Skip to content

Latest commit

 

History

History
133 lines (91 loc) · 8.9 KB

README.md

File metadata and controls

133 lines (91 loc) · 8.9 KB

rq-count_v1


In Silico Workflow for Calculating the Richness of Gene Deletion Mutants in Mixed Samples from Raw Paired-End Short-Read Whole Genome Sequencing Data

Introduction


rq-count_v1 is a comprehensive in silico workflow designed to simplify the processing of raw paired-end short-read whole genome sequencing (WGS) data derived from bacterial samples containing various gene-deletion mutant strains. This workflow includes a well-structured Snakemake script for reads pre-processing and mapping. Additionally, the "scripts" folder houses corresponding Python scripts that allow for the extraction of mapping information and the calculation of mutant richness within the sample.

Key Features


  • Snakemake Script: The provided Snakemake script efficiently handles reads pre-processing and mapping, ensuring a smooth and organized workflow.
  • Python Scripts: The "scripts" folder houses Python scripts that enable users to extract mapping information and calculate the richness of gene deletion mutants in their samples.

Dependencies


  1. python 3.11.3 and following librarires are required;
  1. snakemake 7.25.3;
  2. conda 23.5.0;

Workflow overview


  • Overview of rq-count_v1 workflow.

Quick Start (run it on Linux system)


Installation

  • git clone the rq-count_v1 folder to your local computer;
$ git clone https://github.com/china-fix/rq-count_v1.git
  • export the rq-count_v1 folder to PATH (optional);
  • install conda and create a new snakemake env;
$ conda install -n base -c conda-forge mamba
$ conda activate base
$ conda activate snakemake
$ snakemake --help
  • install python biopython pandas scikit-learn
$ conda install python biopython pandas scikit-learn -n snakemake

Usage

Raw reads pre-processing and mapping

  • In your working folder, establish a structured directory with the following arrangement:
  1. The primary directory is named "in."
  2. Inside the "in" directory, create a subfolder named "REF."In this "REF" subfolder, you should place the reference genome in FASTA format. Ensure that the reference file is named with a ".REF" extension. For example, you can name it "reference_genome.fasta.REF."
  3. Alongside the "REF" subfolder, place your raw sequencing reads data files. Each sample should consist of two files, typically denoted as "_1.fq.gz" and "_2.fq.gz" to represent the paired-end reads. For instance, if you have two samples, "sample1" and "sample2," you would place their corresponding read files as "your_raw_reads_sample1_1.fq.gz," "your_raw_reads_sample1_2.fq.gz," "your_raw_reads_sample2_1.fq.gz," and "your_raw_reads_sample2_2.fq.gz." This organized folder structure will facilitate efficient data management and analysis for your sequencing project.
└── in
    ├── REF
    │   └── your_reference_fasta_file.REF
    ├── your_raw_reads_sample1_1.fq.gz
    ├── your_raw_reads_sample1_2.fq.gz
    ├── your_raw_reads_sample2_1.fq.gz
    └── your_raw_reads_sample2_2.fq.gz
  • run the command in your working direcotry
snakemake -s Snakefile -c 8 --use-conda
  • New folder named report will be created in your working directory, the .tab file recorded the mapping depth which is comare with our python script relative_mapping_caculation_V2.0.py

