Skip to content

Commit

Permalink
added mcirosplit
Browse files Browse the repository at this point in the history
  • Loading branch information
@dbrg77
dbrg77 committed Feb 25, 2024
1 parent c4e931a commit 8af0930
Show file tree
Hide file tree
Showing 3 changed files with 150 additions and 6 deletions.
Binary file added data/aba5257_table_s3.xlsx
View file
Binary file not shown.
2 changes: 1 addition & 1 deletion methods_html/SMART-seq_family.html
View file
Original file line number Diff line number Diff line change
Expand Up @@ -3,7 +3,7 @@

<head>
<link rel="stylesheet" type="text/css" href="../style_related/page_format.css">
<title>SMART-seq/SMART-seq2/SMART-seq3</title>
<title>SMART-seq/SMART-seq2/SMART-seq3/SMART-seq3xpress/FLASH-seq</title>
</head>
<body>

Expand Down
154 changes: 149 additions & 5 deletions methods_html/SPLiT-seq.html
View file
Original file line number Diff line number Diff line change
Expand Up @@ -3,18 +3,22 @@

<head>
<link rel="stylesheet" type="text/css" href="../style_related/page_format.css">
<title>SPLiT-seq</title>
<title>SPLiT-seq/microSPLiT</title>
</head>
<body>

<h1><a href="https://www.science.org/doi/10.1126/science.aam8999" target="_blank">SPLiT-seq</a></h1>
<h1><a href="#SPLiT-seq" target="_self">SPLiT-seq</a> / <a href="#microSPLiT" target="_self">microSPLiT</a></h1>

<span style="font-size:1.1em;"><p>The SPLiT-seq uses the combinatorial indexing to identify single cells without single cell isolation. Multi-level indexing can be performed by ligations. The workflow described here is based on the publication of <a href="https://www.science.org/doi/10.1126/science.aam8999" target="_blank">Science 360, 176-182 (2018)</a>. To be consistent with the publication, all the oligo/primer names are the same as the Science 2018 publication. All oligos can be found in the <a href="../data/aam8999_tables12.xlsx">Supplementary Table S12</a> from the publication. <b>NOTE:</b> The published version in this page is different from the preprint version in the bioRxiv. I have archived the previous Github Page about SPLiT-seq, which was based on the preprint version. If you want to have a look, you can check by <a href="https://teichlab.github.io/scg_lib_structs/methods_html/SPLiT-seq_archive.html">clicking here</a>.
<span style="font-size:1.1em;"><p>The <b>SPLiT-seq</b> uses the combinatorial indexing to identify single cells without single cell isolation. Multi-level indexing can be performed by ligations. The workflow described here is based on the publication of <a href="https://www.science.org/doi/10.1126/science.aam8999" target="_blank">Science 360, 176-182 (2018)</a>. To be consistent with the publication, all the oligo/primer names are the same as the Science 2018 publication. All oligos can be found in the <a href="../data/aam8999_tables12.xlsx">Supplementary Table S12</a> from the publication. <b>NOTE:</b> The published version in this page is different from the preprint version in the bioRxiv. I have archived the previous Github Page about SPLiT-seq, which was based on the preprint version. If you want to have a look, you can check by <a href="https://teichlab.github.io/scg_lib_structs/methods_html/SPLiT-seq_archive.html">clicking here</a>.

<span style="font-size:1.1em;"><p>Be careful that there are different versions of the protocol, and they use slightly different oligo sequences. The basic idea of the method does not change. Check <a href="https://github.com/Teichlab/scg_lib_structs/issues/13" target="_blank">this thread</a> for more information.</p></span>

<span style="font-size:1.1em;"><p><b>microSPLiT</b> was based on <b>SPLiT-seq</b>, and it was developed from the same lab that developed SPLiT-seq. <b>microSPLiT</b> was further optimised to work on sequencing mRNA from bacteria. The oligo sequences used in <b>microSPLiT</b> is almost the same as those in <b>SPLiT-seq</b>, except that the Round2 linker region is shorter. Therefore, the final library of <b>microSPLiT</b> is extremely similar to the original <b>SPLiT-seq</b>. The procedures described here is based on the Science paper and the oligo sequences are taken from their <a href="../data/aba5257_table_s3.xlsx", target="_blank">Supplementary Table S3</a>.</p></span>

<br></br>

<h1><a href="https://www.science.org/doi/10.1126/science.aam8999" target="_blank" name="SPLiT-seq"><span style="color:red">SPLiT-seq</span></a></h1>

