Strings-string-functions-Python.md

layout	topic	title	language
exercise	Strings	string Functions	Python

Use functions from the string module or from base Python to print the following strings.

1. 'species' in all capital letters
2. 'gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg' with all of the occurrences of 'a' replaced with 'A'
3. "    Thank goodness it's Friday" without the leading white space (i.e., without the spaces before Thank)
4. The number of 'a's in 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'.
5. Print the length of this dna sequence 'gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg'