice a label like "homebrew" or "official", you need to place it somewhere that users are scanning for naturally.</sentence>
      <sentence>In your case, consider putting it next to the page title.</sentence>
      <sentence>You may also want to work with alert icons, as these tend not to be ignored by users if they are used sparsely.</sentence>
      <sentence>Preferably a contrasting colour with the rest of your colour scheme.</sentence>
    </expected>
  </test>
  <test>
    <input>Of course though, keep in mind the release version and support period of the Ubuntu version you have. Regular releases are supported for 9 months after the release date, Long Time Support (LTS) releases for 5 years. You should not use or install releases past their end of life date any more, because it is far better and easier to install the latest release than to upgrade from an old and unsupported installation.</input>
    <expected>
      <sentence>Of course though, keep in mind the release version and support period of the Ubuntu version you have.</sentence>
      <sentence>Regular releases are supported for 9 months after the release date, Long Time Support (LTS) releases for 5 years.</sentence>
      <sentence>You should not use or install releases past their end of life date any more, because it is far better and easier to install the latest release than to upgrade from an old and unsupported installation.</sentence>
    </expected>
  </test>
  <test>
    <input>To cross one's fingers is a hand gesture commonly used to wish for luck. Occasionally it is interpreted as an attempt to implore God for protection. The gesture is referred to by the common expressions "cross your fingers", "keep your fingers crossed", or just "fingers crossed". Some people, mostly children, also use the gesture to excuse their telling of a white lie. By extension, a similar belief is that crossing one's fingers invalidates a promise being made.</input>
    <expected>
      <sentence>To cross one's fingers is a hand gesture commonly used to wish for luck.</sentence>
      <sentence>Occasionally it is interpreted as an attempt to implore God for protection.</sentence>
      <sentence>The gesture is referred to by the common expressions "cross your fingers", "keep your fingers crossed", or just "fingers crossed".</sentence>
      <sentence>Some people, mostly children, also use the gesture to excuse their telling of a white lie.</sentence>
      <sentence>By extension, a similar belief is that crossing one's fingers invalidates a promise being made.</sentence>
    </expected>
  </test>
  <test>
    <input>High-dynamic-range imaging (HDRI) is a high dynamic range (HDR) technique used in imaging and photography to reproduce a greater dynamic range of luminosity than is possible with standard digital imaging or photographic techniques. The aim is to present a similar range of luminance to that experienced through the human visual system. The human eye, through adaptation of the iris and other methods, adjusts constantly to adapt to a broad range of luminance present in the environment. The brain continuously interprets this information so that a viewer can see in a wide range of light conditions. HDR images can represent a greater range of luminance levels than can be achieved using more traditional methods, such as many real-world scenes containing very bright, direct sunlight to extreme shade, or very faint nebulae. This is often achieved by capturing and then combining several different, narrower range, exposures of the same subject matter. Non-HDR cameras take photographs with a limited exposure range, referred to as LDR, resulting in the loss of detail in highlights or shadows.</input>
    <expected>
      <sentence>High-dynamic-range imaging (HDRI) is a high dynamic range (HDR) technique used in imaging and photography to reproduce a greater dynamic range of luminosity than is possible with standard digital imaging or photographic techniques.</sentence>
      <sentence>The aim is to present a similar range of luminance to that experienced through the human visual system.</sentence>
      <sentence>The human eye, through adaptation of the iris and other methods, adjusts constantly to adapt to a broad range of luminance present in the environment.</sentence>
      <sentence>The brain continuously interprets this information so that a viewer can see in a wide range of light conditions.</sentence>
      <sentence>HDR images can represent a greater range of luminance levels than can be achieved using more traditional methods, such as many real-world scenes containing very bright, direct sunlight to extreme shade, or very faint nebulae.</sentence>
      <sentence>This is often achieved by capturing and then combining several different, narrower range, exposures of the same subject matter.</sentence>
      <sentence>Non-HDR cameras take photographs with a limited exposure range, referred to as LDR, resulting in the loss of detail in highlights or shadows.</sentence>
    </expected>
  </test>
  <test>
    <input>In photography, dynamic range is measured in exposure value (EV) differences (known as stops). An increase of one EV, or 'one stop', represents a doubling of the amount of light. Conversely, a decrease of one EV represents a halving of the amount of light. Therefore, revealing detail in the darkest of shadows requires high exposures, while preserving detail in very bright situations requires very low exposures. Most cameras cannot provide this range of exposure values within a single exposure, due to their low dynamic range. High-dynamic-range photographs are generally achieved by capturing multiple standard-exposure images, often using exposure bracketing, and then later merging them into a single HDR image, usually within a photo manipulation program). Digital images are often encoded in a camera's raw image format, because 8-bit JPEG encoding does not offer a wide enough range of values to allow fine transitions (and regarding HDR, later introduces undesirable effects due to lossy compression).</input>
    <expected>
      <sentence>In photography, dynamic range is measured in exposure value (EV) differences (known as stops).</sentence>
      <sentence>An increase of one EV, or 'one stop', represents a doubling of the amount of light.</sentence>
      <sentence>Conversely, a decrease of one EV represents a halving of the amount of light.</sentence>
      <sentence>Therefore, revealing detail in the darkest of shadows requires high exposures, while preserving detail in very bright situations requires very low exposures.</sentence>
      <sentence>Most cameras cannot provide this range of exposure values within a single exposure, due to their low dynamic range.</sentence>
      <sentence>High-dynamic-range photographs are generally achieved by capturing multiple standard-exposure images, often using exposure bracketing, and then later merging them into a single HDR image, usually within a photo manipulation program).</sentence>
      <sentence>Digital images are often encoded in a camera's raw image format, because 8-bit JPEG encoding does not offer a wide enough range of values to allow fine transitions (and regarding HDR, later introduces undesirable effects due to lossy compression).</sentence>
    </expected>
  </test>
  <test>
    <input>HDR images often don't use fixed ranges per color channel—other than traditional images—to represent many more colors over a much wider dynamic range. For that purpose, they do not use integer values to represent the single color channels (e.g., 0-255 in an 8 bit per pixel interval for red, green and blue) but instead use a floating point representation. Common are 16-bit (half precision) or 32-bit floating point numbers to represent HDR pixels. However, when the appropriate transfer function is used, HDR pixels for some applications can be represented with a color depth that has as few as 10–12 bits for luminance and 8 bits for chrominance without introducing any visible quantization artifacts.</input>
    <expected>
      <sentence>HDR images often don't use fixed ranges per color channel—other than traditional images—to represent many more colors over a much wider dynamic range.</sentence>
      <sentence>For that purpose, they do not use integer values to represent the single color channels (e.g., 0-255 in an 8 bit per pixel interval for red, green and blue) but instead use a floating point representation.</sentence>
      <sentence>Common are 16-bit (half precision) or 32-bit floating point numbers to represent HDR pixels.</sentence>
      <sentence>However, when the appropriate transfer function is used, HDR pixels for some applications can be represented with a color depth that has as few as 10–12 bits for luminance and 8 bits for chrominance without introducing any visible quantization artifacts.</sentence>
    </expected>
  </test>
  <test>
    <input>Manual tone mapping was accomplished by dodging and burning – selectively increasing or decreasing the exposure of regions of the photograph to yield better tonality reproduction. This was effective because the dynamic range of the negative is significantly higher than would be available on the finished positive paper print when that is exposed via the negative in a uniform manner. An excellent example is the photograph Schweitzer at the Lamp by W. Eugene Smith, from his 1954 photo essay A Man of Mercy on Dr. Albert Schweitzer and his humanitarian work in French Equatorial Africa. The image took 5 days to reproduce the tonal range of the scene, which ranges from a bright lamp (relative to the scene) to a dark shadow.</input>
