To begin with, import the pysam module and open a :class:`pysam.AlignmentFile`:
import pysam samfile = pysam.AlignmentFile("ex1.bam", "rb")
The above command opens the file :file:`ex1.bam` for reading.
The b
qualifier indicates that this is a :term:`BAM` file.
To open a :term:`SAM` file, type:
import pysam samfile = pysam.AlignmentFile("ex1.sam", "r")
:term:`CRAM` files are identified by a c
qualifier:
import pysam samfile = pysam.AlignmentFile("ex1.cram", "rc")
Fetching reads mapped to a :term:`region`
Reads are obtained through a call to the :meth:`pysam.AlignmentFile.fetch` method which returns an iterator. Each call to the iterator will returns a :class:`pysam.AlignedSegment` object:
iter = samfile.fetch("seq1", 10, 20) for x in iter: print (str(x))
:meth:`pysam.AlignmentFile.fetch` returns all reads overlapping a region sorted by the first aligned base in the :term:`reference` sequence. Note that it will also return reads that are only partially overlapping with the :term:`region`. Thus the reads returned might span a region that is larger than the one queried.
In contrast to :term:`fetching`, the :term:`pileup` engine returns for each base in the :term:`reference` sequence the reads that map to that particular position. In the typical view of reads stacking vertically on top of the reference sequence similar to a multiple alignment, :term:`fetching` iterates over the rows of this implied multiple alignment while a :term:`pileup` iterates over the :term:`columns`.
Calling :meth:`~pysam.AlignmentFile.pileup` will return an iterator over each :term:`column` (reference base) of a specified :term:`region`. Each call to the iterator returns an object of the type :class:`pysam.PileupColumn` that provides access to all the reads aligned to that particular reference position as well as some additional information:
iter = samfile.pileup('seq1', 10, 20) for x in iter: print (str(x))
The following example shows how a new :term:`BAM` file is constructed from scratch. The important part here is that the :class:`pysam.AlignmentFile` class needs to receive the sequence identifiers. These can be given either as a dictionary in a header structure, as lists of names and sizes, or from a template file. Here, we use a header dictionary:
header = { 'HD': {'VN': '1.0'}, 'SQ': [{'LN': 1575, 'SN': 'chr1'}, {'LN': 1584, 'SN': 'chr2'}] } with pysam.AlignmentFile(tmpfilename, "wb", header=header) as outf: a = pysam.AlignedSegment() a.query_name = "read_28833_29006_6945" a.query_sequence="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG" a.flag = 99 a.reference_id = 0 a.reference_start = 32 a.mapping_quality = 20 a.cigar = ((0,10), (2,1), (0,25)) a.next_reference_id = 0 a.next_reference_start=199 a.template_length=167 a.query_qualities = pysam.qualitystring_to_array("<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") a.tags = (("NM", 1), ("RG", "L1")) outf.write(a)
Pysam does not support reading and writing from true python file objects, but it does support reading and writing from stdin and stdout. The following example reads from stdin and writes to stdout:
infile = pysam.AlignmentFile("-", "r") outfile = pysam.AlignmentFile("-", "w", template=infile) for s in infile: outfile.write(s)
It will also work with :term:`BAM` files. The following script converts a :term:`BAM` formatted file on stdin to a :term:`SAM` formatted file on stdout:
infile = pysam.AlignmentFile("-", "rb") outfile = pysam.AlignmentFile("-", "w", template=infile) for s in infile: outfile.write(s)
Note that the file open mode needs to changed from r
to rb
.
Commands available in :term:`csamtools` are available as simple function calls. Command line options are provided as arguments. For example:
pysam.sort("-o", "output.bam", "ex1.bam")
corresponds to the command line:
samtools sort -o output.bam ex1.bam
Or for example:
pysam.sort("-m", "1000000", "-o", "output.bam", "ex1.bam")
In order to get usage information, try:
print(pysam.sort.usage())
Argument errors raise a :class:`pysam.SamtoolsError`:
pysam.sort() Traceback (most recent call last): File "x.py", line 12, in <module> pysam.sort() File "/build/lib.linux-x86_64-2.6/pysam/__init__.py", line 37, in __call__ if retval: raise SamtoolsError( "\n".join( stderr ) ) pysam.SamtoolsError: 'Usage: samtools sort [-n] [-m <maxMem>] <in.bam> <out.prefix>\n'
Messages from :term:`csamtools` on stderr are captured and are available using the :meth:`getMessages` method:
pysam.sort.getMessage()
Note that only the output from the last invocation of a command is stored.
In order for pysam to make the output of samtools commands accessible
the stdout stream needs to be redirected. This is the default
behaviour, but can cause problems in environments such as the ipython
notebook. A solution is to pass the catch_stdout
keyword
argument:
pysam.sort(catch_stdout=False)
Note that this means that output from commands which produce output on stdout will not be available. The only solution is to run samtools commands through subprocess.
To open a tabular file that has been indexed with tabix_, use :class:`~pysam.TabixFile`:
import pysam tbx = pysam.TabixFile("example.bed.gz")
Similar to :class:`~pysam.AlignmentFile.fetch`, intervals within a region can be retrieved by calling :meth:`~pysam.TabixFile.fetch()`:
for row in tbx.fetch("chr1", 1000, 2000): print (str(row))
This will return a tuple-like data structure in which columns can be retrieved by numeric index:
- for row in tbx.fetch("chr1", 1000, 2000):
- print ("chromosome is", row[0])
By providing a parser to :class:`~pysam.AlignmentFile.fetch` or :class:`~pysam.TabixFile`, the data will we presented in parsed form:
for row in tbx.fetch("chr1", 1000, 2000, parser=pysam.asTuple()): print ("chromosome is", row.contig) print ("first field (chrom)=", row[0])
Pre-built parsers are available for :term:`bed` (:class:`~pysam.asBed`) formatted files and :term:`gtf` (:class:`~pysam.asGTF`) formatted files. Thus, additional fields become available through named access, for example:
for row in tbx.fetch("chr1", 1000, 2000, parser=pysam.asBed()): print ("name is", row.name)
To iterate through a VCF/BCF formatted file use :class:`~pysam.VariantFile`:
from pysam import VariantFile bcf_in = VariantFile("test.bcf") # auto-detect input format bcf_out = VariantFile('-', 'w', header=bcf_in.header) for rec in bcf_in.fetch('chr1', 100000, 200000): bcf_out.write(rec)
:meth:`_pysam.VariantFile.fetch()` iterates over :class:`~pysam.VariantRecord` objects which provides access to simple variant attributes such as :class:`~pysam.VariantRecord.contig`, :class:`~pysam.VariantRecord.pos`, :class:`~pysam.VariantRecord.ref`:
for rec in bcf_in.fetch(): print (rec.pos)
but also to complex attributes such as the contents to the :term:`info`, :term:`format` and :term:`genotype` columns. These complex attributes are views on the underlying htslib data structures and provide dictionary-like access to the data:
for rec in bcf_in.fetch(): print (rec.info) print (rec.info.keys()) print (rec.info["DP"])
The :py:attr:`~pysam.VariantFile.header` attribute (:class:`~pysam.VariantHeader`) provides access information stored in the :term:`vcf` header. The complete header can be printed:
>>> print (bcf_in.header) ##fileformat=VCFv4.2 ##FILTER=<ID=PASS,Description="All filters passed"> ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth"> ##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency"> ##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele"> ##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129"> ##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership"> ##FILTER=<ID=q10,Description="Quality below 10"> ##FILTER=<ID=s50,Description="Less than 50% of samples have data"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality"> ##contig=<ID=M> ##contig=<ID=17> ##contig=<ID=20> ##bcftools_viewVersion=1.3+htslib-1.3 ##bcftools_viewCommand=view -O b -o example_vcf42.bcf example_vcf42.vcf.gz #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA0000
Individual contents such as contigs, info fields, samples, formats can be retrieved as attributes from :py:attr:`~pysam.VariantFile.header`:
>>> print (bcf_in.header.contigs) <pysam.cbcf.VariantHeaderContigs object at 0xf250f8>
To convert these views to native python types, iterate through the views:
>>> print list((bcf_in.header.contigs)) ['M', '17', '20'] >>> print list((bcf_in.header.filters)) ['PASS', 'q10', 's50'] >>> print list((bcf_in.header.info)) ['NS', 'DP', 'AF', 'AA', 'DB', 'H2'] >>> print list((bcf_in.header.samples)) ['NA00001', 'NA00002', 'NA00003']
Alternatively, it is possible to iterate through all records in the header returning objects of type :py:class:`~pysam.VariantHeaderRecord`::
>>> for x in bcf_in.header.records: >>> print (x) >>> print (x.type, x.key) GENERIC fileformat FILTER FILTER GENERIC fileDate GENERIC source GENERIC reference GENERIC phasing INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO FILTER FILTER FILTER FILTER FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT CONTIG contig CONTIG contig CONTIG contig GENERIC bcftools_viewVersion GENERIC bcftools_viewCommand
Using pyximport_, it is (relatively) straight-forward to access pysam internals and the underlying samtools library. An example is provided in the :file:`tests` directory. The example emulates the samtools flagstat command and consists of three files:
The main script :file:`pysam_flagstat.py`. The important lines in this script are:
import pyximport pyximport.install() import _pysam_flagstat ... flag_counts = _pysam_flagstat.count(pysam_in)
The first part imports, sets up pyximport_ and imports the cython module :file:`_pysam_flagstat`. The second part calls the
count
method in :file:`_pysam_flagstat`.The cython implementation :file:`_pysam_flagstat.pyx`. This script imports the pysam API via:
from pysam.calignmentfile cimport AlignmentFile, AlignedSegment
This statement imports, amongst others, :class:`AlignedSegment` into the namespace. Speed can be gained from declaring variables. For example, to efficiently iterate over a file, an :class:`AlignedSegment` object is declared:
# loop over samfile cdef AlignedSegment read for read in samfile: ...
A :file:`pyxbld` providing pyximport_ with build information. Required are the locations of the samtools and pysam header libraries of a source installation of pysam plus the :file:`csamtools.so` shared library. For example:
def make_ext(modname, pyxfilename): from distutils.extension import Extension import pysam return Extension(name=modname, sources=[pyxfilename], extra_link_args=pysam.get_libraries(), include_dirs=pysam.get_include(), define_macros=pysam.get_defines())
If the script :file:`pysam_flagstat.py` is called the first time, pyximport_ will compile the cython_ extension :file:`_pysam_flagstat.pyx` and make it available to the script. Compilation requires a working compiler and cython_ installation. Each time :file:`_pysam_flagstat.pyx` is modified, a new compilation will take place.
pyximport_ comes with cython_.