Calculate the relative richness of deletion-mutant

  • prepare a fasta file recording all your gene-deletion sequence, the format looks like below
>KO_gene1
tacagcaacggactgaagaagtaaaacagtcgctcggcgacacgttgccataatggacgttttagccataaacgggcatcgagcagacgtgaacgcgaaatataatcgtcctgaacggcggcgaggtcagcaccaaaacctttatcgtcgattgccagggtaatctcgaaatttagccacagactacgcatatcaaggttaactgtgccaaccagacttagttcgccatcgaccagcacgctcttggtatgcagtaacccgccttcaaactgataaattttaaccccagcagccagcagttccgtaaagaatgcgcgactggcccagccgaccagcatcgagtcattttttcgcggaaggataatactgacatccaccccgcgctgcgccgccgtgcaaatcgcatgaagtaaatcatcgcttggcacaaagtagggcgtggtcatgatcaaatattcacgcgccgaataagccgcagtcaataatgcctggtgaatgagatcttccggaaagccggggccagaagcaattgtgtgaatggtgtgaccgctggcctgttcaaacggcataatattgacatctggtggtggcggcagaatacgttttccggtttcaatctcccagtcgcaggaataaataatccccatcgcggtggcgatagggccttccatacgcgccatcagatcaatccattgccctacgcccgcatcttgtttgaagtagcgaggatcgaccatattcatgctgccggtgtacgcgatgtaattatcgatcatgatcatcttgcgatgttggcgcaggtccatacggcgtaaaaacacacgcatcagattgacctttaaggcttcgaccacttcaataccggcattacgcattagctcgggccacgggctgcggaaaaaagccacactcccggcggagtcgagcatcaatcggcaatgaatgccgcgtcgcgcagccgccattaatgattcagccacctggtccgccatgccgccgggctgccagatataaaacaccatctcaatattatggcgcgcgagctggatgtcgcggattaacgcctgcatcacatcatctgactcggtcatcagttgtagctgattccctttgaccccagcgatcccctgacgacgctcgcaaagcttgaataatggcgcagcgacactgctattttcttcggcgaagatatgcttacaggctttaaggtcgttaagccattttgcggtggaaggccacatcgctctggcgcgctcagcgcggcgtttgcctaaatggagctcgccaacggcaagataggcaataattccgactaacggcagaatgtaaataatcaacagccaggccatcgcggagggaactgcgcgtcgtttcattagaatgcgtaaagttacgcctgcaatgagcaaccagtatcccagaatggccaaccaactcaccaacgtataaacggttgtcat
>KO_gene2
atgaataaaatcctgttagttgatgatgaccgagagctgacttattaaaggagctgctcgagatggaaggcttcaacgtgattgttgcccacgatggggaacaggcgcttgatcttctggacgacagcattgatttacttttgcttgacgtaatgatgccgaagaaaaatggtatcgacacattaaaagcacttcgccagacacaccagacgcctgtcattatgttgacggcgcgcggcagtgaacttgatcgcgttctcggccttgagctgggcgcagatgactatctcccgaaaccgtttaatgatcgtgagctggtggcacgtattcgcgcgatcctgcgccgttcgcactggagcgagcaacagcaaaacaacgacaacggttcaccgacactggaagttgatgccttagtgctgaatccaggccgtcaggaagccagcttcgacgggcaaacgctggagttaaccggtactgagtttaccctgctctatttgctggcacagcatctgggtcaggtggtttcccgtgaacatttaagccaggaagtgttgggcaaacgcctgacgcctttcgaccgcgctattgatatgcacatttccaacctgcgtcgtaaactgccggatcgtaaagatggtcacccgtggtttaaaaccttgcgtggtcgcggctatctgatggtttctgcttcatga
>KO_gene3
aatcagcccggtaataacggacaagaccgcgacccgtggggaagcagcaaacctggcggcaactctgagggaaatggaaacaaaggcggtcgcgatcaagggccacctgatttagatgatatcttccgcaaactgagcaaaaagctcggtggtctgggcggcggtaaaggcaccggatctggcggtggcagttcatcgcaaggcccgcgcccgcagcttggcggtcgtgtcgttaccatcgcagcggcagcgattgtcattatctgggcggccagtggtttctataccattaaagaagccgaacgcggcgtggtaacacgctttggtaaattcagccatctggttgagccgggtctgaactggaaaccgacgtttatcgacgaagtcaaaccggtgaacgtggaagccgtgcgtgaactggccgcttctggtgtgatgctgacgtcggacgagaacgtagtgcgcgttgagatgaacgtgcagtaccgcgtcaccaatccggaaaaatatctgtatagcgtgaccagcccggatgacagcctgcgtcaggctaccgacagcgccctgcgtggagttatcggtaaatacaccatggaccgcattctgacggaaggtcgtaccgtgattcgtagcgatactcagcgcgaactggaagagacgattcgtccgtatgacatgggtatcacgctgctggacgtcaacttccaggctgctcgtccgccggaagaagtaaaagcggcgtttgacgatgcgattgccgcgcgtgaaaacgaacagcaatacattcgtgaagcagaagcgtataccaacgaagttcagccgcgtgcgaacggtcaggcgcaacgtatcctcgaagaggcgcgtgcgtacaaggcccagaccatcctggaagctcagggtgaagtggcgcgctttgctaaacttctgccggaatataaagccgcgccggaaattactcgcgagcgtctgtatatcgagacgatggaaaaagtgttgggtaacacccgcaaagtgctggttaacgataaaggtggcaacctgatggttctgccgttagaccagatgctgaaaggtggtaacgcccctgcggcgaagagcgataacggtgccagcaatctgctgcgtctgccgccagcctcttcctccacaaccagtggagcaagcaacacgtcgtccaccagtcagggcgatattatggaccaacgccgcgccaacgcgcagcgtaacgactaccagcgtcagggggaataacgatgcgtaagtcagttatcgcgattatcatcatcgtgctggtagtgctttacatgtctgtctttgtcgtcaaagaaggtgagcgcggtattacgctgcgttttggtaaggtactgcgtgacgatgacaacaaacctctggtttatgagccgggtctgcatttcaagataccgttcattgaaacggtgaaaatgctcgacgcacgtattcagaccatggacaaccaggccgaccgctttgtgaccaaagagaagaaagacctgatcgtcgactcttacatcaaatggcgcatcagcgatttcagccgttactacctggcaacgggtggtggcgacatttcgcaagcggaagtgctgttgaaacgtaagttctctgaccgtctgcgttctgaaattggtcgcctggacgtgaaagatatcgtcaccgattcccgtggtcgtctgaccctcgaagtacgtgacgcgctgaactccggttctgcgggtacagaagatgaagttactaccccggcggcagataacgccattgccgaagcggcagagcgcgtaacggctgagacgaagggcaaagttccggtcatcaacccgaacagtatggcggcgctgggtattgaagttgtcgatgtgcgtatcaagcagatcaacctgccgaccgaagtgtctgaagcgatctacaaccgtatgcgcgccgagcgtgaagcggtagcgcgtcgtcaccgttcacaaggtcaggaagaagcggaaaaactgcgcgcgactgccgactatgaagtgaccagaacgctggcagaagctgagcgtcagggccgcatcatgcgtggtgaaggcgatgccgaagcagccaaactgtttgctgatgcattcagtaaagatccggacttctacgcattcatccgtagcctgcgtgcttatgagaacagcttctctggcaatcaggacgtgatggtcatgagcccggatagcgatttcttccgctacatgaagacgccgacttccgca
...

Usage: relative_mapping_caculation_V2.0.py

options:
  -h, --help            show this help message and exit
  --MAPPING_REF FILENAME
                        the fasta filename you used for bwa mapping reference
  --TARGETS FILENAME    the fasta file includes all the tested gene sequences you want to measure
  --DEPTH_TAB FILENAME  the tab file describe the mapping depth of every base
  --CUTLEN DEFAULT 5000
                        the flanking seq length for target catulation part (extracted for model learning)
  --FIXLEN FIXLEN       flanking seq length you want to drop near the deletion edge location (default is 0)
  --OUT FILENAME        Output file name, report as default
  --DEV                 for developping and testing only normal user can just ignore this

Citation

....

Acknowledgments