<h2>Adapter and primer sequences:</h2>
<seq>
<p>Oligo-dTVN (Round1_01-48): 5'-/5Phos/ <r1>AGGCCAGAGCATTCG</r1><cbc>[8-bp Round1 barcode]</cbc>TTTTTTTTTTTTTTTVN -3'</p>
Expand All @@ -37,7 +41,6 @@ <h2>Adapter and primer sequences:</h2>
<p>Read 2 sequencing primer: 5'- <t7>GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</t7> -3'</p>
</seq>


<br></br>

<h2>Step-by-step library generation</h2>
Expand Down Expand Up @@ -169,7 +172,7 @@ <h3>(10) Final library structure:</h3>
<align class="long">
5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>TAGATCGC<s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me>XXX...XXX(pA)<cbc>NNNNNNNN</cbc><r1>CGAATGCTCTGGCCT</r1><r2>CTCAAGCACGTGGAT</r2><cbc>NNNNNNNN</cbc><r3>AGTCGTACGCCGATGCGAAACATCGGCCAC</r3><cbc>NNNNNNNN</cbc><umi>NNNNNNNNNN</umi><t7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</t7>NNNNNN<p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3'
3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5>ATCTAGCG<s5>AGCAGCCGTCGCAG</s5><me>TCTACACATATTCTCTGTC</me>XXX...XXX(dT)<cbc>NNNNNNNN</cbc><r1>GCTTACGAGACCGGA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>NNNNNNNN</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>NNNNNNNN</cbc><umi>NNNNNNNNNN</umi><t7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</t7>NNNNNN<p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5'
<p5>Illumina P5</p5> <s5>s5</s5> <me>ME</me> cDNA <cbc>8 bp</cbc> <r2>Round2 linker</r2> <cbc>8 bp</cbc> <r3>Round3 linker</r3> <cbc>8 bp</cbc> <umi>10 bp</umi> <t7>Illumina Truseq</t7> 6bp i7 <p7>Illumina P7</p7>
<p5>Illumina P5</p5> <s5>s5</s5> <me>ME</me> cDNA <cbc>8 bp</cbc> <r2>Round2 linker</r2> <cbc>8 bp</cbc> <r3>Round3 linker</r3> <cbc>8 bp</cbc> <umi>10 bp</umi> <t7>TruSeq Read 2</t7> 6bp i7 <p7>Illumina P7</p7>
<cbc>Round1</cbc> <cbc>Round2</cbc> <cbc>Round3</cbc> <umi>UMI</umi>
<cbc>Barcode</cbc> <cbc>Barcode</cbc> <cbc>Barcode</cbc>
</align>
Expand Down Expand Up @@ -205,5 +208,146 @@ <h3>(3) Cluster regeneration, add Read 2 sequencing primer to sequence the secon

<br></br>

<h1><a href="https://www.science.org/doi/10.1126/science.aba5257" target="_blank" name="microSPLiT"><span style="color:red">microSPLiT</span></a></h1>

<h2>Adapter and primer sequences:</h2>
<seq>
<p>Oligo-dTVN (Round1_01-48): 5'-/5Phos/ <r1>ACTGTGG</r1><cbc>[8-bp Round1 barcode]</cbc>TTTTTTTTTTTTTTTVN -3'</p>
<p>Oligo-randN (Round1_49-96): 5'-/5Phos/ <r1>ACTGTGG</r1><cbc>[8-bp Round1 barcode]</cbc>NNNNNN -3'</p>
<p>Round2 Ligation Barcodes (Round2_01-96): 5'-/5Phos/ <r3>CATCGGCGTACGACT</r3><cbc>[8-bp Round2 barcode]</cbc><r2>ATCCACGTGCTTGAG</r2> -3'</p>
<p>Round2 Barcode Linker (BC_0335): 5'- <r1>CCACAGT</r1><r2>CTCAAGCACG</r2> -3'</p>
<p>Round3 Ligation Barcodes (Round3_01-96): 5'-/5Biosg/ <t7>CAGACGTGTGCTCTTCCGATCT</t7><umi>[10-bp UMI]</umi><cbc>[8-bp Round3 barcode]</cbc><r3>GTGGCCGATGTTTCG</r3> -3'</p>
<p>Round3 Barcode Linker (BC_0284): 5'- <r3>TACGCCGATGCGAAACATCG</r3> -3'</p>
<p>Round2 blocking strand (BC_0340): 5'- CGTGCTTGAGACTGTGG -3'</p>
<p>Round3 blocking strand (BC_0066): 5'- GTGGCCGATGTTTCGCATCGGCGTACGACT -3'</p>
<p>Template Switching Oligos (TSO, BC_0127): 5'- <tso>AAGCAGTGGTATCAACGCAGAGT</tso>GAATrGrG+G -3'</p>
<p>cDNA Amplification Primer 1 (BC_0062): 5'- <t7>CAGACGTGTGCTCTTCCGATCT</t7> -3'</p>
<p>cDNA Amplification Primer 2 (BC_0108): 5'- <tso>AAGCAGTGGTATCAACGCAGAGT</tso> -3'</p>
<p>Nextera N/S5xx primer entry point (s5): 5'- <s5>TCGTCGGCAGCGTC</s5> -3'</p>
<p>Nextera N7xx primer entry point (s7): 5'- <s7>GTCTCGTGGGCTCGG</s7> -3'</p>
<p>Indexed Library PCR Primer 1 (BC_0076 - BC_0083) : 5'- <p7>CAAGCAGAAGACGGCATACGAGAT</p7>[6-bp i7 sample index]<t7>GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</t7> -3'</p>
<p>Library PCR Primer 2 (BC_0118): 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>TAGATCGC<s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me> -3'</p>
<p>Read 1 sequencing primer: 5'- <s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me> -3'</p>
<p>Index 1 sequencing primer: 5'- <t7>GATCGGAAGAGCACACGTCTGAACTCCAGTCAC</t7> -3'</p>
<p>Read 2 sequencing primer: 5'- <t7>GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</t7> -3'</p>
</seq>

