-
phased multiple alleles calling for long sequencing reads, e.g. PacBio HiFi
-
call variants of STR/SSR, SNP, InDel at the same time
-
run faster with parallel computing
Macrohaplotype caller for STR, SNP, and InDel from NGS long-read sequencing data, especially for PacBio HiFi reads The MacroHapCaller calls targeted STRs/SSRs, SNPs, and InDels sites simultaneously in a row from each single NGS read and clusters the variants into phased haplotype strings. MacroHapCaller is the best tool to analyze all haplotypic variants from genetically inherited DNA. It suits diploid, polyploid, and complex DNA mixtures from many individuals, e.g. DNA forensics. MacroHapCaller is programmed in Java with parallel computing enabled so it can run on any computing platform.
The MacroHapCaller is also integrated into a pipeline with a shell script or Python3. The pipeline takes the BAM or fastq reads as input, align reads to the genome, sort, and index alignment, and then user can use the output to run MacroHapCaller. Additional tools are also available as util tools. For util usage : java -jar appName.jar where appName should be replaced with a detailed tool name.
MacroHapCaller runs fast. It takes ~ 2 mins for merged data from four full runs of PacBio SMRTcell HiFi reads on a Linux machine with 12 threads, and a maximum allowed 120G RAM.
V0.3
For help:
java -jar MacroHapCaller##.jar
where ## is the version number, e.g.: 0.3.
usage: java -jar -Xmx100G MacroHapCaller0.3.jar [options]
-a,--strAnchorFile configure file of anchors for STRs in tabular plain text
-c,--MinReadCount integer, minimum read count to report a macrohaplotype, default [2]
-d,--inDelBedFile configure file of InDels in BED format in tabular plain text
-i,--input input BAM file with a path
-l,--homopolymerLen integer, homopolymer length threshold to skip call variant,default [4]
-m,--MaxMismatches integer, maximum distance of edit distance in anchor match, default [1]
-n,--snpPanelPosFile configure file of SNPs in tabular plain text
-o,--output output file name for macrohaplotype result
-p,--MinReadProportion double, minimum read proportion of all reads for each locus to report a macrohaplotype, default [0.001]
-q,--LowQualThreshold integer, phred-scale quality threshold for variant bases, default [15]
-r,--refGenomeFastaFile Genome reference sequence file in .fasta format
-t,--ThreadNumber integer, the number of computing threads, default [12]
java -jar -Xmx120G MacroHapCaller0.3.jar -i /mnt/data0/xuewen/macrohaplotype/hg002/Q40hifi/hg002.8kampl.Q40.fastq.gz_GRCh38.bam -o hg002.8kampl.Q40_GRCh38.tsv -a /mnt/data0/xuewen/macrohaplotype/scripts/MHvar_v0.3/CODISSTR_anchor.XW.config_v0.2.txt -d /mnt/data0/xuewen/macrohaplotype/scripts/MHvar_v0.3/MHindels_v0.2.bed -n /mnt/data0/xuewen/macrohaplotype/scripts/MHvar_v0.3/MHsnps.pos.txt -r /mnt/data0/xuewen/hg38giab/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta -l 2 -m 1 -q 15 -c 100 -p 0.01 -t 12
This pipeline will preprocess the originall PacBio HiFi reads in BAM to fastq, read quality control, umi-analysis (optional), statistical summary, read-reference alignment, sort, and index. The major results are a read-reference alignment in the BAM format and BAM index, as well as statistical report files.
MH_umi_dedup_map_pipe.sh
-
a read-reference alignment file in BAM format. This alignment file could be generated from
MH_umi_dedup_map_pipe.shor user-generated alignment file in .Bam format -
Configure files of targeted variant positional information for each of STRs, SNPs, and InDels
The configure file listed the STR loci information in a tabular separated text file. An example file for forensic CODIS STR of human genome is given in "CODISSTR_anchor.XW.config_v0.2.txt" Each line for one STR locus. There is one fixed headline before starting the detailed STR locus. Every line has 11 columns. The integer value for the last column is the estimated maximum length of TR, where 500 is enough for most cases. The coordinate starts from 1.
