Permalink
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
54 lines (40 sloc) 2.49 KB

The CAMI Assembly Output Format

1. Outline

CAMI stands for Critical Assessment of Metagenome Interpretation. The CAMI assembly format is a FASTA-formatted contig and scaffold file.

2. The header section

The header section of the FASTA files must follow the standard FASTA guidelines and must start with ">" character followed by any alphanumeric "[A-Za-z]", whitespace (spaces and tabs), brackets "[]", underscores "_", colons "[:;]", commas ",", periods ".", pipes "|", or hypens "-" ending with a newline character.

Contigs and scaffolds should be written to output files contigs.fna and scaffolds.fna, respectively.

Examples:
>gi|5524211|gb|AAD44166.1| cytochrome b [Elephas maximus maximus]
ATCTG
>scaffold-1
ATCTG
>Contig 2, Node 1
ATCTG

3. The sequence section

Sequences must contain only capitalized nucleotide characters, including the ambiguous character 'N': /[ATCGN]+/.

There is no requirement on the number of nucleotides per line, but community best practices advises limiting the amount of nucleotides to 120 characters.

4. Contigs vs. scaffolds

Contigs must not contain any stretches of greater than 5 ambiguous bases (Ns) in a row. Contigs must be split by the user at these points into smaller contigs. There are no restrictions on the amount of contiguous ambiguous bases in scaffolds.

Contigs should be provided in a file called: contigs.fna

Scaffolds should be provided in a file called: scaffolds.fna

5. Examples

>NODE_1331_length_1852_cov_20.7969_ID_2661
CTATTTTTAAATATCCGCGTACTTACTGAGTTATCGTGGCAGTTTTTGCTAATTTTGCGATTTTTGCCACGATAACTTGT
TAAAAAATATGACGTCTGCAATTCTTGTTGCTTTTACACTACAAAAAAGATAAAATATTAGTATGAAAGCAACAGAAGTG
AGGCTATTATGTCAAACAAAGAGATGCTCCTTGACTATTTAGATAACCATCATGGAATAATTACATACAAAGATTGTAAA
ACATTAAATATTCCAACTATATATTTAACTCGTTTGAAAAACGAAGGTGTTCTTAATCGAATTGAAAGGGGAATTTTTCT
CTCTTCCAATGGTGATTATGACGAATATTACTTCTTTCAATATCGTTATCCACAAGCTGTATTCTCTTATGTTTCAGCTC
TTTATCTTCAAGGTTTTACAGATGAAATTCCACAACATTTTGAAGTAAGCGTTCCTAGAGGATATCGTTTTAATAATCCA
CCATCAAATTTAACTATTCATTGGGTCTCAAAATTGTATAGCAAATTAGGCATTACTACAACGATTACCACAATGGGGAA
TAAAGTACGTATTTATGATTTTGAACGCATTATTTGTGATTTTATAATAAACAGAAACAGTATTGATTCTGAACTCTTTG
TTAAAACTCTTCAAGCTTACAGTAGGTATAACGGGAAAGATCTTATAAAGC
>54257
AAAATAGACGCACAAGCTGGCACATCACAACGAATAACCAAGCATAGAAATGAAGAAAAAGAAAATAATCATGGGAGTAG
GAACAGGAATCCTTTTGGCTGCTGTTGCTTTTTGGGGGTGGCATTCCACACAAGCAACTTCGACAGAAATAACAAATGAA
ATGGAAAGCGCCATGCACAACGAGCCTGTTGGTCCTGCTTTTGAAGCCGATTCTGCGTACCGTTATATTGAAGCACAATG
TAGTTTCGGCCCTCGCACCATGAACAGCGAAGCACACGAACAATGTGCGGAGTGGATTAT