DNA splint sequence

[callumparr]

I wanted to try out this script using the SRA archived SIRV data but I cannot see a DNA splint sequence supplied. I think I worked out the sequence from find the fwd and rev primer sequences in a downloaded lambda DNA fasta file. But I am unsure whether this is the exact lambda DNA sequence you used or not

Sequence is included the:

TGAGGCTGATGAGTTCCATATTTGAAAAGTTTTCATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTATCTACTCTCATACAACCAATAAATGCTGAAATGAATTCTAAGCGGAGATCGCCTAGTGATTTTAAACTATTGCTGGCAGCATTCTTGAGTCCAATATAAAAGTATTGTGTACCTTTTGCTGGGTCAGGTTGTTCTTTAGGAGGAGTAAAAGGATCAAATGCACTAAACGAAACTGAAACAAGCGATCGAAAATATCCCTTT

[rvolden]

Yeah that looks fine to me