    <expected>
      <sentence>Manual tone mapping was accomplished by dodging and burning – selectively increasing or decreasing the exposure of regions of the photograph to yield better tonality reproduction.</sentence>
      <sentence>This was effective because the dynamic range of the negative is significantly higher than would be available on the finished positive paper print when that is exposed via the negative in a uniform manner.</sentence>
      <sentence>An excellent example is the photograph Schweitzer at the Lamp by W. Eugene Smith, from his 1954 photo essay A Man of Mercy on Dr. Albert Schweitzer and his humanitarian work in French Equatorial Africa.</sentence>
      <sentence>The image took 5 days to reproduce the tonal range of the scene, which ranges from a bright lamp (relative to the scene) to a dark shadow.</sentence>
    </expected>
  </test>
  <test>
    <input>David Prudames of 24 Hour Museum reviewed the show, "This exhibition of Stuckist work from around the world at a purpose built gallery lays the movement's foundations and states it is here to stay." Arty magazine edited by Cathy Lomax of Transition Gallery said, "Work presented here is always a wonder to behold... The best painted space in town—the coloured walls are themselves better than some galleries' shows... Art with attitude, whatever style you happen to enjoy. And there are more styles here than you'd be led to believe." However, Sarah Kent stated in Time Out, "it will prove their undoing. These vociferous opportunists are revealed to be a bunch of Bayswater Road-style daubers without an original idea between them."</input>
    <expected>
      <sentence>David Prudames of 24 Hour Museum reviewed the show, "This exhibition of Stuckist work from around the world at a purpose built gallery lays the movement's foundations and states it is here to stay."</sentence>
      <sentence>Arty magazine edited by Cathy Lomax of Transition Gallery said, "Work presented here is always a wonder to behold... The best painted space in town—the coloured walls are themselves better than some galleries' shows... Art with attitude, whatever style you happen to enjoy. And there are more styles here than you'd be led to believe."</sentence>
      <sentence>However, Sarah Kent stated in Time Out, "it will prove their undoing. These vociferous opportunists are revealed to be a bunch of Bayswater Road-style daubers without an original idea between them."</sentence>
    </expected>
  </test>
  <test>
    <input>Reactivated in January 1941, the regiment underwent mobilization and training in several locations, and was eventually broken up on 18 March 1943, into the 1106th Engineer Combat Group, the 209th Engineer Combat Battalion, and the 37th Engineer Combat Battalion (Amphibious). The 37th Engineer Combat Battalion was subsequently assigned to the 5th Engineer Special Brigade and participated in Operation Overlord, landing with the initial waves on Omaha Beach. For its performance, the battalion was awarded the Presidential Unit Citation and the French Croix de Guerre with Palm. After the Invasion of Normandy, the battalion spent several months on the beach unloading troops and equipment, clearing roads, and repairing port facilities. For this, the battalion received the Meritorious Unit Commendation. Later, the battalion was detached from the 5th Engineer Special Brigade and moved through Belgium and the Netherlands, supporting the Allied advance. The battalion entered Germany in March 1945, where it remained until its return to the United States in November of that same year. The following month, the battalion was again inactivated.</input>
    <expected>
      <sentence>Reactivated in January 1941, the regiment underwent mobilization and training in several locations, and was eventually broken up on 18 March 1943, into the 1106th Engineer Combat Group, the 209th Engineer Combat Battalion, and the 37th Engineer Combat Battalion (Amphibious).</sentence>
      <sentence>The 37th Engineer Combat Battalion was subsequently assigned to the 5th Engineer Special Brigade and participated in Operation Overlord, landing with the initial waves on Omaha Beach.</sentence>
      <sentence>For its performance, the battalion was awarded the Presidential Unit Citation and the French Croix de Guerre with Palm.</sentence>
      <sentence>After the Invasion of Normandy, the battalion spent several months on the beach unloading troops and equipment, clearing roads, and repairing port facilities.</sentence>
      <sentence>For this, the battalion received the Meritorious Unit Commendation.</sentence>
      <sentence>Later, the battalion was detached from the 5th Engineer Special Brigade and moved through Belgium and the Netherlands, supporting the Allied advance.</sentence>
      <sentence>The battalion entered Germany in March 1945, where it remained until its return to the United States in November of that same year.</sentence>
      <sentence>The following month, the battalion was again inactivated.</sentence>
    </expected>
  </test>
  <test>
    <input>The compost must be open and free draining, to help prevent waterlogging and recreate natural habitat. Cacti compost is readily available from garden centres. Alternatively, use John Innes No. 2 with up to 30 percent extra grit or fine gravel by volume, to help with drainage. Re-pot pot-bound plants in spring, into a pot only slightly larger in diameter. Holding spiny specimens can be tricky when re-potting so use thick strips of folded newspaper as tongs or an oven glove.</input>
    <expected>
      <sentence>The compost must be open and free draining, to help prevent waterlogging and recreate natural habitat.</sentence>
      <sentence>Cacti compost is readily available from garden centres.</sentence>
      <sentence>Alternatively, use John Innes No. 2 with up to 30 percent extra grit or fine gravel by volume, to help with drainage.</sentence>
      <sentence>Re-pot pot-bound plants in spring, into a pot only slightly larger in diameter.</sentence>
      <sentence>Holding spiny specimens can be tricky when re-potting so use thick strips of folded newspaper as tongs or an oven glove.</sentence>
    </expected>
  </test>
  <test>
    <input>Cacti and succulents thrive with good light sources, and it is best to place cacti and succulents in a bright place. A south facing position will provide good sunlight. However, be careful to not put them in direct sunlight because the intense light can make the plants turn a yellow colour. The optimum light depends on the variety of cacti and succulent that you are growing. For example, forest-growing epiphytes, such as Rhipsalis, need semi-shade, but an Echeveria needs bright light. During the autumn and winter months, it is best for the plants to be kept cool at night with temperatures of around 8°C to 10°C. In the spring and summer the plants need good ventilation, but will survive in high temperatures.</input>
    <expected>
      <sentence>Cacti and succulents thrive with good light sources, and it is best to place cacti and succulents in a bright place.</sentence>
      <sentence>A south facing position will provide good sunlight.</sentence>
      <sentence>However, be careful to not put them in direct sunlight because the intense light can make the plants turn a yellow colour.</sentence>
      <sentence>The optimum light depends on the variety of cacti and succulent that you are growing.</sentence>
      <sentence>For example, forest-growing epiphytes, such as Rhipsalis, need semi-shade, but an Echeveria needs bright light.</sentence>
      <sentence>During the autumn and winter months, it is best for the plants to be kept cool at night with temperatures of around 8°C to 10°C.</sentence>
      <sentence>In the spring and summer the plants need good ventilation, but will survive in high temperatures.</sentence>
    </expected>
  </test>
  <test>
    <input>My very first plant was purchased when I was six years old and it cost me 2s-6d (12.5p). The plant was 'Ferocactus herrerae' it was in a 50mm pot and the size of a golf ball. Forty two years on the plant is in a 375mm pot and the size of a football. It is still growing well as you can see (pictured right).</input>
    <expected>
      <sentence>My very first plant was purchased when I was six years old and it cost me 2s-6d (12.5p).</sentence>
      <sentence>The plant was 'Ferocactus herrerae' it was in a 50mm pot and the size of a golf ball.</sentence>
      <sentence>Forty two years on the plant is in a 375mm pot and the size of a football.</sentence>
      <sentence>It is still growing well as you can see (pictured right).</sentence>
    </expected>
  </test>
  <test>
    <input>Like most of my generation, I was brought up on the saying: 'Satan finds some mischief for idle hands to do.' Being a highly virtuous child, I believed all that I was told, and acquired a conscience which has kept me working hard down to the present moment. But although my conscience has controlled my actions, my opinions have undergone a revolution. I think that there is far too much work done in the world, that immense harm is caused by the belief that work is virtuous, and that what needs to be preached in modern industrial countries is quite different from what always has been preached. Everyone knows the story of the traveler in Naples who saw twelve beggars lying in the sun (it was before the days of Mussolini), and offered a lira to the laziest of them. Eleven of them jumped up to claim it, so he gave it to the twelfth. this traveler was on the right lines. But in countries which do not enjoy Mediterranean sunshine idleness is more difficult, and a great public propaganda will be required to inaugurate it. I hope that, after reading the following pages, the leaders of the YMCA will start a campaign to induce good young men to do nothing. If so, I shall not have lived in vain.</input>
