Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
0 parents
commit a2dda9e
Showing
9 changed files
with
85 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,10 @@ | ||
/target | ||
/lib | ||
/classes | ||
/checkouts | ||
pom.xml | ||
*.jar | ||
*.class | ||
.lein-deps-sum | ||
.lein-failures | ||
.lein-plugins |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,13 @@ | ||
# rosalind | ||
|
||
A Clojure library designed to ... well, that part is up to you. | ||
|
||
## Usage | ||
|
||
FIXME | ||
|
||
## License | ||
|
||
Copyright © 2013 FIXME | ||
|
||
Distributed under the Eclipse Public License, the same as Clojure. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
ATATTCTAAGTTCCCGCACTATCTTCTAACCCGACTACGGGACCGGCATACGACCACACCCTCTCTTATACATGGCGGTTCTGACCATTGTTGATGCCTCTCTTGATACCGCAGAACGGAATCTAAGCCCGCGACAACTTATGTCGGCCCCAAGGGCATGGCCAGGCTTTTTATCAGTTACATTACATTGGAATAGGCATCTGCGGCGAGTCACTCTCGTGTCTACGGTCCGCTTCGACGAGGTTTGCCTTTGCCGGTCTCGGACGAATATCTATCGAGAATCATGCTGGACTTAACTCTATGAGTGGTCGTTAACACGCAACTTAAAACCAAAGACTAAAGGAATTGCCGTTGCATACTCGGAGATACTAACCACGACAAGATTTAGGATCGCTCCTGTCGGGTCATTACTGATTGGTTAGTGAGATTTCGACTCTTTGAGAAGAGCACTTTACTTAAGTCGCCGGTGACGTCATCACCTCAGCCATATAATAGGTACATTTTTCCGATCTCGGTGCTGGACGTCACACGCGGTTGTAGTGAGACGACGAGAATGGACTCAGTCAGAAGCTATTAACTGCTTGACACGCCCTCGACCTGGTGCCGAAAAAGTGAACTCTGTTTTGATTTTTATAAAGGGATCACGGTTTCAAAGATCCTGCTCTCTGCCTATGAACGTCATTCTTAATGCAGAGATTTACAGATGAGACGATGTAGCGGCGGCACCTAATACTGTATAGCATACCGGTGGCAGCAAATCTGTATGCGATGCCATCTGGGCCAGCTATATATCACGATGTTCTAGATAGGAGTTGCAACACGGACTCGACATCACTACGAATACAAAACCATATTATAGTCTAGCATTGAATGCTTGGAATTACTCCTAGAACTAGCCCGCACGGTATGTGGCAAAGG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
# Introduction to rosalind | ||
|
||
TODO: write [great documentation](http://jacobian.org/writing/great-documentation/what-to-write/) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,7 @@ | ||
(defproject rosalind "0.1.0" | ||
:description "FIXME: write description" | ||
:url "http://example.com/FIXME" | ||
:license {:name "Eclipse Public License" | ||
:url "http://www.eclipse.org/legal/epl-v10.html"} | ||
:dependencies [[org.clojure/clojure "1.4.0"]] | ||
:main rosalind.core) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,24 @@ | ||
(ns rosalind.basics) | ||
|
||
(defn dna-counter-fn | ||
"This actually does the counting" | ||
[dna cnt] | ||
(loop [d dna | ||
c cnt] | ||
(let [l (first d) | ||
r (rest d)] | ||
(case l | ||
\A (def h (assoc c :A (+ 1 (:A c)))) | ||
\G (def h (assoc c :G (+ 1 (:G c)))) | ||
\C (def h (assoc c :C (+ 1 (:C c)))) | ||
\T (def h (assoc c :T (+ 1 (:T c)))) | ||
nil) | ||
(if (empty? r) | ||
h | ||
(recur r h))))) | ||
|
||
(defn dna-count | ||
"Counts DNA Neucleotides" | ||
[dna] | ||
(let [h (dna-counter-fn dna {:A 0 :C 0 :T 0 :G 0})] | ||
[(:A h) (:C h) (:G h) (:T h)])) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,11 @@ | ||
(ns rosalind.core) | ||
|
||
(defn foo | ||
"I don't do a whole lot." | ||
[x] | ||
(println x "Hello, World!")) | ||
|
||
(defn -main | ||
"Main entry point" | ||
[] | ||
(foo "oh bother...")) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,9 @@ | ||
(ns rosalind.basics-test | ||
(:use clojure.test | ||
rosalind.basics)) | ||
|
||
(deftest a-test | ||
(testing "DNA counting stuff" | ||
(is (= | ||
[20 12 17 21] | ||
(dna-count "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"))))) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,7 @@ | ||
(ns rosalind.core-test | ||
(:use clojure.test | ||
rosalind.core)) | ||
|
||
(deftest a-test | ||
(testing "FIXME, I fail." | ||
(is (= 0 0)))) |