Skip to content

Commit

Permalink
replaced asserts with nose.tools
Browse files Browse the repository at this point in the history
  • Loading branch information
Adam R. Rivers committed Dec 14, 2017
1 parent 012a8d1 commit 8a347a6
Show file tree
Hide file tree
Showing 4 changed files with 21 additions and 18 deletions.
4 changes: 3 additions & 1 deletion README.rst
View file
Expand Up @@ -10,7 +10,9 @@ Vica: Identify highly divergent RNA and RNA viruses in metagenomic and metatrans
.. image:: https://readthedocs.org/projects/vica/badge/?version=latest
:target: http://vica.readthedocs.io/en/latest/?badge=latest
:alt: Documentation Status

.. image:: https://api.codacy.com/project/badge/Grade/f39e8359ea334739842bba35e596cfdc
:target: https://www.codacy.com/app/arivers/vica?utm_source=github.com&utm_medium=referral&utm_content=USDA-ARS-GBRU/vica&utm_campaign=Badge_Grade

:Authors: Adam R. Rivers, US Department of Agriculture, Agricultural Research Service

Qingpeng Zhang, US Department of Energy, Joint Genome Institute
Expand Down
9 changes: 5 additions & 4 deletions tests/test_khmer_features.py
View file
Expand Up @@ -3,6 +3,7 @@
import os
import filecmp
import shutil
from nose.tools import ok_ , eq_

kmer_list = ['AAAA', 'AAAC', 'AAAT', 'AAAG', 'AACA', 'AACC', 'AACT', 'AACG',
'AATA', 'AATC', 'AATT', 'AATG', 'AAGA', 'AAGC', 'AAGT', 'AAGG', 'ACAA',
Expand All @@ -28,8 +29,8 @@ def almost_equal(value_1, value_2, accuracy = 10**-8):
def test_iterate_kmer():
expected = kmer_list
results = vica.khmer_features.iterate_kmer(4)
assert results == expected, "The fuction itrate Khmer did not return the \
expected codon table for k=4"
eq_(results, expected, msg="The fuction itrate Khmer did not return the \
expected codon table for k=4")

def test_get_composition():
seq='GTGAAACATTCGGATTTCGATATTGTCGTGATCGGGGCCGGACATGCCGGCGCCGAGGCTGCACATGCTGCGGCACGCATGGGAATGCGTACTGCCTTGGTTTCCCTGTCCGAACGCGACATTGGCGTGATGTCCTGTAA'
Expand All @@ -42,7 +43,7 @@ def test_get_composition():
1, 0, 1, 0, 2, 1, 1, 1, 3, 1]

r1 = vica.khmer_features.get_composition(ksize=4, seq=seq, kmers=kmer_list, norm=False)
assert r1 == expected1, "The un-normalized composition did not match it's expected result"
eq_(r1,expected1, msg="The un-normalized composition did not match it's expected result")

expected2 = [0, 0.014598540145985401, 0.0072992700729927005, 0, 0.0072992700729927005, 0.0072992700729927005, 0, 0.0072992700729927005, 0.0072992700729927005, 0.0072992700729927005, 0, 0.021897810218978103, 0, 0, 0, 0.0072992700729927005, 0.0072992700729927005, 0, 0.0364963503649635, 0.014598540145985401, 0.0072992700729927005, 0, 0, 0, 0, 0, 0.0072992700729927005, 0.0072992700729927005, 0.029197080291970802, 0, 0, 0, 0, 0.0072992700729927005, 0, 0.014598540145985401, 0.0072992700729927005, 0, 0.014598540145985401, 0, 0.014598540145985401, 0.014598540145985401, 0, 0.029197080291970802, 0.0072992700729927005, 0, 0, 0, 0.0072992700729927005, 0.0072992700729927005, 0, 0, 0.0072992700729927005, 0, 0, 0.0072992700729927005, 0.014598540145985401, 0.0072992700729927005, 0, 0, 0.0072992700729927005, 0.0072992700729927005, 0, 0.021897810218978103, 0, 0.0072992700729927005, 0.021897810218978103, 0, 0.014598540145985401, 0.014598540145985401, 0.014598540145985401, 0, 0, 0.0072992700729927005, 0.0072992700729927005, 0.0072992700729927005, 0, 0.0072992700729927005, 0.029197080291970802, 0.0072992700729927005, 0.014598540145985401, 0, 0, 0, 0, 0, 0.0072992700729927005, 0, 0, 0, 0.021897810218978103, 0.021897810218978103, 0.014598540145985401, 0.021897810218978103, 0.021897810218978103, 0.0072992700729927005, 0.0072992700729927005, 0, 0.021897810218978103, 0.0364963503649635, 0, 0, 0.0072992700729927005, 0, 0, 0.0072992700729927005, 0, 0, 0, 0.021897810218978103, 0, 0.014598540145985401, 0, 0.0072992700729927005, 0.0072992700729927005, 0, 0.0072992700729927005, 0.0072992700729927005, 0.014598540145985401, 0.021897810218978103, 0, 0, 0.0072992700729927005, 0.021897810218978103, 0.0364963503649635, 0.0072992700729927005, 0.0072992700729927005, 0, 0.0072992700729927005, 0, 0.014598540145985401, 0.0072992700729927005, 0.0072992700729927005, 0.0072992700729927005, 0.021897810218978103, 0.0072992700729927005]

