add functionality to digest all assemblies in build with bespoke REs

basicsynbio/__init__.py

@@ -25,6 +25,7 @@
     BasicBuild,
     BuildDecoder,
     BuildEncoder,
+    build_digest,
     new_part_resuspension,
     export_echo_assembly,
     pdf_instructions,

basicsynbio/cam/__init__.py

@@ -1,4 +1,9 @@
+from .csv_export import export_csvs
 from .echo_instructions import export_echo_assembly
 from .pdf_instructions import pdf_instructions
-from .csv_export import export_csvs
 from .main import *
+from .misc_funs import (
+    build_digest,
+    new_part_resuspension,
+    seqrecord_hexdigest,
+)

basicsynbio/cam/main.py

@@ -1,48 +1,19 @@
-"""Module contains a collection of objects for computer assisted manufacturing
-within the BASIC DNA assembly framework."""
+"""Module contains key objects for computer assisted manufacturing (CAM)
+within the BASIC DNA assembly framework.
+"""
 
-from Bio.SeqUtils import molecular_weight
 from Bio.Seq import Seq
-from Bio.SeqRecord import SeqRecord
 from basicsynbio.main import (
     BasicAssembly,
     BasicLinker,
     BasicPart,
     BasicUTRRBSLinker,
-    ClipReaction,
     LinkerException,
 )
-import csv
-from dataclasses import dataclass
-from datetime import datetime
 from collections import OrderedDict, Counter
-import hashlib
 import json
-import os
-from pathlib import Path
-from typing import Union, Dict, Generator
+from typing import Dict, Generator
 import re
-import zipfile
-
-
-def new_part_resuspension(
-    part: BasicPart, mass: float, double_stranded: bool = True
-) -> float:
-    """Returns the volume of resuspension buffer (µL) required for a 75 nM
-    solution of part, equivalent to 75 fmol/µL.
-
-    Args:
-        part: BasicPart object.
-        mass: mass of synthesised part (ng).
-        double_stranded (optional): True (default) indicates part is dsDNA.
-    """
-    return (
-        (mass * 10 ** -9)
-        / molecular_weight(part.seq, double_stranded=double_stranded)
-        * 1
-        / (75e-9)
-        * 10 ** 6
-    )
 
 
 class BasicBuild:
@@ -448,27 +419,3 @@ def return_unique_linkers(dictionary):
 
 class BuildException(Exception):
     pass
-
-
-def seqrecord_hexdigest(seqrecord_obj: Union[SeqRecord, BasicPart, BasicLinker]) -> str:
-    """Returns an MD5 hash of a Bio.SeqRecord.SeqRecord-like object, using
-    relevant attributes.
-
-    Note:
-        Care should be taken when using the return value of this function as an identifier/hash for seqrecord_obj given these objects are mutable.
-
-    Args:
-        seqrecord_obj: Bio.SeqRecord.SeqRecord-like object, containing relevant
-            attributes
-
-    Returns:
-        MD5 hash
-    """
-    seqrec_hash = hashlib.md5(str(seqrecord_obj.seq).encode("UTF-8"))
-    bytes_objs = [
-        getattr(seqrecord_obj, attribute).encode("UTF-8")
-        for attribute in ["name", "description"]
-    ]
-    for element in bytes_objs:
-        seqrec_hash.update(element)
-    return seqrec_hash.hexdigest()

