New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
error #32
Comments
Hi @hust-yyan , The error is, it is not finding the umi length. Since it is Qiagen UMI, you need to add this parameter to your command Also, I noticed you have used BAM parameter, I request you to refer this previous issue and download the libarary to result you BAM output . Further, just to test if UMI's are working correctly, I would suggest you minimize the parameters of secondary output as this will save time. Let me know if this works. Thanks, |
Hi @hust-yyan, I believe you are looking at mapped.csv file, which reports miRNAs at individual collapsed reads with their read counts. If you are interested at miRNA level expression values, you should be looking at miR.Counts.csv (for counts) or for RPM values, miR.RPM.csv. If you are interested in isomiRs you should be looking at a file with extension Here cannonical sequence for miR-223-3p is "TGTCAGTTTGTCAAATACCCCA" and the counts for 118,460 corresponds to a non-template addtion of Thank you, |
Hello, my data is Qiagen small RNA-seq. I tried to perform an analysis with the following code, but I encountered the following error.$indir/$ {sample}/${sample}_R1.fastq.gz
export PATH=/home/yyan/miniconda3/envs/py3.7/bin:$PATH
outdir=/data1/shiyan_data/mirge
lib=/home/yyan/database/miRge3_Lib
indir=/data1/shiyan_data/plasma_miRNA
sample=$1
/home/yyan/miniconda3/envs/py3.7/bin/miRge3.0 -s
-lib ${lib} -on human -db miRBase -o ${outdir}/${sample} --qiagenumi -cpu 3 -q 20 -NX -nmir -minl 16 -maxl 25 -c 2 -mloc 3 -sl 25 -olc 14 -clc 30 -gff -bam -ai -tcf -trf -a AACTGTAGGCACCATCAAT
The text was updated successfully, but these errors were encountered: