Installation error

[linki11]

Hi~~

I was trying to install args_asp package using conda.
But something wrong, error came out and couldn't install successfully.
error message is listed below:
"Retrieving notices: ...working... done
WARNING conda.core.prefix_data:_load_single_record(225): Ignoring malformed prefix record at: /Users/xxxxx/miniconda3/conda-meta/osx-64_blast-2.12.0-h0370960_3.json
Channels:

• bioconda
• blast
• conda
• defaults
• conda-forge
  Platform: osx-arm64
  Collecting package metadata (repodata.json): done
  Solving environment: failed

LibMambaUnsatisfiableError: Encountered problems while solving:

• nothing provides blast >=2.12 needed by args_oap-3.2-pyhdfd78af_0

Could not solve for environment specs
The following package could not be installed
└─ args_oap is not installable because it requires
└─ blast >=2.12 , which does not exist (perhaps a missing channel)."

Do you have any suggestions to me?
Thank you so much.

[xinehc]

I guess blast is not available in the osx-arm64 channel.

you may need to change the default channel from osx-arm64 to osx-64, see: https://stackoverflow.com/questions/70205633/cannot-install-python-3-7-on-osx-arm64

[linki11]

Thank you for your prompt response. I followed the instruction and create a now environment. It seem okay.
But When I ran your demo example data, it stopped at building database. I have capture the log and environment information for your reference. where is the problem? Thank you so much for helping me.
![Screenshot 2023-12-15 at 6 55 51 PM](https://github.co

m/xinehc/args_oap/assets/89136993/541a801c-a0c6-4cc7-9af9-07809159aebb)

[xinehc]

ATM I would suggest to use the command-line version as the desktop version is still under development & testing.

You can get it done by:

wget https://dl.dropboxusercontent.com/s/pqgftlo24rfc2rd/example.tar.gz
tar -xvf example.tar.gz
cd example

conda create -n args_oap -c bioconda -c conda-forge args_oap
conda activate args_oap

args_oap stage_one -i input -o output -f fa -t 8
args_oap stage_two -i output -t 8

[linki11]

Yes, it works in command-line.

[linki11]

I have another question. Can I use assembly data with args_oap? I tried using two sets of data: one was clean data with two reads (forward and reverse), and the other was data obtained after assembly. However, I noticed that the results were different. The former showed an critical message saying 'No target sequence detected in file. no further normalization will be made', while the latter was able to identify target genes and generate normalized gene types.

[xinehc]

no, args_oap currently does not support contigs. You may consider using blastx/diamond.

[linki11]

Hi~
I have another question. I am running a pipeline using a FASTQ file as input, and I was able to successfully match the rno ARGs in the end. However, I just realized that the format of my data is different from what you described. Here is an example of my data format:
@read1
ACTGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Should I remove the quality information in Line 4 before running the pipeline?

[xinehc]

fastq is ok, you can use it as input

[linki11]

I am wondering why I am not getting any matches for the type of antibiotic resistance. Should I consider changing the "thread" level from 8 to another value? The bioinformatics company analyzed the same data but using a different pipeline, and they were able to obtain the desired result. Do you have any suggestions?"

[linki11]

btw, thank you for your quick response.

[xinehc]

Your reads are too short to pass the predefined filter in stage_two (25aa).

[linki11]

how can I adjust criteria?

[xinehc]

You may consider adjust the following parameters when running stage_two:

  --e FLOAT             E-value cutoff for target sequences. [1e-7]
  --id FLOAT            Identity cutoff (in percentage) for target sequences. [80]
  --qcov FLOAT          Query cover cutoff (in percentage) for target sequences. [75]
  --length INT          Aligned length cutoff (in amino acid) for target sequences. [25]

[linki11]

thank you for your kind assistance.
I tried and the result was same.
I used --e 0.0000001 --id 60 --length 20. It did not work in my case.
" No target sequence detected in file extracted.fa"
Have any other possible solution?

[linki11]

More information for you
" args_oap stage_two -i /Users/lxxxx/Desktop/args_oap/output.dry -t 8 --e 0.0000001 --id 60 --length 20 --qcov 70
[2024-01-10 15:09:33] WARNING: Output folder </Users/xxxx/Desktop/args_oap/output.dry> contains <blastout.txt> and/or <.filtered.>, they/it will be overwritten.
[2024-01-10 15:09:33] INFO: Processing </Users/xxxx/Desktop/args_oap/output.dry/extracted.fa> ...
[2024-01-10 15:09:34] INFO: Extracting target sequences using BLAST ...
[2024-01-10 15:09:34] INFO: BLAST settings: 350660991 bps, 2351229 reads, 8 threads, mt_mode 1.
[2024-01-10 17:21:31] INFO: Merging files ...
[2024-01-10 17:21:31] CRITICAL: No target sequence detected in file </Users/xxxxx/Desktop/args_oap/output.dry/extracted.fa>, no further normalization will be made."

[xinehc]

It means no ARG-like sequences being detected, which is possible.