<br></br>

<h2>Step-by-step library generation</h2>
<h3>(1) Prepare ligation adapters by annealing barcodes with corresponding linkers:</h3>
<pre>
<seq>
<i>Round2 adapters: anneal Round2 Ligation Barcodes (Round2_01-96) with Round2 Barcode Linker (BC_0335):</i>

5'- <r1>CCACAGT</r1><r2>CTCAAGCACG</r2>
<r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTAC</r3> /5Phos/-5'


<i>Round3 adapters: anneal Round3 Ligation Barcodes (Round3_01-96) with Round3 Barcode Linker (BC_0284):</i>

5'- <r3>TACGCCGATGCGAAACATCG</r3>
<r3>GCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> /5Biosg/-5'


</seq>
</pre>

<h3>(2) In-cell addition of poly-A to mRNA by using <i>E.coli</i> PAP, anneal Oligo-dTVN and Oligo-randN primers to mRNA and reverse transcription using Maxima H Minus Reverse Transcriptase <i>in situ</i> to add Round 1 barcodes:</h3>
<pre>
<seq>
<i>mRNA 3':</i>

5'- XXX...XXXB(A)<sub>n</sub>
<---NV(T)<sub>15</sub><cbc>[8-bp Round 1 barcode]</cbc><r1>GGTGTCA</r1> /5Phos/-5'

<i>mRNA internal (omitted in the rest stages):</i>

5'- XXX...XXX(A)<sub>n</sub>
<-NNNNNN<cbc>[8-bp Round 1 barcode]</cbc><r1>GGTGTCA</r1> /5Phos/-5'
</seq>
</pre>

<h3>(3) Pool and split to the plate containing Round2 adapters to add Round 2 barcodes:</h3>
<pre>
<seq>
5'- XXX...XXXB(pA) <r1>CCACAGT</r1><r2>CTCAAGCACG</r2>
CCCXXX...XXXV(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTAC</r3> /5Phos/-5'
</seq>
</pre>

<h3>(4) Pool and split to the plate containing Round3 adapters to add Round 3 barcodes:</h3>
<pre>
<align class="long">
5'- XXX...XXXB(pA) <r1>CCACAGT</r1><r2>CTCAAGCACG</r2> <r3>TACGCCGATGCGAAACATCG</r3>
CCCXXX...XXXV(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> /5Biosg/-5'
</align>
</pre>

<h3>(5) Pool, count cells, split into sublibraries. Then, for each sublibrary, perform cell lysis, low temperature (55 degree celcius) reverse crosslink and bind cDNA to streptavidin beads</h3>
<pre>
<align class="long">
3'- CCCXXX...XXXV(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> /5Biosg/-5'
</align>
</pre>

<h3>(6) Add TSO (BC_0127) to each sublibrary for second strand synthesis:</h3>
<pre>
<align class="long">
5'- <tso>AAGCAGTGGTATCAACGCAGAGT</tso>GAATGGG---->
<---CCCXXX...XXXV(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> /5Biosg/-5'--|
</align>
</pre>

