1. Installation
2. Overview
3. Examples
4. References
5. Roadmap

Installation

pip install crossy

Overview

The goal of crossy is to provide RNA stability tools for researchers and scientists in a well-tested Python package which is easy to install and use.

The name crossy is a reference to RNA secondary structure which sometimes forms a "cross" shape.

## Examples

Create mRNA object and calculate stability.

from crossy import MRNA
from crossy.analyze import monte_carlo_strategy, apply_substitutions

# Generate MRNA object
mrna = MRNA.from_sequence("CCTACAGCAACTTTAGATGTTACTGAAGTC")
stability = mrna.total_stability  # 0.466...

Get and apply substitutions to target a 0.5 increase in stability.

# Get and apply substitutions
substitutions = monte_carlo_strategy(mrna.get_candidate_substitutions(), 0.5)
new_mrna = apply_substitutions(mrna, substitutions)

new_mrna.total_stability  # 0.964 ~ 0.466 + 0.5

## References

The mRNA stability calculation is primarily based on work in Saccharomyces cerevisiae from Coller lab from 2015: Codon Optimality Is a Major Determinant of mRNA Stability

The work showed a quantitative relationship between codon prevalance and mRNA half life in living cells.

## Roadmap

• Recent reviews discuss the relationship between codon prevalence and mRNA stability, translation rate, and correct folding: link.

  • The relationship between these effects and tRNA prevalance (tRNA Adaptive Index, TAI), which is known for several species, is discussed.

• Predictive RNA secondary structure models are now (being developed)[http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi].

• RNA stability in storage is the subject of a recent (Kaggle competition)[https://www.kaggle.com/c/stanford-covid-vaccine/data].