basicsynbio/cam/misc_funs.py

@@ -0,0 +1,95 @@
+"""Module contains several small functions that support or utilise key cam
+objects but each is not critical to the bsb workflow.
+"""
+
+
+from Bio.Restriction import BsaI
+from Bio.SeqUtils import molecular_weight
+from Bio.SeqRecord import SeqRecord
+from Bio.Seq import Seq
+from basicsynbio.main import BasicAssembly, BasicPart, BasicLinker
+from .main import BasicBuild
+from dataclasses import dataclass
+import hashlib
+from typing import Generator, Tuple, Union
+
+
+@dataclass
+class AssemblyDigest:
+    """class to return data calculated by `build_digest` function."""
+
+    assembly: BasicAssembly
+    restriction_enzyme: str
+    sequences: Tuple[Seq, ...]
+    product_lengths: Tuple[int, ...]
+
+
+def seqrecord_hexdigest(seqrecord_obj: Union[SeqRecord, BasicPart, BasicLinker]) -> str:
+    """Returns an MD5 hash of a Bio.SeqRecord.SeqRecord-like object, using
+    relevant attributes.
+
+    Note:
+        Care should be taken when using the return value of this function as an identifier/hash for seqrecord_obj given these objects are mutable.
+
+    Args:
+        seqrecord_obj: Bio.SeqRecord.SeqRecord-like object, containing relevant
+            attributes
+
+    Returns:
+        MD5 hash
+    """
+    seqrec_hash = hashlib.md5(str(seqrecord_obj.seq).encode("UTF-8"))
+    bytes_objs = [
+        getattr(seqrecord_obj, attribute).encode("UTF-8")
+        for attribute in ["name", "description"]
+    ]
+    for element in bytes_objs:
+        seqrec_hash.update(element)
+    return seqrec_hash.hexdigest()
+
+
+def new_part_resuspension(
+    part: BasicPart, mass: float, double_stranded: bool = True
+) -> float:
+    """Returns the volume of resuspension buffer (µL) required for a 75 nM
+    solution of part, equivalent to 75 fmol/µL.
+
+    Args:
+        part: BasicPart object.
+        mass: mass of synthesised part (ng).
+        double_stranded (optional): True (default) indicates part is dsDNA.
+    """
+    return (
+        (mass * 10 ** -9)
+        / molecular_weight(part.seq, double_stranded=double_stranded)
+        * 1
+        / (75e-9)
+        * 10 ** 6
+    )
+
+
+def build_digest(
+    build: BasicBuild,
+    restriction_enzyme: None = BsaI,
+) -> Generator[AssemblyDigest, None, None]:
+    """Conduct a diagnostic digest on basic_assemblies in build.
+
+    Function uses a single Bio.Restriction enzyme to digest all BasicAssembly objects
+    in build. The resulting AssemblyDigest dataclass contains data on sequences and
+    product lengths generated from digest.
+
+    Args:
+        build: BasicBuild object.
+        restriction_enzyme: A single restriction enzyme from Bio.Restriction
+
+    """
+    for assembly in build.basic_assemblies:
+        assembly_digest = restriction_enzyme.catalyse(
+            assembly.return_part().seq, linear=False
+        )
+        yield AssemblyDigest(
+            assembly,
+            restriction_enzyme.__name__,
+            assembly_digest,
+            tuple(len(seq) for seq in assembly_digest),
+        )

tests/test_cam.py

@@ -142,3 +142,16 @@ def test_decoded_build(promoter_assemblies_build, promoter_assemblies_json):
         )
         == True
     )
+
+
+def test_build_digest(promoter_assemblies_build):
+    build_digest = tuple(bsb.build_digest(promoter_assemblies_build))
+    assert len(build_digest) == len(promoter_assemblies_build.basic_assemblies)
+    for assembly_digest in build_digest:
+        assert len(assembly_digest.sequences) == 2
+    promoter_assemblies_returned_parts = (
+        assembly.return_part()
+        for assembly in promoter_assemblies_build.basic_assemblies
+    )
+    for ind, part in enumerate(promoter_assemblies_returned_parts):
+        assert len(part.basic_slice()) + 6 in build_digest[ind].product_lengths

tests/test_fixtures.py

@@ -235,7 +235,7 @@ def all_promoter_assemblies_build():
 @pytest.fixture
 def bb_linker():
     from Bio.Seq import Seq
-    from basicsynbio.cam.main import seqrecord_hexdigest
+    from basicsynbio.cam import seqrecord_hexdigest
 
     bb_linker = bsb.BasicLinker(
         seq=Seq("GGCTCGGCCCACTTGTGTGTCTCGTACAATTCTGAGGTCCACACAGATAGTGTCC"),