This repository contains code used to analyze sequencing reads starting from .fastq.gz
files (not contained in this repository owing to size constraints). A link to SRA will be added when these reads are fully deposited and available. Aside from these initial read files, this repository should be sufficient to re-create the entire analysis. As you'll see, the code requires many packages/programs to be installed so be aware of that constraint. It also assumes a certain file structure and after running certain lines below I subsequently cleaned things up and pushed files around so the file paths should not be taken too seriously and rather should be altered accordingly. This is simply a guide to using the programs with the parameters, inputs/outputs that I used to construct a repeatable analysis.
My first step is to simply remove the 3' adapter sequence and filter so that the resulting reads are at least 20nts long (the -m
flag). All of the nohup
terminology that you'll see here and throughout is to just store the run-time output into a file. These output files are the ones that say essentially how many reads the adapter was found in/removed from, which in this case I know is like 99.5% of the reads for each of the different lanes.
nohup cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 20 -o ribo1.trimmed.fastq.gz AM-ribo_S1_L001_R1_001.fastq.gz &> nohup.ribo1.out&
Next I'm demultiplexing each "lane" .fastq.gz
file into the subsequent "samples" based on the barcode sequences.
As before, I also impose a resulting length threshold (here 15 nts) as well as storing the run-time output to keep track of how many of each barcode were found in each lane. When run on each lane this creates a lot of files, 5 for each lane (one for each of the 4 barcodes, and an "unknown" file for any reads without one of the 4 barcodes attached, which I essentially throw away from here on out). The name of the resulting files comes from the id of the barcode contained in the barcodes.fasta
file.
nohup cutadapt -m 15 -a file:../barcodes.fasta -o {name}.ribo1.fastq.gz ribo1.trimmed.fastq.gz &> nohup.demultiplex.ribo1.out&
In this example, since "RIBOTrep1" reads were found in each of the 4 "ribo" lanes, I have 4 fastq.gz
files that I concatenate together into one. And of course repeat this process for all samples
cat RIBOTrep1.ribo1.fastq.gz RIBOTrep1.ribo2.fastq.gz RIBOTrep1.ribo3.fastq.gz RIBOTrep1.ribo4.fastq.gz > RIBOTrep1.ribo.fastq.gz
I don't save any output here which is why you don't see "> blahblah&" at the end of the code line.
nohup cutadapt -u -5 -o RIBOTrep1.ribo.clipped.fastq.gz RIBOTrep1.ribo.fastq.gz &
And make sure resulting reads are at least 10nts long. This step does a little bit, but not much. In practice, part of the adapter is found only in between 1-5% of the reads (compared with >99% for the 3' adapter). But I aligned things multiple times and in different ways throughout the testing process for this pipeline and I found that the percent of reads that can be aligned is slightly higher by performing this step. Which is to say, the 5' adapter isn't actually on many reads, but if it is we might as well remove it and cutadapt seems to do so competently
nohup cutadapt -g XACACTCTTTCCCTACACGACGCTCTTCCGATCT -m 10 -o RIBOTrep1.ribo.clippedV2.fastq.gz RIBOTrep1.ribo.clipped.fastq.gz &> nohup.RIBOTrep1.ribo.5clip.out&
Finally, I remove the first 2 nt's of each read because these may/may not be N's by design of the experiment
No output necessary. Again, I found that removing these actually helps the percentage that ultimately align via HISAT2 even though many reads may not contain the 5' NN sequence that is part of the design.
nohup cutadapt -u 2 -m 10 -o RIBOTrep1.ribo.final.fastq.gz RIBOTrep1.ribo.clippedV2.fastq.gz &
With that, the cutadapt protocol is finally finished.
Note that I move some files around afterwards to put these guys in different folders that should be clear below. But this is the basic syntax of building index files and I built three seperate ones: one to the genome for actual mappings/analysis and two separate rRNA/tRNA type of files to see what fraction of reads mapped to these regions.
$ ~/workspace/hisat2-2.1.0/hisat2-build ../Genome_files/U00096.3.fasta U00096.3.hisat2.index
$ ~/workspace/hisat2-2.1.0/hisat2-build ../Previous_genome_files/U00096_Ribo-T.frn U00096.3.hisat2.RIBOTRNA.index
$ ~/workspace/hisat2-2.1.0/hisat2-build ../Previous_genome_files/U00096.frn U00096.3.hisat2.WTRNA.index
I performed this for all samples using the HISAT2_rRNA_all.sh
script. Here I give brief examples. The relevant flags here are really just saying that I use 8 cores (-p), don't write unaligned reads to a SAM file (--no-unal), do not allow for spliced alignment (ala eukaryotes, --no-spliced-alignment). It's also worth noting that I throw the actual mapping results away since I'm curious how many reads map here but don't find it necessary to store or do anything with these alignments. Back when alignments were slower, or computing resources not available I suppose it was useful to filter reads by first mapping to files like this but I don't see the point owing to the speed of HISAT2 mapping to the entire genome.