<h3>(7) Add cDNA Amplification Primers 1 & 2 (BC_0062 and BC_0108) to each sublibrary:</h3>
<pre>
<align class="long">
5'- <tso>AAGCAGTGGTATCAACGCAGAGT</tso>------>
5'- <tso>AAGCAGTGGTATCAACGCAGAGT</tso>GAATGGGXXX...XXXB(pA)<cbc>[8-bp Round1 barcode]</cbc><r1>CCACAGT</r1><r2>CTCAAGCACGTGGAT</r2><cbc>[8-bp Round2 barcode]</cbc><r3>AGTCGTACGCCGATGCGAAACATCGGCCAC</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>AGATCGGAAGAGCACACGTCTG</t7>
<tso>TTCGTCACCATAGTTGCGTCTCA</tso>CTTACCCXXX...XXXV(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> /5Biosg/-5'--|
<------<t7>TCTAGCCTTCTCGTGTGCAGAC</t7> -5'
</align>
</pre>

<h3>(8) Tagmentation with Illumina Nextera XT Kit. This is the same as SPLiT-seq, so un-amplifiable products are omitted here:</h3>
<img src="../data/tn5_dimer.svg" alt="Tn5 dimer" style="width:800px;height:450px;">
<pre>
<align class="long">
<i>Product 5 (s5 at one end, 3' of cDNA at the other end, the only amplifiable fragment, see the next step):</i>

5'- <s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me>XXXXXXXXXXXX...XXX(pA)<cbc>[8-bp Round1 barcode]</cbc><r1>CCACAGT</r1><r2>CTCAAGCACGTGGAT</r2><cbc>[8-bp Round2 barcode]</cbc><r3>AGTCGTACGCCGATGCGAAACATCGGCCAC</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>AGATCGGAAGAGCACACGTCTG</t7> -3'
<me>TCTACACATATTCTCTGTC</me> XXX...XXX(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> -5'


</align>
</pre>

<h3>(9) Add Library PCR Primer 1 (one of BC_0076 - BC_0083) and 2 (BC_0018) to index each sublibrary:</h3>
<pre>
<align class="long">
5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>TAGATCGC<s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me>------->
5'- <s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me>XXXXXXXXXXXX...XXX(pA)<cbc>[8-bp Round1 barcode]</cbc><r1>CCACAGT</r1><r2>CTCAAGCACGTGGAT</r2><cbc>[8-bp Round2 barcode]</cbc><r3>AGTCGTACGCCGATGCGAAACATCGGCCAC</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>AGATCGGAAGAGCACACGTCTG</t7> -3'
<me>TCTACACATATTCTCTGTC</me> XXX...XXX(dT)<cbc>[8-bp Round1 barcode]</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>[8-bp Round2 barcode]</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>[8-bp Round3 barcode]</cbc><umi>[10-bp UMI]</umi><t7>TCTAGCCTTCTCGTGTGCAGAC</t7> -5'
<--------<t7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</t7>[i7]<p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5'
</align>
</pre>

<h3>(10) Final library structure:</h3>
<pre>
<align class="long">
5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>TAGATCGC<s5>TCGTCGGCAGCGTC</s5><me>AGATGTGTATAAGAGACAG</me>XXX...XXX(pA)<cbc>NNNNNNNN</cbc><r1>CCACAGT</r1><r2>CTCAAGCACGTGGAT</r2><cbc>NNNNNNNN</cbc><r3>AGTCGTACGCCGATGCGAAACATCGGCCAC</r3><cbc>NNNNNNNN</cbc><umi>NNNNNNNNNN</umi><t7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</t7>NNNNNN<p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3'
3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5>ATCTAGCG<s5>AGCAGCCGTCGCAG</s5><me>TCTACACATATTCTCTGTC</me>XXX...XXX(dT)<cbc>NNNNNNNN</cbc><r1>GGTGTCA</r1><r2>GAGTTCGTGCACCTA</r2><cbc>NNNNNNNN</cbc><r3>TCAGCATGCGGCTACGCTTTGTAGCCGGTG</r3><cbc>NNNNNNNN</cbc><umi>NNNNNNNNNN</umi><t7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</t7>NNNNNN<p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5'
<p5>Illumina P5</p5> <s5>s5</s5> <me>ME</me> cDNA <cbc>8 bp</cbc> <r2>Round2 linker</r2> <cbc>8 bp</cbc> <r3>Round3 linker</r3> <cbc>8 bp</cbc> <umi>10 bp</umi> <t7>TruSeq Read 2</t7> 6bp i7 <p7>Illumina P7</p7>
<cbc>Round1</cbc> <cbc>Round2</cbc> <cbc>Round3</cbc> <umi>UMI</umi>
<cbc>Barcode</cbc> <cbc>Barcode</cbc> <cbc>Barcode</cbc>
</align>
</pre>

<br></br>

<h2>Library sequencing:</h2>

<h3>The same as SPLiT-seq, omitted here.</h3>

</body>
</html>

0 comments on commit 8af0930

Please sign in to comment.