Expand All @@ -56,5 +57,5 @@ def test_write_kmers_as_csv():
dtemp = tempfile.mkdtemp()
outfile = os.path.join(dtemp,"outfile.csv")
vica.khmer_features.write_kmers_as_csv(infile=infile, outfile=outfile, ksize=4, kmers=kmer_list)
assert filecmp.cmp(outfile, expected)
ok_(filecmp.cmp(outfile, expected))
shutil.rmtree(dtemp)
25 changes: 13 additions & 12 deletions tests/test_prodigal.py
View file
Expand Up @@ -8,6 +8,7 @@
import yaml
from Bio import SeqIO


import vica

with open(vica.CONFIG_PATH) as cf:
Expand All @@ -34,15 +35,15 @@ def test_call_genes():
outfile1 = os.path.join(td,"genes.fasta")
vica.prodigal._call_genes(infile="tests/test-data/2testseqs.fasta",
outfile=outfile1)
assert filecmp.cmp("tests/test-data/calledgenes.fasta", outfile1, shallow=False)
nose.tools.ok_(filecmp.cmp("tests/test-data/calledgenes.fasta", outfile1, shallow=False))
shutil.rmtree(td)

def test_gene_to_codon():
genestring = 'ATCGATCGCATCGACTAGCCACGTACGACGACTGACGTCG'
genedict = ['ATC', 'GAT', 'CGC', 'ATC', 'GAC', 'TAG', 'CCA', 'CGT', 'ACG',
'ACG', 'ACT', 'GAC', 'GTC']
result = vica.prodigal._gene_to_codon(genestring)
assert result == genedict
nose.tools.eq_(result, genedict)

def test_codon_to_dict():
genestring = 'ATCGATCGCATCGACTAGCCACGTACGACGACTGACGTCG'
Expand All @@ -52,15 +53,15 @@ def test_codon_to_dict():
r0 = vica.prodigal._codon_to_dict(genestring, 0)
r1 = vica.prodigal._codon_to_dict(genestring, 1)
r2 = vica.prodigal._codon_to_dict(genestring, 2)
assert r0 == d0
assert r1 == d1
assert r2 == d2, "%s did not mactch expected value of %s" % (r2, d2)
nose.tools.eq_(r0, d0)
nose.tools.eq_(r1, d1)
nose.tools.eq_(r2, d2, msg="{} did not mactch expected value of {}".format(r2, d2))


def _parse_prodigal_id_from_biopython():
stripped_id = '>NC_000'
result = vica.prodigal._parse_prodigal_id_from_biopython('>NC_000_001')
assert result == stripped_id
nose.tools.eq_(result, stripped_id)

def almost_equal(value_1, value_2, accuracy = 10**-8):
'''a Function to compare tuples of float values'''
Expand All @@ -71,14 +72,14 @@ def test_count_dict_to_clr_array():
'CGC': 1, 'CCA': 1, 'TAG': 1}
expected = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.81225239635623547, 0.0, 0.0, 0.0, 0.0, 0.81225239635623547, 0.0, 0.0, 0.0, 0.81225239635623547, 0.0, 0.81225239635623547, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.81225239635623547, 0.0, 0.0, 1.6245047927124709, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.6245047927124709, 0.0, 0.0, 0.0, 0.0, 0.81225239635623547, 0.0, 0.81225239635623547, 0.0, 1.6245047927124709, 0.0, 0.0, 0.0, 0.0, 0.0]
result = vica.prodigal.count_dict_to_clr_array(d0, codon_list)
assert all(almost_equal(*values) for values in zip(expected, result))
nose.tools.ok_(all(almost_equal(*values) for values in zip(expected, result)))

