-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
0 parents
commit 5c8b1d5
Showing
100 changed files
with
19,679 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
Readme HPup |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,40 @@ | ||
; the central environment config file will be used as default | ||
; for the pipeline runner (Pied Piper), so think twice before | ||
; blindly changing entries | ||
|
||
[Assemblies] | ||
prefix=/TL/deep-share/nobackup/deep_svn/Deep/pipelines/trunk/configs/assemblies | ||
; please make sure to include only compatible reference files/values in the | ||
; respective INI files - think about "chr" vs "non-chr" assemblies! | ||
hg19= ${prefix}/hg19.ini | ||
hs37d5= ${prefix}/hs37d5.ini | ||
grcm38= ${prefix}/grcm38.ini | ||
|
||
[RegExps] | ||
prefix= /TL/deep-share/nobackup/deep_svn/Deep/pipelines/trunk/configs/regexps | ||
deep_generic= ${prefix}/deep_generic_re.ini | ||
|
||
[Misc] | ||
prefix= /TL/deep-share/nobackup/deep_svn/Deep/pipelines/trunk/configs/misc | ||
color_codes= ${prefix}/color_codes.ini | ||
|
||
[LibPython3] | ||
pottyplotty= /home/pebert/work/code/sandbox/tools/trunk | ||
statelabeller= /home/pebert/work/code/sandbox/tools/trunk | ||
|
||
[LibPython2] | ||
deeptools= /TL/deep-share/archive00/software/packages/deeptools/v1.5.9.1/install/lib/python2.7/site-packages | ||
macs2= /TL/deep-share/archive00/software/packages/macs2/MACS/install/lib/python2.7/site-packages | ||
bxpython= /TL/deep-share/archive00/software/packages/bxpython/v20140415/install/lib/python2.7/site-packages | ||
cutadapt= /TL/deep-share/archive00/software/lib/python2.7/site-packages | ||
ld_library_path= /usr/local/lib | ||
|
||
[BinPaths] | ||
common= /bin:/usr/bin:/usr/local/bin:/TL/deep-share/archive00/software/bin | ||
cluster= | ||
#cluster= #/TL/deep-share/archive00/software/bin | ||
petools= /home/pebert/work/code/sandbox/tools/trunk | ||
|
||
[Software] | ||
trim_galore= /TL/deep-share/archive00/software/bin/trim_galore | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,35 @@ | ||
[Analysis] | ||
#things to adjust for each run | ||
sampleid= SAMPLEID | ||
mainFolder= /current/Folder/ | ||
input= ${mainFolder}/data/${sampleid} | ||
output= ${mainFolder}/out/${sampleid}/${date} | ||
date= DATE | ||
fastqid=@HISEQ | ||
|
||
#reference genome | ||
#genome_reference_gem= /projects/student/Andreas/reference/Mus_musculus.GRCm38.dna.chromosome.1.gem | ||
genome_reference_gem= /DEEP_fhgfs/data/external/references/DEEP/genomes/mouse/Methylation/indices/gem/GRCm38mm10_PhiX_Lambda.gem | ||
|
||
#mostly fixed parameters | ||
#/DEEP_fhgfs/projects/karln/hpseq/150929/pipelines | ||
installFolder= /DEEP_fhgfs/projects/karln/hpseq/pipeline/local_pipelines | ||
name= ${sampleid}.${date} | ||
dir_work_root= ${output}/wd | ||
dir_work_temp=${dir_work_root}/tmp | ||
dir_work_log=${dir_work_root}/log | ||
|
||
#hairpin linker information | ||
linker= GGGTTT[AGT][AGT][AGT]T[AGT][AGT][AGT]AGGTTT | ||
linkerGrep= GGG[CT]{2}T...T...AGG[CT]{3} | ||
linkerSed= GGG\(..\)T\(...\)T\(...\)AGG\(...\) | ||
#size of added wildcard nucleatides(N) to prepare spike-in sequences | ||
padSize=100 | ||
#spikein sequences | ||
spikein_seq= /DEEP_fhgfs/projects/karln/hpseq/pipeline/data/Spikes.ref.upper.fa | ||
q1hmc_upp= TACGATCACGGCGAATCCGATCGAATCACAGTGGCGCTTTACGAAGTGCGACAGCCTTAG | ||
q3hmc_upp= TACGATCACGGCGAATCCGATCGAATCCTTGTAGCGCTTTACGAAGTGCGACAGCCTTAG | ||
q6hmc_upp= TACGATCACGGCGAATCCGATCGAATCAGTCAAGCGCTTTACGAAGTGCGACAGCCTTAG | ||
qfc_upp= TACGATCACGGCGAATCCGATCGAATCGTTTCGGCGCTTTACGAAGTGCGACAGCCTTAG | ||
qmc_upp= TACGATCACGGCGAATCCGATCGAATCTAGCTTGCGCTTTACGAAGTGCGACAGCCTTAG | ||
sqc_upp= TACGATCACGGCGAATCCGATCGAATCCAGATCGCGCTTTACGAAGTGCGACAGCCTTAG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,89 @@ | ||
[Process] | ||
process= hpSeqV1 | ||
fastqPattern= *q.gz | ||
|
||
[hpSeqV1] | ||
# count reads from fasta files | ||
countReads= bash ${System:installFolder}/wrappers/hpSeq/countReads.sh -n {description} -i {{inputfile}} -o {{outputfile}} | ||
|
||
# count reads from BAM files | ||
countBAMReads= bash ${System:installFolder}/wrappers/hpSeq/countBAMReads.sh -n {description} -i {{inputfile}} -o {{outputfile}} | ||
|
||
# count reads from output file | ||
countOUTReads= bash ${System:installFolder}/wrappers/hpSeq/countOUTReads.sh -n {description} -i {{inputfile}} -o {{outputfile}} | ||
|
||
#merge reads | ||
mergeReads= cat {inputfile} > {outputfile} | ||
|
||
#defining the process | ||
joinReads= bash ${System:installFolder}/wrappers/hpSeq/preProcess.sh -L "${Analysis:linker}" -a {inputfile[0]} -b {inputfile[1]} -x {outputfile[0]} -y {outputfile[1]} | ||
|
||
#clean up step of raw files | ||
cleanup= > {outputfile[0]} | ||
|
||
#replace= ${Commands:java8} -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpReplaceSeq {inputfile} > {outputfile} | ||
|
||
linkanalyze=${Commands:java8} -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpSeqBamAnalyze {inputfile[0]} {inputfile[1]} | sort -k1,1 -k2,2n > {outputfile[0]} | ||
|
||
mergelink= bash ${System:installFolder}/wrappers/hpSeq/mergeLink.sh -i {inputfile} -o {outputfile} | ||
|
||
#${syncReads_boolean} | ||
#joinReads= bash preProcess.sh -L "${Analysis:linker}" -a {inputfile[0]} -b {inputfile[1]} -x {outputfile[0]} -y {outputfile[1]} | ||
syncReads_boolean=false | ||
syncReads_maxShift=12 | ||
syncReads_minLength=16 | ||
syncReads_maxError=7 | ||
syncReads= ${Commands:java8} -Xmx32G -jar ${System:jarFolder}/fastqUtils.jar hpSeqSync ${syncReads_boolean} ${syncReads_maxShift} ${syncReads_minLength} ${syncReads_maxError} {inputfile[0]} {inputfile[1]} | ||
|
||
#syncReads= hpSync.sh -Xmx4G ${System:jarFolder}/fastqUtils.jar hpSeqSync ${syncReads_maxShift} ${syncReads_minLength} ${syncReads_maxError} {inputfile[0]} {inputfile[1]} | ||
|
||
#map R1 synchronized fastq files with reference library to output bam files | ||
mapReads= ${Commands:mapWithGem} -a {inputfile} -o {outputfile} -r ${Analysis:genome_reference_gem} | ||
|
||
#map wobble position with mapped reads | ||