    <expected>
      <sentence>Like most of my generation, I was brought up on the saying: 'Satan finds some mischief for idle hands to do.'</sentence>
      <sentence>Being a highly virtuous child, I believed all that I was told, and acquired a conscience which has kept me working hard down to the present moment.</sentence>
      <sentence>But although my conscience has controlled my actions, my opinions have undergone a revolution.</sentence>
      <sentence>I think that there is far too much work done in the world, that immense harm is caused by the belief that work is virtuous, and that what needs to be preached in modern industrial countries is quite different from what always has been preached.</sentence>
      <sentence>Everyone knows the story of the traveler in Naples who saw twelve beggars lying in the sun (it was before the days of Mussolini), and offered a lira to the laziest of them.</sentence>
      <sentence>Eleven of them jumped up to claim it, so he gave it to the twelfth.</sentence>
      <sentence>this traveler was on the right lines.</sentence>
      <sentence>But in countries which do not enjoy Mediterranean sunshine idleness is more difficult, and a great public propaganda will be required to inaugurate it.</sentence>
      <sentence>I hope that, after reading the following pages, the leaders of the YMCA will start a campaign to induce good young men to do nothing.</sentence>
      <sentence>If so, I shall not have lived in vain.</sentence>
    </expected>
  </test>
  <test>
    <input>Before advancing my own arguments for laziness, I must dispose of one which I cannot accept. Whenever a person who already has enough to live on proposes to engage in some everyday kind of job, such as school-teaching or typing, he or she is told that such conduct takes the bread out of other people's mouths, and is therefore wicked. If this argument were valid, it would only be necessary for us all to be idle in order that we should all have our mouths full of bread. What people who say such things forget is that what a man earns he usually spends, and in spending he gives employment. As long as a man spends his income, he puts just as much bread into people's mouths in spending as he takes out of other people's mouths in earning. The real villain, from this point of view, is the man who saves. If he merely puts his savings in a stocking, like the proverbial French peasant, it is obvious that they do not give employment. If he invests his savings, the matter is less obvious, and different cases arise.</input>
    <expected>
      <sentence>Before advancing my own arguments for laziness, I must dispose of one which I cannot accept.</sentence>
      <sentence>Whenever a person who already has enough to live on proposes to engage in some everyday kind of job, such as school-teaching or typing, he or she is told that such conduct takes the bread out of other people's mouths, and is therefore wicked.</sentence>
      <sentence>If this argument were valid, it would only be necessary for us all to be idle in order that we should all have our mouths full of bread.</sentence>
      <sentence>What people who say such things forget is that what a man earns he usually spends, and in spending he gives employment.</sentence>
      <sentence>As long as a man spends his income, he puts just as much bread into people's mouths in spending as he takes out of other people's mouths in earning.</sentence>
      <sentence>The real villain, from this point of view, is the man who saves.</sentence>
      <sentence>If he merely puts his savings in a stocking, like the proverbial French peasant, it is obvious that they do not give employment.</sentence>
      <sentence>If he invests his savings, the matter is less obvious, and different cases arise.</sentence>
    </expected>
  </test>
  <test>
    <input>One of the commonest things to do with savings is to lend them to some Government. In view of the fact that the bulk of the public expenditure of most civilized Governments consists in payment for past wars or preparation for future wars, the man who lends his money to a Government is in the same position as the bad men in Shakespeare who hire murderers. The net result of the man's economical habits is to increase the armed forces of the State to which he lends his savings. Obviously it would be better if he spent the money, even if he spent it in drink or gambling.</input>
    <expected>
      <sentence>One of the commonest things to do with savings is to lend them to some Government.</sentence>
      <sentence>In view of the fact that the bulk of the public expenditure of most civilized Governments consists in payment for past wars or preparation for future wars, the man who lends his money to a Government is in the same position as the bad men in Shakespeare who hire murderers.</sentence>
      <sentence>The net result of the man's economical habits is to increase the armed forces of the State to which he lends his savings.</sentence>
      <sentence>Obviously it would be better if he spent the money, even if he spent it in drink or gambling.</sentence>
    </expected>
  </test>
  <test>
    <input>But, I shall be told, the case is quite different when savings are invested in industrial enterprises. When such enterprises succeed, and produce something useful, this may be conceded. In these days, however, no one will deny that most enterprises fail. That means that a large amount of human labor, which might have been devoted to producing something that could be enjoyed, was expended on producing machines which, when produced, lay idle and did no good to anyone. The man who invests his savings in a concern that goes bankrupt is therefore injuring others as well as himself. If he spent his money, say, in giving parties for his friends, they (we may hope) would get pleasure, and so would all those upon whom he spent money, such as the butcher, the baker, and the bootlegger. But if he spends it (let us say) upon laying down rails for surface card in some place where surface cars turn out not to be wanted, he has diverted a mass of labor into channels where it gives pleasure to no one. Nevertheless, when he becomes poor through failure of his investment he will be regarded as a victim of undeserved misfortune, whereas the gay spendthrift, who has spent his money philanthropically, will be despised as a fool and a frivolous person.</input>
    <expected>
      <sentence>But, I shall be told, the case is quite different when savings are invested in industrial enterprises.</sentence>
      <sentence>When such enterprises succeed, and produce something useful, this may be conceded.</sentence>
      <sentence>In these days, however, no one will deny that most enterprises fail.</sentence>
      <sentence>That means that a large amount of human labor, which might have been devoted to producing something that could be enjoyed, was expended on producing machines which, when produced, lay idle and did no good to anyone.</sentence>
      <sentence>The man who invests his savings in a concern that goes bankrupt is therefore injuring others as well as himself.</sentence>
      <sentence>If he spent his money, say, in giving parties for his friends, they (we may hope) would get pleasure, and so would all those upon whom he spent money, such as the butcher, the baker, and the bootlegger.</sentence>
      <sentence>But if he spends it (let us say) upon laying down rails for surface card in some place where surface cars turn out not to be wanted, he has diverted a mass of labor into channels where it gives pleasure to no one.</sentence>
      <sentence>Nevertheless, when he becomes poor through failure of his investment he will be regarded as a victim of undeserved misfortune, whereas the gay spendthrift, who has spent his money philanthropically, will be despised as a fool and a frivolous person.</sentence>
    </expected>
  </test>
  <test>
    <input>All this is only preliminary. I want to say, in all seriousness, that a great deal of harm is being done in the modern world by belief in the virtuousness of work, and that the road to happiness and prosperity lies in an organized diminution of work.</input>
    <expected>
      <sentence>All this is only preliminary.</sentence>
      <sentence>I want to say, in all seriousness, that a great deal of harm is being done in the modern world by belief in the virtuousness of work, and that the road to happiness and prosperity lies in an organized diminution of work.</sentence>
    </expected>
  </test>
  <test>
    <input>First of all: what is work? Work is of two kinds: first, altering the position of matter at or near the earth's surface relatively to other such matter; second, telling other people to do so. The first kind is unpleasant and ill paid; the second is pleasant and highly paid. The second kind is capable of indefinite extension: there are not only those who give orders, but those who give advice as to what orders should be given. Usually two opposite kinds of advice are given simultaneously by two organized bodies of men; this is called politics. The skill required for this kind of work is not knowledge of the subjects as to which advice is given, but knowledge of the art of persuasive speaking and writing, i.e. of advertising.</input>
