File path

[jeffapderek]

Hi,
Stumbling on the walk through here: after copying new parameters to file program doesn't recognise the file path for Step 3.
Have re-started terminal, restarted machine and checked all file paths within the Parameters file.
Any ideas please?

(base) jeff@UBU-CND7483XVZ:$ cd ./Walk_Through_RPA_Primers/
(base) jeff@UBU-CND7483XVZ:/Walk_Through_RPA_Primers$ ls -l
total 1704
-rw-r--r-- 1 jeff jeff 7478 May 15 2015 GCF_000896435.1_ViralProj76727_genomic.fna
-rw-r--r-- 1 jeff jeff 94163 May 19 12:06 HPV_Run_1_Alignment_Summary.csv
-rw-r--r-- 1 jeff jeff 237945 May 19 12:06 HPV_Run_1_Output_Sets.csv
-rw-r--r-- 1 jeff jeff 1393632 May 19 12:06 HPV_Run_1_PrimedRPA_Oligo_Binding_Sites.csv
-rw-r--r-- 1 jeff jeff 2378 May 19 12:16 PrimedRPA_Parameters.txt
(base) jeff@UBU-CND7483XVZ:~/Walk_Through_RPA_Primers$ PrimedRPA PrimedRPA_Parameters.txt

---

----------------PrimedRPA------------------
-----Finding RPA Primer and Probe Sets-----
-------------Higgins M et al.--------------

Parameters File Could Not Be Opened
Check File Path.
PLease run PrimedRPA --help to see valid options

[MatthewHiggins2017]

Hi Jeff,

First could you please double check the PrimedRPA_Parameters.txt file contains all 22, greater than symbols '>' as if there are more or less, this could trigger the error. This could be done with the following command: grep '>' PrimedRPA_Parameters.txt | wc -l

Alternatively, if this doesnt work, could you please try the command-line option by running the following command:

PrimedRPA --RunID Debug --InputFile GCF_000896435.1_ViralProj76727_genomic.fna

[MatthewHiggins2017]

Hi Jeff,

Did this solution work?

Kind regards,
Matt.

[jeffapderek]

Hi Matt, thanks for the suggestion. Haven't had a chance today sorry. Will let you know asap Many Thanks,Jeff Sent from Outlook Mobile<https://aka.ms/blhgte>

…

________________________________ From: Matt Higgins <notifications@github.com> Sent: Friday, May 22, 2020 3:46:52 PM To: MatthewHiggins2017/bioconda-PrimedRPA <bioconda-PrimedRPA@noreply.github.com> Cc: Jeff Davey <jefwithonef@hotmail.com>; Author <author@noreply.github.com> Subject: Re: [MatthewHiggins2017/bioconda-PrimedRPA] File path (#1) Hi Jeff, Did this solution work? Kind regards, Matt. — You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub<#1 (comment)>, or unsubscribe<https://github.com/notifications/unsubscribe-auth/AKJNC3TDYNRAO6I4SK2OE73RS2F5ZANCNFSM4NE5JPXA>.

[jeffapderek]

Hi Matt, yeah, that seems to have worked thanks:
22 '>'s and your files produced three debug_...csv files, with less oligo binding sites than the first.

Now for step 3 and it's produced a folder with blast inputs and outputs, but come up with an error message saying it can't find the
ileNotFoundError: [Errno 2] No such file or directory: 'Adv_TAAGACCGCCTTCGGTCTATAAATTCACAGAG_AF082339.1.fa'

Any suggestions?
Many Thanks, Jeff

[jeffapderek]

Hi Matt,

Got round to having a go with my own data today. Fine when I'm just producing primers, probes and self-annealing scores, but getting an error when I attempat a cross-reactivity file. Have checked file paths, formatting trimmed sequences to equal length. Seems to be an error with the Blast search of the non-target sequences. Any suggestions please?
Error message when running from scratch i.e. without providing a previously generated alignment File/Binding sites:

Generating Alignment Summary (fine!)
Generating Primer/Probe Binding Site DataFrame
multiprocessing.pool.RemoteTraceback:
"""
Traceback (most recent call last):
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 47, in starmapstar
return list(itertools.starmap(args[0], args[1]))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 541, in IndentifyingAndFilteringOligos
MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 195, in BlastnBackgroundCheck
fastadict = FastaToDict('Adv_{}_{}.fa'.format(seq,CleanRefID))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 32, in FastaToDict
with open(InputFile) as file_one:
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
File "/home/jeff/miniconda3/bin/PrimedRPA", line 1034, in
CheckingAlignedOutputFile(AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 810, in CheckingAlignedOutputFile
PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 276, in starmap
return self._map_async(func, iterable, starmapstar, chunksize).get()
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'

--
Much appreciated, Jeff

[MatthewHiggins2017]

Hi Jeff,

Apologies for the delay in my response and can you please check the version of samtools have installed with bioconda is v1.9 or higher

[jeffapderek]

Many thanks Matt. Did that via
conda update samtools
and it's upgraded from v1.3.1 to 1.9, but still the same error message.

Let me know if you'd like me to run anything and let you know the error output

Jeff

[jeffapderek]

Hi Matt,

Have you had a chance to take a look at this please?

Cheers, Jeff

[vinay7623]

Had a similar problem installed samtools and updated it and the program works