def test_count_dict_to_ilr_array():
d0 = {'CGT': 1, 'GAT': 1, 'ATC': 2, 'ACT': 1, 'ACG': 2, 'GAC': 2, 'GTC': 1,
'CGC': 1, 'CCA': 1, 'TAG': 1}
expected = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -0.78471036590622656, 0.052430666733412762, 0.049250035659379708, 0.046433378917902231, 0.043921579351258642, -0.75001803758170915, 0.079267717285667116, 0.075578802966779754, 0.072218046827921739, -0.72600691487382352, 0.099480195671282773, -0.70090152321249855, 0.12262596457641053, 0.11816533618132451, 0.11401788429298802, 0.11015174113954165, 0.10653922134156935, 0.10315615749345099, 0.09998135851902494, -0.70322219713140899, 0.11773010326165942, 0.11441309478231763, -1.4911237639366819, 0.15163392649017504, 0.14769470968813433, 0.14395499611465096, 0.14040000307035622, 0.13701637323833493, 0.13379200691796261, 0.13071591741042154, 0.12777810591205632, -1.4817806559659221, 0.15721923036048868, 0.15390898109601467, 0.15073525918484715, 0.14768978849961878, -0.65948476591381477, 0.15772634569942362, -0.64983138856456379, 0.16701245952274074, -1.4457210713825195, 0.19026503939080927, 0.18689725044635552, 0.1836466155121933, 0.18050712578909411, 0.17747317650455946]
result = vica.prodigal.count_dict_to_ilr_array(d0, codon_list)
assert all(almost_equal(*values) for values in zip(expected, result))
nose.tools.ok_(all(almost_equal(*values) for values in zip(expected, result)))

def test_dsum():
d0 = {'CGT': 1, 'GAT': 1, 'ATC': 2, 'ACT': 1, 'ACG': 2, 'GAC': 2, 'GTC': 1,
Expand All @@ -89,7 +90,7 @@ def test_dsum():
'CGA': 2, 'TCG': 3, 'GCA': 1, 'CGC': 1, 'ATC': 3, 'GAT': 1,
'GTC': 1, 'CAC': 1, 'ACG': 3, 'GAC': 2, 'CTG': 1}
result = vica.prodigal.dsum(d0, d1)
assert result == expected
nose.tools.eq_(result, expected)

def test_count_codon_in_gene():
testfasta = 'tests/test-data/2testseqs.fasta'
Expand Down Expand Up @@ -135,7 +136,7 @@ def test_count_codon_in_gene():
records = SeqIO.parse(testfasta, 'fasta')
record = next(records)
result = vica.prodigal.count_codon_in_gene(record)
assert result == expected
nose.tools.eq_(result, expected)

def test_count_codons():
dt = tempfile.mkdtemp()
Expand All @@ -147,7 +148,7 @@ def test_count_codons():
with open(outfile, 'w') as csvfile:
csv_writer_instance = csv.writer(csvfile, lineterminator='\n')
vica.prodigal.count_codons(seqio_iterator= seqs, csv_writer_instance=csv_writer_instance, codon_list=codon_list)
assert filecmp.cmp(expected, outfile, shallow=False)
nose.tools.ok_(filecmp.cmp(expected, outfile, shallow=False))
shutil.rmtree(dt)


Expand All @@ -157,5 +158,5 @@ def test_contigs_to_feature_file():
outfile = os.path.join(dt, "codons.csv")
expected = 'tests/test-data/codons.csv'
vica.prodigal.contigs_to_feature_file(infile=infile, outfile=outfile, dtemp=dt, codon_list=codon_list)
assert filecmp.cmp(expected, outfile, shallow=False)
nose.tools.ok_(filecmp.cmp(expected, outfile, shallow=False))
shutil.rmtree(dt)
1 change: 0 additions & 1 deletion vica/vica_cli.py
View file
Expand Up @@ -204,7 +204,6 @@ def main():

try:
with open(args.config) as cf:
global config
config = yaml.save_load(cf)
except:
print("Could not parse the configuration file.")
Expand Down

0 comments on commit 8a347a6

Please sign in to comment.