    <expected>
      <sentence>First of all: what is work?</sentence>
      <sentence>Work is of two kinds: first, altering the position of matter at or near the earth's surface relatively to other such matter; second, telling other people to do so.</sentence>
      <sentence>The first kind is unpleasant and ill paid; the second is pleasant and highly paid.</sentence>
      <sentence>The second kind is capable of indefinite extension: there are not only those who give orders, but those who give advice as to what orders should be given.</sentence>
      <sentence>Usually two opposite kinds of advice are given simultaneously by two organized bodies of men; this is called politics.</sentence>
      <sentence>The skill required for this kind of work is not knowledge of the subjects as to which advice is given, but knowledge of the art of persuasive speaking and writing, i.e. of advertising.</sentence>
    </expected>
  </test>
  <test>
    <input>Throughout Europe, though not in America, there is a third class of men, more respected than either of the classes of workers. There are men who, through ownership of land, are able to make others pay for the privilege of being allowed to exist and to work. These landowners are idle, and I might therefore be expected to praise them. Unfortunately, their idleness is only rendered possible by the industry of others; indeed their desire for comfortable idleness is historically the source of the whole gospel of work. The last thing they have ever wished is that others should follow their example.</input>
    <expected>
      <sentence>Throughout Europe, though not in America, there is a third class of men, more respected than either of the classes of workers.</sentence>
      <sentence>There are men who, through ownership of land, are able to make others pay for the privilege of being allowed to exist and to work.</sentence>
      <sentence>These landowners are idle, and I might therefore be expected to praise them.</sentence>
      <sentence>Unfortunately, their idleness is only rendered possible by the industry of others; indeed their desire for comfortable idleness is historically the source of the whole gospel of work.</sentence>
      <sentence>The last thing they have ever wished is that others should follow their example.</sentence>
    </expected>
  </test>
  <test>
    <input>From the beginning of civilization until the Industrial Revolution, a man could, as a rule, produce by hard work little more than was required for the subsistence of himself and his family, although his wife worked at least as hard as he did, and his children added their labor as soon as they were old enough to do so. The small surplus above bare necessaries was not left to those who produced it, but was appropriated by warriors and priests. In times of famine there was no surplus; the warriors and priests, however, still secured as much as at other times, with the result that many of the workers died of hunger. This system persisted in Russia until 1917 [1], and still persists in the East; in England, in spite of the Industrial Revolution, it remained in full force throughout the Napoleonic wars, and until a hundred years ago, when the new class of manufacturers acquired power. In America, the system came to an end with the Revolution, except in the South, where it persisted until the Civil War. A system which lasted so long and ended so recently has naturally left a profound impress upon men's thoughts and opinions. Much that we take for granted about the desirability of work is derived from this system, and, being pre-industrial, is not adapted to the modern world. Modern technique has made it possible for leisure, within limits, to be not the prerogative of small privileged classes, but a right evenly distributed throughout the community. The morality of work is the morality of slaves, and the modern world has no need of slavery.</input>
    <expected>
      <sentence>From the beginning of civilization until the Industrial Revolution, a man could, as a rule, produce by hard work little more than was required for the subsistence of himself and his family, although his wife worked at least as hard as he did, and his children added their labor as soon as they were old enough to do so.</sentence>
      <sentence>The small surplus above bare necessaries was not left to those who produced it, but was appropriated by warriors and priests.</sentence>
      <sentence>In times of famine there was no surplus; the warriors and priests, however, still secured as much as at other times, with the result that many of the workers died of hunger.</sentence>
      <sentence>This system persisted in Russia until 1917 [1], and still persists in the East; in England, in spite of the Industrial Revolution, it remained in full force throughout the Napoleonic wars, and until a hundred years ago, when the new class of manufacturers acquired power.</sentence>
      <sentence>In America, the system came to an end with the Revolution, except in the South, where it persisted until the Civil War.</sentence>
      <sentence>A system which lasted so long and ended so recently has naturally left a profound impress upon men's thoughts and opinions.</sentence>
      <sentence>Much that we take for granted about the desirability of work is derived from this system, and, being pre-industrial, is not adapted to the modern world.</sentence>
      <sentence>Modern technique has made it possible for leisure, within limits, to be not the prerogative of small privileged classes, but a right evenly distributed throughout the community.</sentence>
      <sentence>The morality of work is the morality of slaves, and the modern world has no need of slavery.</sentence>
    </expected>
  </test>
  <test>
    <input>It is obvious that, in primitive communities, peasants, left to themselves, would not have parted with the slender surplus upon which the warriors and priests subsisted, but would have either produced less or consumed more. At first, sheer force compelled them to produce and part with the surplus. Gradually, however, it was found possible to induce many of them to accept an ethic according to which it was their duty to work hard, although part of their work went to support others in idleness. By this means the amount of compulsion required was lessened, and the expenses of government were diminished. To this day, 99 per cent of British wage-earners would be genuinely shocked if it were proposed that the King should not have a larger income than a working man. The conception of duty, speaking historically, has been a means used by the holders of power to induce others to live for the interests of their masters rather than for their own. Of course the holders of power conceal this fact from themselves by managing to believe that their interests are identical with the larger interests of humanity. Sometimes this is true; Athenian slave-owners, for instance, employed part of their leisure in making a permanent contribution to civilization which would have been impossible under a just economic system. Leisure is essential to civilization, and in former times leisure for the few was only rendered possible by the labors of the many. But their labors were valuable, not because work is good, but because leisure is good. And with modern technique it would be possible to distribute leisure justly without injury to civilization.</input>
    <expected>
      <sentence>It is obvious that, in primitive communities, peasants, left to themselves, would not have parted with the slender surplus upon which the warriors and priests subsisted, but would have either produced less or consumed more.</sentence>
      <sentence>At first, sheer force compelled them to produce and part with the surplus.</sentence>
      <sentence>Gradually, however, it was found possible to induce many of them to accept an ethic according to which it was their duty to work hard, although part of their work went to support others in idleness.</sentence>
      <sentence>By this means the amount of compulsion required was lessened, and the expenses of government were diminished.</sentence>
      <sentence>To this day, 99 per cent of British wage-earners would be genuinely shocked if it were proposed that the King should not have a larger income than a working man.</sentence>
      <sentence>The conception of duty, speaking historically, has been a means used by the holders of power to induce others to live for the interests of their masters rather than for their own.</sentence>
      <sentence>Of course the holders of power conceal this fact from themselves by managing to believe that their interests are identical with the larger interests of humanity.</sentence>
      <sentence>Sometimes this is true; Athenian slave-owners, for instance, employed part of their leisure in making a permanent contribution to civilization which would have been impossible under a just economic system.</sentence>
      <sentence>Leisure is essential to civilization, and in former times leisure for the few was only rendered possible by the labors of the many.</sentence>