nohup ~/workspace/hisat2-2.1.0/hisat2 -x ../Previous_genome_files/HISAT2_indices/U00096.3.hisat2.WTRNA.index -p 8 --no-unal --no-spliced-alignment -U ../FASTQs/FINALS/WTrep1.rna.final.fastq.gz -S ./trash.sam &> ../nohup.WTrep1.rna.hisat2.RNAALIGN.out&
In the case of RIBOT samples, make sure to map to the different RIBOT index that I created above. This is a little nuanced piece of information pertaining to how the RIBOT constructs are designed
nohup ~/workspace/hisat2-2.1.0/hisat2 -x ../Previous_genome_files/HISAT2_indices/U00096.3.hisat2.RIBOTRNA.index -p 8 --no-unal --no-spliced-alignment -U ../FASTQs/FINALS/RIBOTrep1.rna.final.fastq.gz -S ./trash.sam &> ../nohup.RIBOTrep1.rna.hisat2.RNAALIGN.out&
As above this is run for all samples using the HISAT2_all.sh
script but here is an example. Relevant flags/parameters are identical to above. Just note that I care about the SAM file now and thus name it something (-S flag)
nohup ~/workspace/hisat2-2.1.0/hisat2 -x ../Genome_files/HISAT2_indices/U00096.3.hisat2.index -p 8 --no-unal --no-spliced-alignment -U ../FASTQs/FINALS/WTrep1.rna.final.fastq.gz -S ../WTrep1.rna.sam &> ../nohup.WTrep1.rna.hisat2.out&
I have .sam
files of all the reads that mapped. SAM files are enormous and can be condensed a bit so I use samtools
. Specifically, I run the script SAMTOOLS_all.sh
. Here I'll annotate an example:
##This just sets a bash variable to make my life easy
sample_name='WTrep1.rna'
##Here, I create the BAM file from the SAM file
samtools view -bS ../${sample_name}.sam > ../${sample_name}.bam
##Next, I sort the BAM file which I think is usually more useful
samtools sort ../${sample_name}.bam ../${sample_name}.sorted
##Finally I index the BAM file, not sure what exactly these index files are used for but here they are incase they're needed
samtools index ../${sample_name}.sorted.bam ../${sample_name}.sorted.bai
We can use HTSEQ to count reads mapped to each feature, and I experimented with this but ultimately am not using it. There is, however, a script called HTSEQ_all.sh
that can be used to count feature reads if necessary.
Ultimately, .sam
files will/should probably be deleted because they're enormous and unnecessary. But, they're readable and were easier to write this custom python script. I was looking how .wig
files are normally made and it doesn't appear to be standard at all so the script sam_to_wig.py
does the trick for me and I tested it a lot to make sure it does what I want it to. The only really important note with using this script is that I'm only selecting "primary" HISAT2 reads and discarding all information about multi-mapped (secondary) reads. Think this is an okay choice. Up until now, this is the only custom code that I'm using as opposed to off the shelf tools to manipulate the reads
python sam_to_wig.py ../WTrep1.rna.sam
So the entire previous analysis is mostly for dealing with the ribosome profiling data (but in order to do so I also repeated the whole analysis for RNA-seq as well). For significance testing of RNA-seq, however, I will not use the .wig
files or even the .sam
or .bam
files. Rather, for mapping reads I use Kallisto and for significance testing of the output I use Sleuth. Realistically, I didn't even need to do many of the adapter trimming steps to use Kallisto (and I found that more reads could be mapped if I used pre-trimmed reads) but to be straightforward I used the .fastq.gz
files at the very end of the cutadapt pipeline.
First, I needed to get a "transcripts" file to build the Kallisto index file. I do this using:
python genome_to_transcriptome.py
It's worth noting that in place of actual "transcripts", this file contains the sequence of all annotated CDSs from start to stop codons subject to a few minor constraints outlined in the genome_to_transcriptome.py
file.
I experimented with a few different "k" values, but the reads here are pretty short so I opted to go all the way down to 17 because 21 didn't seem to make much of a difference.
kallisto index -i ../Data/Genome_files/KALLISTO_indices/U00096.3.k17.transcripts.index -k 17 ../Data/Genome_files/U00096.3.transcripts.fasta
I just ran all of these at once using the KALLISTO_all.sh
file. Everything should be straightforward in there including the relevant parameters
For this part of the analysis, you'll have to enter the R
world. Specifically, sleuth_analysis.Rmd
. Step through all that code and it should save some files.
Stepping through rna_seq_analysis.ipynb
should be sufficient to read the sleuth outputs and do the final steps of the RNA-seq analysis pipeline.
The final analysis of the ribosome profiling data pipeline uses information stored in the previously generated .wig
files. Of particular note there are 2 main analyses that I am doing here:
-
Differential translation efficiency analysis
Step through the code contained in
ribo_prof_analysis.ipynb
. -
Meta-gene analysis
This is to look at the (potential) pile-up of reads at 5' and 3' ends of annotated genes. Step through the code in
meta_gene_analysis.ipynb