Chrom ChromStartPos_Str ChromEndPos_Str Name Repeat_unit_length Motif_must_present Inner_offset Anchor_left Anchor_right LeftAnchorStartPos RightAnchorEndPos MaxRefLength
chr1 230765214 230765259 D1S1656@STR_118267 2 CACACA 0 CAGAAAATGAGAACACATG GGTTATGCCAAAAGGGC 230765190 230765281 500
chr1 230769616 230769683 D1S1656 4 TCTATCTATCTA 0 TCAGAGAAATAGAATCACTA TGAGCAACACAGGCTTGAAC 230769556 230769721 500
chr2 1489653 1489684 TPOX 4 AATGAATG 0 CAGAACAGGCACTTAGGGAA AACGCTGACAAGGACAGAAG 1489624 1489716 500
The config file for InDel is in a BED format tabular separated plain text file, which coordinates start from 0. The REF and ALT are the bases for InDel in the reference genome and variant. An example file is given for 8-kb fragments containing human CODIS STR. For Details, please read our paper. There is one fixed headline and 5 columns in each line. Then each subsequent line is for one InDel site. If multiple InDel for the same coordinate, list one of them is enough.
Chrom ChromStart ChromEnd REF ALT
chr1 230764747 230764748 GA G
chr1 230764749 230764750 T TC
chr2 1485704 1485705 C CT
chr2 1486795 1486803 TAGTGGGG T
chr2 1487522 1487526 CAGG C
chr2 1489924 1489975 GCACACAGGAGGAGTCACGACAGAGCAGTGTAAGAGCCGCCACGTGGGTCC G
The config file for SNP is in a tabular separated plain text file, which coordinates start from 1. There is one fixed headline and 5 columns in each line. Then each subsequent line is for one SNP site. An example file is given for 8-kb fragments containing 20 human CODIS STRs. the "ID" column is the name of a DNA fragment, which uses the same name as one of the STR in this 8-kb fragment as STR configure. All SNPs with the same "ID" will be put together with STR alleles in the same fragment once the ID of STR is shared between SNP and STR configure file.
#CHROM POS ID REF ALT
chr1 230765010 D1S1656 A G
chr1 230765280 D1S1656 G A
chr1 230765336 D1S1656 C T
chr1 230765352 D1S1656 G C
Macrohaplotypes and supported read count in tabular text file .tsv. E.g., the two macrohaplotypes around FBI's CODIS loci D2S441 in 8 kb PacBio HiFi reads of benchmark reference hg002. Locus details are at FBI
The first line shows the total reads for this locus D2441. The position lines present the coordinate of each targeted variant site on chr2 in the human genome Hg38. Then the macrohaplotypes, including three parts of SNPs, InDels and STRs separated by ";".
#Total hapVar: D2S441 27694
#Markername Counts HapVarLen hapVar(s)
# Position:68011922,68011990,68012066,68012109,68012198,68012335,68012415,68012463,68012596,68012616,68012754,68012776,68012877,68012888,68013086,68013124,68013388,68013405,68013406,68013664,68013692,68013770,68013988,68014065,68014213,68014245,68014581,68014700,68015087,68015100,68015130,68015131,68015330,68015388,68015498,68015787,68015976,68016033,68016045,68016108,68016576,68016583,68017126,68017147,68017242,68017364,68017504,68017573,68017732,68017739,68018169,68018176,68018322,68018330,68012435,68012478,68012608,68012694,68012722,68012762,68012781,68011917
D2S441 8646 136
G,A,A,A,G,C,T,A,T,C,C,T,G,T,T,G,C,C,G,C,A,A,G,T,A,T,A,G,A,A,C,G,T,G,C,G,G,G,T,C,C,G,C,G,G,A,A,C,C,C,T,A,A,G;TA,CACATATATA,CA,CA,CACATATATA,CATATATA,ATGT;TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA
D2S441 7467 152
G,A,A,A,G,C,T,A,T,T,C,T,A,T,C,G,C,C,T,C,A,G,G,T,G,T,A,G,A,A,C,G,C,G,C,G,G,G,T,C,C,G,C,G,A,A,A,C,C,C,T,G,A,G;TAC,C,CA,CA,CACATATATA,CATATAT,T;TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATCTATCTA
The macrohaplotypes can be visualized or edited in a text processor, Microsoft excels, and spreadsheett.
The graphically view and compare the macrohaplotypes, please use our graphic tool: USAT
This work was supported in part by award 15PNIJ-21-GG-04159-RESS, awarded by the National Institute of Justice, Office of Justice Programs, U.S. Department of Justice.
coming soon