      <sentence>But their labors were valuable, not because work is good, but because leisure is good.</sentence>
      <sentence>And with modern technique it would be possible to distribute leisure justly without injury to civilization.</sentence>
    </expected>
  </test>
  <test>
    <input>Modern technique has made it possible to diminish enormously the amount of labor required to secure the necessaries of life for everyone. This was made obvious during the war. At that time all the men in the armed forces, and all the men and women engaged in the production of munitions, all the men and women engaged in spying, war propaganda, or Government offices connected with the war, were withdrawn from productive occupations. In spite of this, the general level of well-being among unskilled wage-earners on the side of the Allies was higher than before or since. The significance of this fact was concealed by finance: borrowing made it appear as if the future was nourishing the present. But that, of course, would have been impossible; a man cannot eat a loaf of bread that does not yet exist. The war showed conclusively that, by the scientific organization of production, it is possible to keep modern populations in fair comfort on a small part of the working capacity of the modern world. If, at the end of the war, the scientific organization, which had been created in order to liberate men for fighting and munition work, had been preserved, and the hours of the week had been cut down to four, all would have been well. Instead of that the old chaos was restored, those whose work was demanded were made to work long hours, and the rest were left to starve as unemployed. Why? Because work is a duty, and a man should not receive wages in proportion to what he has produced, but in proportion to his virtue as exemplified by his industry.</input>
    <expected>
      <sentence>Modern technique has made it possible to diminish enormously the amount of labor required to secure the necessaries of life for everyone.</sentence>
      <sentence>This was made obvious during the war.</sentence>
      <sentence>At that time all the men in the armed forces, and all the men and women engaged in the production of munitions, all the men and women engaged in spying, war propaganda, or Government offices connected with the war, were withdrawn from productive occupations.</sentence>
      <sentence>In spite of this, the general level of well-being among unskilled wage-earners on the side of the Allies was higher than before or since.</sentence>
      <sentence>The significance of this fact was concealed by finance: borrowing made it appear as if the future was nourishing the present.</sentence>
      <sentence>But that, of course, would have been impossible; a man cannot eat a loaf of bread that does not yet exist.</sentence>
      <sentence>The war showed conclusively that, by the scientific organization of production, it is possible to keep modern populations in fair comfort on a small part of the working capacity of the modern world.</sentence>
      <sentence>If, at the end of the war, the scientific organization, which had been created in order to liberate men for fighting and munition work, had been preserved, and the hours of the week had been cut down to four, all would have been well.</sentence>
      <sentence>Instead of that the old chaos was restored, those whose work was demanded were made to work long hours, and the rest were left to starve as unemployed.</sentence>
      <sentence>Why?</sentence>
      <sentence>Because work is a duty, and a man should not receive wages in proportion to what he has produced, but in proportion to his virtue as exemplified by his industry.</sentence>
    </expected>
  </test>
  <test>
    <input>This is the morality of the Slave State, applied in circumstances totally unlike those in which it arose. No wonder the result has been disastrous. Let us take an illustration. Suppose that, at a given moment, a certain number of people are engaged in the manufacture of pins. They make as many pins as the world needs, working (say) eight hours a day. Someone makes an invention by which the same number of men can make twice as many pins: pins are already so cheap that hardly any more will be bought at a lower price. In a sensible world, everybody concerned in the manufacturing of pins would take to working four hours instead of eight, and everything else would go on as before. But in the actual world this would be thought demoralizing. The men still work eight hours, there are too many pins, some employers go bankrupt, and half the men previously concerned in making pins are thrown out of work. There is, in the end, just as much leisure as on the other plan, but half the men are totally idle while half are still overworked. In this way, it is insured that the unavoidable leisure shall cause misery all round instead of being a universal source of happiness. Can anything more insane be imagined?</input>
    <expected>
      <sentence>This is the morality of the Slave State, applied in circumstances totally unlike those in which it arose.</sentence>
      <sentence>No wonder the result has been disastrous.</sentence>
      <sentence>Let us take an illustration.</sentence>
      <sentence>Suppose that, at a given moment, a certain number of people are engaged in the manufacture of pins.</sentence>
      <sentence>They make as many pins as the world needs, working (say) eight hours a day.</sentence>
      <sentence>Someone makes an invention by which the same number of men can make twice as many pins: pins are already so cheap that hardly any more will be bought at a lower price.</sentence>
      <sentence>In a sensible world, everybody concerned in the manufacturing of pins would take to working four hours instead of eight, and everything else would go on as before.</sentence>
      <sentence>But in the actual world this would be thought demoralizing.</sentence>
      <sentence>The men still work eight hours, there are too many pins, some employers go bankrupt, and half the men previously concerned in making pins are thrown out of work.</sentence>
      <sentence>There is, in the end, just as much leisure as on the other plan, but half the men are totally idle while half are still overworked.</sentence>
      <sentence>In this way, it is insured that the unavoidable leisure shall cause misery all round instead of being a universal source of happiness.</sentence>
      <sentence>Can anything more insane be imagined?</sentence>
    </expected>
  </test>
  <test>
    <input>The idea that the poor should have leisure has always been shocking to the rich. In England, in the early nineteenth century, fifteen hours was the ordinary day's work for a man; children sometimes did as much, and very commonly did twelve hours a day. When meddlesome busybodies suggested that perhaps these hours were rather long, they were told that work kept adults from drink and children from mischief. When I was a child, shortly after urban working men had acquired the vote, certain public holidays were established by law, to the great indignation of the upper classes. I remember hearing an old Duchess say: 'What do the poor want with holidays? They ought to work.' People nowadays are less frank, but the sentiment persists, and is the source of much of our economic confusion.</input>
    <expected>
      <sentence>The idea that the poor should have leisure has always been shocking to the rich.</sentence>
      <sentence>In England, in the early nineteenth century, fifteen hours was the ordinary day's work for a man; children sometimes did as much, and very commonly did twelve hours a day.</sentence>
      <sentence>When meddlesome busybodies suggested that perhaps these hours were rather long, they were told that work kept adults from drink and children from mischief.</sentence>
      <sentence>When I was a child, shortly after urban working men had acquired the vote, certain public holidays were established by law, to the great indignation of the upper classes.</sentence>
      <sentence>I remember hearing an old Duchess say: 'What do the poor want with holidays? They ought to work.'</sentence>
      <sentence>People nowadays are less frank, but the sentiment persists, and is the source of much of our economic confusion.</sentence>
    </expected>
  </test>
  <test>
    <input>Let us, for a moment, consider the ethics of work frankly, without superstition. Every human being, of necessity, consumes, in the course of his life, a certain amount of the produce of human labor. Assuming, as we may, that labor is on the whole disagreeable, it is unjust that a man should consume more than he produces. Of course he may provide services rather than commodities, like a medical man, for example; but he should provide something in return for his board and lodging. to this extent, the duty of work must be admitted, but to this extent only. I shall not dwell upon the fact that, in all modern societies outside the USSR, many people escape even this minimum amount of work, namely all those who inherit money and all those who marry money. I do not think the fact that these people are allowed to be idle is nearly so harmful as the fact that wage-earners are expected to overwork or starve.</input>
    <expected>
      <sentence>Let us, for a moment, consider the ethics of work frankly, without superstition.</sentence>