wobblemapRead= bash ${System:installFolder}/wrappers/hpSeq/wobblemapRead.sh -i {inputfile[0]} -j {inputfile[1]} -o {outputfile[0]} | ||
|
||
#replace sequence with sequence including methylation information (problems with bam format) | ||
replace= bash ${System:installFolder}/wrappers/hpSeq/replaceSeqmarkDup.sh -i {inputfile[0]} -j {inputfile[1]} -o {outputfile[0]} | ||
|
||
#analyze statistics of duplicats | ||
markduplicates= bash ${System:installFolder}/wrappers/hpSeq/markduplicates.sh -i {inputfile} -o {outputfile} | ||
|
||
|
||
#mapReads= mapWithGem.sh -a {inputfile} -o {outputfile} -r ${Analysis:genome_reference_gem} | ||
|
||
pileup= ${Commands:java8} -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpSeqPileup {inputfile} | sort -k1,1 -k2,2n > {outputfile} | ||
|
||
pileup2= ${Commands:java8} -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpSeqPileup2 {inputfile} | sort -k1,1 -k2,2n > {outputfile} | ||
|
||
#pileup= pileup.sh -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpSeqPileup {inputfile[1]} {inputfile[0]} > {outputfile} | ||
|
||
# the mergeCall command is cheating... but it will have to do for now | ||
mergeCall= sort -m -k1,1 -k2,2n {inputfolder}/seq_????_pileup.txt |mawk -f ${System:installFolder}/wrappers/hpSeq/mergeCall.awk | ${Commands:java8} -cp .:${System:jarFolder}/htsjdk-1.130.jar:${System:jarFolder}/bamUtils.jar tools.bam.bamUtils hpSeqPileupCall - |${Commands:bgzip} -c > {{outputfile}} | ||
|
||
#call tabix for igv browser | ||
tabixCall= ${Commands:tabix} -s1 -b2 -e2 -f {inputfile} > {outputfile} | ||
|
||
|
||
# generate file with sequence identifier and sequence of wobble position | ||
# calculate the bisulfite conversion rate of the hairpin linker | ||
|
||
conversionHAIRPIN= bash ${System:installFolder}/wrappers/hpSeq/conversionHAIRPIN.sh -i {inputfile[0]} -y {outputfile[0]} -x {outputfile[1]} -c ${Analysis:output}/config.ini -I ${Analysis:installFolder} | ||
|
||
# generate wobble position | ||
|
||
wobbleHAIRPIN=bash ${System:installFolder}/wrappers/hpSeq/wobbleHairpin.sh -i {inputfile} -o {outputfile} | ||
|
||
#pad spikes | ||
padReferenceSpikes_paddingSize=100 | ||
padReferenceSpikes= ${Commands:java8} -jar ${System:jarFolder}/fastaUtils.jar pad {inputfile} ${padReferenceSpikes_paddingSize} > {outputfile} | ||
|
||
createReferenceSpikes= ${Commands:gmap_build} -D {spikeReferenceFolder} -d repeats {{inputfile}} && ${Commands:cmetindex} -F {spikeReferenceFolder} -d repeats &> {{outputfile}} | ||
|
||
filterSpikes= ${Commands:gsnap} --nthreads=8 --npaths=1 --db=repeats --dir={spikeReferenceFolder} --sam-use-0M --format=sam --gunzip --mode=cmet-stranded {{inputfile}} |${Commands:samtools} view -u -F 260 - | ${Commands:samtools} sort -T - > {{outputfile}} | ||
|
||
forwardmergeSpikes= ${Commands:samtools} merge -u - {{inputfile}}| ${Commands:samtools} view -F16 -u - | ${Commands:samtools} mpileup -f {paddedReference} - > {{outputfile}} | ||
|
||
reversemergeSpikes= ${Commands:samtools} merge -u - {{inputfile}}| ${Commands:samtools} view -f16 -u - | ${Commands:samtools} mpileup -f {paddedReference} - > {{outputfile}} | ||
|
||
finalSpikes= bash ${System:installFolder}/wrappers/hpSeq/finalSpikes.sh -a {inputfile[0]} -b {inputfile[1]} -o {outputfile[0]} -c ${Analysis:output}/config.ini -I ${Analysis:installFolder} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,87 @@ | ||
[System] | ||
installFolder= ${Analysis:installFolder} | ||
jarFolder= ${Analysis:installFolder}/java/jar | ||
tmpdir=/tmp | ||
annotation= ${Analysis:installFolder}/annotation.bed | ||
|
||
[DeeptoolsJobSingle] | ||
jobname= ruffus | ||
workdir= ${Analysis:dir_work_root} | ||
outpath= ${Analysis:dir_work_log} | ||
errpath= ${Analysis:dir_work_log} | ||
#native_spec= -l h=deep0[23456789]*|deep1[0123456]* | ||
#native_spec= -l mem_free=16G,h_vmem=16G,slots_free=1,h=deep0[23456789]*|deep1[0123456]* | ||
native_spec= -l mem_free=66G,h_vmem=66G,slots_free=1,h=deep0[23456789]*|deep1[0123456]* | ||
scriptdir= ${Analysis:dir_work_log} | ||
keepscripts= 1 | ||
|
||
[DeeptoolsJobDouble] | ||
jobname= ruffusDouble | ||
workdir= ${Analysis:dir_work_root} | ||
outpath= ${Analysis:dir_work_log} | ||
errpath= ${Analysis:dir_work_log} | ||
#native_spec= -l h=deep0[23456789]*|deep1[0123456]* | ||
native_spec= -l mem_free=15G,h_vmem=15G,slots_free=2,h=deep0[23456789]*|deep1[0123456]* | ||
scriptdir= ${Analysis:dir_work_log} | ||
keepscripts= 1 | ||
|
||
[DeeptoolsJobQuarter] | ||
jobname= ruffusQuarter | ||
workdir= ${Analysis:dir_work_root} | ||
outpath= ${Analysis:dir_work_log} | ||
errpath= ${Analysis:dir_work_log} | ||
#native_spec= -l h=deep0[23456789]*|deep1[0123456]* | ||
native_spec= -l mem_free=31G,h_vmem=31G,slots_free=4,h=deep0[23456789]*|deep1[0123456]* | ||
scriptdir= ${Analysis:dir_work_log} | ||
keepscripts= 1 | ||
|
||
[DeeptoolsJobHalf] | ||
jobname= ruffus | ||
workdir= ${Analysis:dir_work_root} | ||
outpath= ${Analysis:dir_work_log} | ||
errpath= ${Analysis:dir_work_log} | ||
#native_spec= -l h=deep0[23456789]*|deep1[0123456]* | ||
native_spec= -l mem_free=62G,h_vmem=62G,slots_free=8,h=deep0[23456789]*|deep1[0123456]* | ||
scriptdir= ${Analysis:dir_work_log} | ||
keepscripts= 1 | ||
|
||
[DeeptoolsJobFull] | ||
jobname= ruffus | ||
workdir= ${Analysis:dir_work_root} | ||
outpath= ${Analysis:dir_work_log} | ||
errpath= ${Analysis:dir_work_log} | ||
#native_spec= -l h=deep0[23456789]*|deep1[0123456]* | ||
native_spec= -l mem_free=124G,h_vmem=124G,slots_free=16,h=deep0[23456789]*|deep1[0123456]* | ||
scriptdir= ${Analysis:dir_work_log} | ||
keepscripts= 1 | ||
|
||
[EnvConfig] | ||
path= ${BinPaths:cluster}:${BinPaths:common} | ||
|
||
[EnvPy2Config] | ||
path= ${BinPaths:cluster}:${BinPaths:common} | ||
pythonpath= ${LibPython2:deeptools}:${LibPython2:macs2}:${LibPython2:bxpython}:${LibPython2:cutadapt}:${System:installFolder} | ||
ld_library_path= ${LibPython2:ld_library_path} | ||
#path= /local/projects/pipelines/wd/bin:/usr/lib64/qt-3.3/bin:/usr/local/bin:/usr/bin:/bin:/usr/local/sbin:/usr/sbin:/home/karln/.local/bin:/home/karln/bin | ||
#pythonpath= . | ||
|
||
|
||
[EnvPy3Config] | ||
path= ${BinPaths:cluster}:${BinPaths:petools}:${BinPaths:common} | ||
pythonpath= ${LibPython3:pottyplotty} | ||
|
||
|
||
[Commands] | ||
#trimGalorePaired= ${Software:trim_galore} --suppress_warn -q 20 --phred33 -o {outputFolder} --no_report_file --paired {{inputfile[0]}} {{inputfile[1]}} | ||
trimGalorePaired= ${Software:trim_galore} --suppress_warn -q 20 --phred33 -o {outputFolder} --no_report_file --paired {{inputfile[0]}} {{inputfile[1]}} 2> /dev/null | ||
mapWithGem= bash ${System:installFolder}/wrappers/mappers/mapWithGEM.sh | ||
java6= /usr/lib/jvm/java-6-openjdk-amd64/bin/java | ||
java8= /usr/lib/jvm/java-8-oracle/jre/bin/java | ||
python3= /usr/bin/python3 | ||
gsnap= /TL/deep-share/archive00/software/bin/gsnap | ||
bgzip= /TL/deep-share/archive00/software/bin/bgzip | ||
tabix= /TL/deep-share/archive00/software/bin/tabix | ||
samtools= /TL/deep-share/archive00/software/bin/samtools | ||
picardjar= ${System:jarFolder}/picard.jar | ||
cmetindex= /TL/deep-share/archive00/software/bin/cmetindex | ||
gmap_build= /TL/deep-share/archive00/software/bin/gmap_build |
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
Manifest-Version: 1.0 | ||
Created-By: 1.7.0_99 (Oracle Corporation) | ||
Main-Class: tools.bam.bamUtils | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
Manifest-Version: 1.0 | ||
Created-By: 1.7.0_99 (Oracle Corporation) | ||
Main-Class: tools.fastq.fastqUtils | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,22 @@ | ||
<?xml version="1.0" encoding="UTF-8" standalone="no"?> | ||
<jardesc> | ||
<jar path="/home/karln/jars/bamUtils.jar"/> | ||
<options buildIfNeeded="true" compress="true" descriptionLocation="/tools/src/tools/bam/bamUtilToJar.jardesc" exportErrors="true" exportWarnings="true" includeDirectoryEntries="false" overwrite="false" saveDescription="true" storeRefactorings="false" useSourceFolders="false"/> | ||
<storedRefactorings deprecationInfo="true" structuralOnly="false"/> | ||
<selectedProjects/> | ||
<manifest generateManifest="true" mainClassHandleIdentifier="=tools/src<tools.bam{bamUtils.java[bamUtils" manifestLocation="" manifestVersion="1.0" reuseManifest="false" saveManifest="false" usesManifest="true"> | ||
<sealing sealJar="false"> | ||
<packagesToSeal/> | ||
<packagesToUnSeal/> | ||
</sealing> | ||
</manifest> | ||
<selectedElements exportClassFiles="true" exportJavaFiles="false" exportOutputFolder="false"> | ||
<javaElement handleIdentifier="=tools/src<tools.fastq{FastqSeq.java"/> | ||
<javaElement handleIdentifier="=tools/src<tools.utils{general.java"/> | ||
<javaElement handleIdentifier="=tools/src<tools.bam"/> | ||
<javaElement handleIdentifier="=tools/src<tools.fastq{fastqParser.java"/> | ||
<javaElement handleIdentifier="=tools/src<tools.sequences"/> | ||
<javaElement handleIdentifier="=tools/src<tools.fasta{FastaSeq.java"/> | ||
<javaElement handleIdentifier="=tools/src<tools.fasta{fastaParser.java"/> | ||
</selectedElements> | ||
</jardesc> |
Oops, something went wrong.