      <sentence>Every human being, of necessity, consumes, in the course of his life, a certain amount of the produce of human labor.</sentence>
      <sentence>Assuming, as we may, that labor is on the whole disagreeable, it is unjust that a man should consume more than he produces.</sentence>
      <sentence>Of course he may provide services rather than commodities, like a medical man, for example; but he should provide something in return for his board and lodging.</sentence>
      <sentence>to this extent, the duty of work must be admitted, but to this extent only.</sentence>
      <sentence>I shall not dwell upon the fact that, in all modern societies outside the USSR, many people escape even this minimum amount of work, namely all those who inherit money and all those who marry money.</sentence>
      <sentence>I do not think the fact that these people are allowed to be idle is nearly so harmful as the fact that wage-earners are expected to overwork or starve.</sentence>
    </expected>
  </test>
  <test>
    <input>If the ordinary wage-earner worked four hours a day, there would be enough for everybody and no unemployment -- assuming a certain very moderate amount of sensible organization. This idea shocks the well-to-do, because they are convinced that the poor would not know how to use so much leisure. In America men often work long hours even when they are well off; such men, naturally, are indignant at the idea of leisure for wage-earners, except as the grim punishment of unemployment; in fact, they dislike leisure even for their sons. Oddly enough, while they wish their sons to work so hard as to have no time to be civilized, they do not mind their wives and daughters having no work at all. the snobbish admiration of uselessness, which, in an aristocratic society, extends to both sexes, is, under a plutocracy, confined to women; this, however, does not make it any more in agreement with common sense.</input>
    <expected>
      <sentence>If the ordinary wage-earner worked four hours a day, there would be enough for everybody and no unemployment -- assuming a certain very moderate amount of sensible organization.</sentence>
      <sentence>This idea shocks the well-to-do, because they are convinced that the poor would not know how to use so much leisure.</sentence>
      <sentence>In America men often work long hours even when they are well off; such men, naturally, are indignant at the idea of leisure for wage-earners, except as the grim punishment of unemployment; in fact, they dislike leisure even for their sons.</sentence>
      <sentence>Oddly enough, while they wish their sons to work so hard as to have no time to be civilized, they do not mind their wives and daughters having no work at all.</sentence>
      <sentence>the snobbish admiration of uselessness, which, in an aristocratic society, extends to both sexes, is, under a plutocracy, confined to women; this, however, does not make it any more in agreement with common sense.</sentence>
    </expected>
  </test>
  <test>
    <input>I remember that, in the time of my childhood, I was devout, and in the habit of keeping vigils, and eager to practise mortification and austerities. One night I sate up in attendance on my father, and did not close my eyes the whole night, and held the precious qur'an in my lap while the people around me slept. I said to my father, "Not one of these lifts up his head to perform a prayer. They are so profoundly asleep that you would say they were dead." He replied, "Life of thy father! it were better if thou, too, wert asleep; rather than thou shouldst be backbiting people."</input>
    <expected>
      <sentence>I remember that, in the time of my childhood, I was devout, and in the habit of keeping vigils, and eager to practise mortification and austerities.</sentence>
      <sentence>One night I sate up in attendance on my father, and did not close my eyes the whole night, and held the precious qur'an in my lap while the people around me slept.</sentence>
      <sentence>I said to my father, "Not one of these lifts up his head to perform a prayer. They are so profoundly asleep that you would say they were dead."</sentence>
      <sentence>He replied, "Life of thy father! it were better if thou, too, wert asleep; rather than thou shouldst be backbiting people."</sentence>
    </expected>
  </test>
  <test>
    <input>A similar movement is going on before our own eyes. Modern bourgeois society, with its relations of production, of exchange and of property, a society that has conjured up such gigantic means of production and of exchange, is like the sorcerer who is no longer able to control the powers of the nether world whom he has called up by his spells. For many a decade past the history of industry and commerce is but the history of the revolt of modern productive forces against modern conditions of production, against the property relations that are the conditions for the existence of the bourgeois and of its rule. It is enough to mention the commercial crises that by their periodical return put the existence of the entire bourgeois society on its trial, each time more threateningly. In these crises, a great part not only of the existing products, but also of the previously created productive forces, are periodically destroyed. In these crises, there breaks out an epidemic that, in all earlier epochs, would have seemed an absurdity – the epidemic of overproduction. Society suddenly finds itself put back into a state of momentary barbarism; it appears as if a famine, a universal war of devastation, had cut off the supply of every means of subsistence; industry and commerce seem to be destroyed; and why? Because there is too much civilisation, too much means of subsistence, too much industry, too much commerce. The productive forces at the disposal of society no longer tend to further the development of the conditions of bourgeois property; on the contrary, they have become too powerful for these conditions, by which they are fettered, and so soon as they overcome these fetters, they bring disorder into the whole of bourgeois society, endanger the existence of bourgeois property. The conditions of bourgeois society are too narrow to comprise the wealth created by them. And how does the bourgeoisie get over these crises? On the one hand by enforced destruction of a mass of productive forces; on the other, by the conquest of new markets, and by the more thorough exploitation of the old ones. That is to say, by paving the way for more extensive and more destructive crises, and by diminishing the means whereby crises are prevented. </input>
    <expected>
      <sentence>A similar movement is going on before our own eyes.</sentence>
      <sentence>Modern bourgeois society, with its relations of production, of exchange and of property, a society that has conjured up such gigantic means of production and of exchange, is like the sorcerer who is no longer able to control the powers of the nether world whom he has called up by his spells.</sentence>
      <sentence>For many a decade past the history of industry and commerce is but the history of the revolt of modern productive forces against modern conditions of production, against the property relations that are the conditions for the existence of the bourgeois and of its rule.</sentence>
      <sentence>It is enough to mention the commercial crises that by their periodical return put the existence of the entire bourgeois society on its trial, each time more threateningly.</sentence>
      <sentence>In these crises, a great part not only of the existing products, but also of the previously created productive forces, are periodically destroyed.</sentence>
      <sentence>In these crises, there breaks out an epidemic that, in all earlier epochs, would have seemed an absurdity – the epidemic of overproduction.</sentence>
      <sentence>Society suddenly finds itself put back into a state of momentary barbarism; it appears as if a famine, a universal war of devastation, had cut off the supply of every means of subsistence; industry and commerce seem to be destroyed; and why?</sentence>
      <sentence>Because there is too much civilisation, too much means of subsistence, too much industry, too much commerce.</sentence>
      <sentence>The productive forces at the disposal of society no longer tend to further the development of the conditions of bourgeois property; on the contrary, they have become too powerful for these conditions, by which they are fettered, and so soon as they overcome these fetters, they bring disorder into the whole of bourgeois society, endanger the existence of bourgeois property.</sentence>
      <sentence>The conditions of bourgeois society are too narrow to comprise the wealth created by them.</sentence>
      <sentence>And how does the bourgeoisie get over these crises?</sentence>
      <sentence>On the one hand by enforced destruction of a mass of productive forces; on the other, by the conquest of new markets, and by the more thorough exploitation of the old ones.</sentence>
      <sentence>That is to say, by paving the way for more extensive and more destructive crises, and by diminishing the means whereby crises are prevented.</sentence>
    </expected>
  </test>
  <test>
    <input>Almost five years ago, I realised that my bottle-of-wine a night habit was stamping all over my relationships, career and wellbeing in the manner of King Kong crashing through a city. So I quit, completely. Not without absolute dread, mind. I felt like I was pawning a bejewelled party dress to get money to pay the gas bill, or selling a Porsche to put into a pension. I knew it was sensible for me to stop, but did I want to do it? Hell no. So I was astonished to discover how much happier I became, and how much more my family and friends liked me. Sobriety is portrayed as social suicide. We are told – we tell each other – that alcohol is the bottle-shaped root of all fun, bonding, romance and relaxation. Phrases like “stone-cold sober” and “sober as a judge” hammer home the stern, preachy reputation of sobriety. But sober really doesn’t feel like that. Drinking is not socially essential. I am living proof, as are millions of others, that you can be 100% teetotal and have an infinitely more interesting social life. My going-out money no longer gets snaffled by endless bottles of house white at the pub, so I can explore other pursuits. I no longer stay out until 3am shouting at people I barely know, repeating myself, before getting stuck into some questionable chicken like a coyote. I don’t have terrifying rips in my memory where the end of the night should be, nor do I drag myself through the next day fantasising about being hit by a bus so that I can go where I feel like going – hospital. Drinking has a beautiful side, as well as a beastly one, of course. But then every drug has positives. MDMA made me dance like a lunatic for five hours straight and told me I loved everyone; I did acid once and had a fascinating conversation with a hand towel; when I did cocaine I felt like the hot damn Mistress of the Universe. Recreational drugs drop a veil over reality, they do a sexy belly dance in your brain; you do mad, spontaneous things, then in the morning you pick up the agonising tab. The flipside of MDMA was a week-long serotonin ennui, microdots convinced me that a woman on the nightbus was an assassin, and I may have felt silken and charming on coke, but everyone else thought I was an arrogant wazzock. None of those drugs were worth the price tag. They were too expensive, both psychologically and physically, for me. Alcohol is no different. It has its pros and it has its crashing lows. Alcohol allows you to segue swiftly from clenched to chilled, by sliding down the fast-route wine waterslide. Whoosh. You’re there. But are the lows worth the highs? For me, they weren’t. And a fifth of British adults think similarily, since they’re also teetotal, according to the latest Office for National Statistics figures. Drinking alcohol for health benefits is like eating burgers for the gherkins. Anyone still imbibing under this delusion needs to remove their head from the sandpit in the pub garden. Surely we already knew this, on an atomic level, that even a small amount of alcohol screws with our body and mental health? Even when I managed to keep my pub tab to just two drinks, the next day I still felt the smudge of tiredness, the scratch of anxiety, the roil of nausea, the ghost of sadness. Our body tells us that it hates even titchy amounts of booze, if we would only listen; we don’t really need a report to tell us.</input>
    <expected>
      <sentence>Almost five years ago, I realised that my bottle-of-wine a night habit was stamping all over my relationships, career and wellbeing in the manner of King Kong crashing through a city.</sentence>
      <sentence>So I quit, completely.</sentence>
      <sentence>Not without absolute dread, mind.</sentence>
      <sentence>I felt like I was pawning a bejewelled party dress to get money to pay the gas bill, or selling a Porsche to put into a pension.</sentence>
      <sentence>I knew it was sensible for me to stop, but did I want to do it?</sentence>
      <sentence>Hell no.</sentence>
      <sentence>So I was astonished to discover how much happier I became, and how much more my family and friends liked me.</sentence>
      <sentence>Sobriety is portrayed as social suicide.</sentence>
      <sentence>We are told – we tell each other – that alcohol is the bottle-shaped root of all fun, bonding, romance and relaxation.</sentence>
      <sentence>Phrases like “stone-cold sober” and “sober as a judge” hammer home the stern, preachy reputation of sobriety.</sentence>
      <sentence>But sober really doesn’t feel like that.</sentence>
      <sentence>Drinking is not socially essential.</sentence>
      <sentence>I am living proof, as are millions of others, that you can be 100% teetotal and have an infinitely more interesting social life.</sentence>
      <sentence>My going-out money no longer gets snaffled by endless bottles of house white at the pub, so I can explore other pursuits.</sentence>
      <sentence>I no longer stay out until 3am shouting at people I barely know, repeating myself, before getting stuck into some questionable chicken like a coyote.</sentence>
      <sentence>I don’t have terrifying rips in my memory where the end of the night should be, nor do I drag myself through the next day fantasising about being hit by a bus so that I can go where I feel like going – hospital.</sentence>
      <sentence>Drinking has a beautiful side, as well as a beastly one, of course.</sentence>
      <sentence>But then every drug has positives.</sentence>
      <sentence>MDMA made me dance like a lunatic for five hours straight and told me I loved everyone; I did acid once and had a fascinating conversation with a hand towel; when I did cocaine I felt like the hot damn Mistress of the Universe.</sentence>
      <sentence>Recreational drugs drop a veil over reality, they do a sexy belly dance in your brain; you do mad, spontaneous things, then in the morning you pick up the agonising tab.</sentence>
      <sentence>The flipside of MDMA was a week-long serotonin ennui, microdots convinced me that a woman on the nightbus was an assassin, and I may have felt silken and charming on coke, but everyone else thought I was an arrogant wazzock.</sentence>
      <sentence>None of those drugs were worth the price tag.</sentence>
      <sentence>They were too expensive, both psychologically and physically, for me.</sentence>
      <sentence>Alcohol is no different.</sentence>
      <sentence>It has its pros and it has its crashing lows.</sentence>
      <sentence>Alcohol allows you to segue swiftly from clenched to chilled, by sliding down the fast-route wine waterslide.</sentence>
      <sentence>Whoosh.</sentence>
      <sentence>You’re there.</sentence>
      <sentence>But are the lows worth the highs?</sentence>
      <sentence>For me, they weren’t.</sentence>
      <sentence>And a fifth of British adults think similarily, since they’re also teetotal, according to the latest Office for National Statistics figures.</sentence>
      <sentence>Drinking alcohol for health benefits is like eating burgers for the gherkins.</sentence>
      <sentence>Anyone still imbibing under this delusion needs to remove their head from the sandpit in the pub garden.</sentence>
      <sentence>Surely we already knew this, on an atomic level, that even a small amount of alcohol screws with our body and mental health?</sentence>
      <sentence>Even when I managed to keep my pub tab to just two drinks, the next day I still felt the smudge of tiredness, the scratch of anxiety, the roil of nausea, the ghost of sadness.</sentence>
      <sentence>Our body tells us that it hates even titchy amounts of booze, if we would only listen; we don’t really need a report to tell us.</sentence>
    </expected>
  </test>
  <test>
    <input>Heralded as the "best book on the dope decade" by the New York Times Book Review, Hunter S. Thompson's documented drug orgy through Las Vegas would no doubt leave Nancy Reagan blushing and D.A.R.E. founders rethinking their motto. Under the pseudonym of Raoul Duke, Thompson travels with his Samoan attorney, Dr. Gonzo, in a souped-up convertible dubbed the "Great Red Shark." In its trunk, they stow "two bags of grass, seventy-five pellets of mescaline, five sheets of high-powered blotter acid, a salt shaker half-full of cocaine and a whole galaxy of multicolored uppers, downers, screamers, laughers.... A quart of tequila, a quart of rum, a case of Budweiser, a pint of raw ether and two dozen amyls," which they manage to consume during their short tour.</input>
    <expected>
      <sentence>Heralded as the "best book on the dope decade" by the New York Times Book Review, Hunter S. Thompson's documented drug orgy through Las Vegas would no doubt leave Nancy Reagan blushing and D.A.R.E. founders rethinking their motto.</sentence>
      <sentence>Under the pseudonym of Raoul Duke, Thompson travels with his Samoan attorney, Dr. Gonzo, in a souped-up convertible dubbed the "Great Red Shark."</sentence>
      <sentence>In its trunk, they stow "two bags of grass, seventy-five pellets of mescaline, five sheets of high-powered blotter acid, a salt shaker half-full of cocaine and a whole galaxy of multicolored uppers, downers, screamers, laughers.... A quart of tequila, a quart of rum, a case of Budweiser, a pint of raw ether and two dozen amyls," which they manage to consume during their short tour.</sentence>
    </expected>
  </test>
  <test>
    <input>Fear and Loathing is one of the great classics of American journalism (literature?) and IMO the definitive book for developing an understanding on American drug culture in the late 20th century. The book is hilarious and horrifying, a piece of narrative genius both disrupted and enhanced by the author's instability and grotesqueness. More than anything it captures the ambivalent draw of a life on the edge -- with the exhilaration and freedom displayed alongside the self-loathing and despair. Thompson was both the most disgusting of men and the most empowered, and Fear &amp; Loathing is perhaps the most enduring display of this strange mixture. And like all good anti-hero's narratives, there's a powerful sense of voyeurism strewn throughout. I found myself drawn in by a powerful sense of vicariousness, and even more powerfully repulsed.</input>
    <expected>
      <sentence>Fear and Loathing is one of the great classics of American journalism (literature?) and IMO the definitive book for developing an understanding on American drug culture in the late 20th century.</sentence>
      <sentence>The book is hilarious and horrifying, a piece of narrative genius both disrupted and enhanced by the author's instability and grotesqueness.</sentence>
      <sentence>More than anything it captures the ambivalent draw of a life on the edge -- with the exhilaration and freedom displayed alongside the self-loathing and despair.</sentence>
      <sentence>Thompson was both the most disgusting of men and the most empowered, and Fear &amp; Loathing is perhaps the most enduring display of this strange mixture.</sentence>
      <sentence>And like all good anti-hero's narratives, there's a powerful sense of voyeurism strewn throughout.</sentence>
      <sentence>I found myself drawn in by a powerful sense of vicariousness, and even more powerfully repulsed.</sentence>
    </expected>
  </test>
  <test>
    <input>I admit that I only read the book after seeing the movie when I was younger, and even after hearing the song by Avenged Sevenfold "Bat Country", but this story changed a lot about the way I think. "The American Dream" is the theme of this adventure story (though I use the term adventure in place of "drug binge fueled blaze across Nevada), and two unlikely companion take their wild "trip" to the heart of Nevada: Las Vegas to find the dream and write about it to bring home. This story is very crazy to be honest but it is time and time again one of my favourite stories. If you are into half truth and half fiction stories where it is hard to draw the line between what could have really happened and what exactly was fabricated you will enjoy the wild ride Thompson will put you through in Fear and Loathing. It has twists and turns and bizarre events at every turn. It will keep you enthralled and engaged and you can buy a ticket to take this ride safely from the comfort of your home.</input>
    <expected>
      <sentence>I admit that I only read the book after seeing the movie when I was younger, and even after hearing the song by Avenged Sevenfold "Bat Country", but this story changed a lot about the way I think.</sentence>
      <sentence>"The American Dream" is the theme of this adventure story (though I use the term adventure in place of "drug binge fueled blaze across Nevada), and two unlikely companion take their wild "trip" to the heart of Nevada: Las Vegas to find the dream and write about it to bring home.</sentence>
      <sentence>This story is very crazy to be honest but it is time and time again one of my favourite stories.</sentence>
      <sentence>If you are into half truth and half fiction stories where it is hard to draw the line between what could have really happened and what exactly was fabricated you will enjoy the wild ride Thompson will put you through in Fear and Loathing.</sentence>
      <sentence>It has twists and turns and bizarre events at every turn.</sentence>
      <sentence>It will keep you enthralled and engaged and you can buy a ticket to take this ride safely from the comfort of your home.</sentence>
    </expected>
  </test>
  <test>
    <input>Magna Carta Libertatum (Medieval Latin for "the Great Charter of the Liberties"), commonly called Magna Carta (also Magna Charta; "Great Charter"),[a] is a charter agreed to by King John of England at Runnymede, near Windsor, on 15 June 1215. First drafted by the Archbishop of Canterbury to make peace between the unpopular King and a group of rebel barons, it promised the protection of church rights, protection for the barons from illegal imprisonment, access to swift justice, and limitations on feudal payments to the Crown, to be implemented through a council of 25 barons. Neither side stood behind their commitments, and the charter was annulled by Pope Innocent III, leading to the First Barons' War. After John's death, the regency government of his young son, Henry III, reissued the document in 1216, stripped of some of its more radical content, in an unsuccessful bid to build political support for their cause. At the end of the war in 1217, it formed part of the peace treaty agreed at Lambeth, where the document acquired the name Magna Carta, to distinguish it from the smaller Charter of the Forest which was issued at the same time. Short of funds, Henry reissued the charter again in 1225 in exchange for a grant of new taxes. His son, Edward I, repeated the exercise in 1297, this time confirming it as part of England's statute law.</input>
    <expected>
      <sentence>Magna Carta Libertatum (Medieval Latin for "the Great Charter of the Liberties"), commonly called Magna Carta (also Magna Charta; "Great Charter"),[a] is a charter agreed to by King John of England at Runnymede, near Windsor, on 15 June 1215.</sentence>
      <sentence>First drafted by the Archbishop of Canterbury to make peace between the unpopular King and a group of rebel barons, it promised the protection of church rights, protection for the barons from illegal imprisonment, access to swift justice, and limitations on feudal payments to the Crown, to be implemented through a council of 25 barons.</sentence>
      <sentence>Neither side stood behind their commitments, and the charter was annulled by Pope Innocent III, leading to the First Barons' War.</sentence>
      <sentence>After John's death, the regency government of his young son, Henry III, reissued the document in 1216, stripped of some of its more radical content, in an unsuccessful bid to build political support for their cause.</sentence>
      <sentence>At the end of the war in 1217, it formed part of the peace treaty agreed at Lambeth, where the document acquired the name Magna Carta, to distinguish it from the smaller Charter of the Forest which was issued at the same time.</sentence>
      <sentence>Short of funds, Henry reissued the charter again in 1225 in exchange for a grant of new taxes.</sentence>
      <sentence>His son, Edward I, repeated the exercise in 1297, this time confirming it as part of England's statute law.</sentence>
    </expected>
  </test>
  <test>
    <input>Saint Maximus (died 250) is a Christian saint and martyr.[1] The emperor Decius published a decree ordering the veneration of busts of the deified emperors.</input>
    <expected>
      <sentence>Saint Maximus (died 250) is a Christian saint and martyr.[1]</sentence>
      <sentence>The emperor Decius published a decree ordering the veneration of busts of the deified emperors.</sentence>
    </expected>
  </test>
  <test>
    <input>Differing agendas can potentially create an understanding gap in a consultation.11 12 Take the example of one of the most common presentations in ill health: the common cold.</input>
    <expected>
      <sentence>Differing agendas can potentially create an understanding gap in a consultation.11 12</sentence>
      <sentence>Take the example of one of the most common presentations in ill health: the common cold.</sentence>
    </expected>
  </test>
  <test>
    <input>Daniel Kahneman popularised the concept of fast and slow thinking: the distinction between instinctive (type 1 thinking) and reflective, analytical cognition (type 2).10 This model relates to doctors achieving a balance between efficiency and effectiveness.</input>
    <expected>
      <sentence>Daniel Kahneman popularised the concept of fast and slow thinking: the distinction between instinctive (type 1 thinking) and reflective, analytical cognition (type 2).10</sentence>
      <sentence>This model relates to doctors achieving a balance between efficiency and effectiveness.</sentence>
    </expected>
  </test>
  <test>
    <input>Its traditional use[1] is well documented in the ethnobotanical literature [2–11]. Leaves, buds, tar and essential oils are used to treat a wide spectrum of diseases.</input>
    <expected>
      <sentence>Its traditional use[1] is well documented in the ethnobotanical literature [2–11].</sentence>
      <sentence>Leaves, buds, tar and essential oils are used to treat a wide spectrum of diseases.</sentence>
    </expected>
  </test>
  <test>
    <input>Thus increasing the desire for political reform both in Lancashire and in the country at large.[7][8] This was a serious misdemeanour,[16] encouraging them to declare the assembly illegal as soon as it was announced on 31 July.[17][18] The radicals sought a second opinion on the meeting's legality.</input>
    <expected>
      <sentence>Thus increasing the desire for political reform both in Lancashire and in the country at large.[7][8]</sentence>
      <sentence>This was a serious misdemeanour,[16] encouraging them to declare the assembly illegal as soon as it was announced on 31 July.[17][18]</sentence>
      <sentence>The radicals sought a second opinion on the meeting's legality.</sentence>
    </expected>
  </test>
</tests>