forked from bgruening/docker-galaxy-stable
-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request bgruening#68 from bgruening/Workflow_PAR-CLIP
Workflow par clip
- Loading branch information
Showing
5 changed files
with
1,051 additions
and
783 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
266 changes: 266 additions & 0 deletions
266
rna-workbench-workflow/Galaxy-Workflow-PAR-CLIP_analysis.ga
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,266 @@ | ||
| { | ||
| "a_galaxy_workflow": "true", | ||
| "annotation": "A workflow for analyzing PAR-CLIP data.", | ||
| "format-version": "0.1", | ||
| "name": "PAR-CLIP analysis", | ||
| "steps": { | ||
| "0": { | ||
| "annotation": "It should be in fastqsanger format.", | ||
| "content_id": null, | ||
| "id": 0, | ||
| "input_connections": {}, | ||
| "inputs": [ | ||
| { | ||
| "description": "It should be in fastqsanger format.", | ||
| "name": "PAR-CLIP fastq" | ||
| } | ||
| ], | ||
| "label": null, | ||
| "name": "Input dataset", | ||
| "outputs": [], | ||
| "position": { | ||
| "left": 214, | ||
| "top": 319 | ||
| }, | ||
| "tool_errors": null, | ||
| "tool_id": null, | ||
| "tool_state": "{\"name\": \"PAR-CLIP fastq\"}", | ||
| "tool_version": null, | ||
| "type": "data_input", | ||
| "uuid": "6e949653-700f-436b-90a9-b4bf4ce52d0c", | ||
| "workflow_outputs": [] | ||
| }, | ||
| "1": { | ||
| "annotation": "It should be in fasta format", | ||
| "content_id": null, | ||
| "id": 1, | ||
| "input_connections": {}, | ||
| "inputs": [ | ||
| { | ||
| "description": "It should be in fasta format", | ||
| "name": "Reference sequence" | ||
| } | ||
| ], | ||
| "label": null, | ||
| "name": "Input dataset", | ||
| "outputs": [], | ||
| "position": { | ||
| "left": 712, | ||
| "top": 463 | ||
| }, | ||
| "tool_errors": null, | ||
| "tool_id": null, | ||
| "tool_state": "{\"name\": \"Reference sequence\"}", | ||
| "tool_version": null, | ||
| "type": "data_input", | ||
| "uuid": "ed3f5918-0a38-4b97-8771-cf4856358323", | ||
| "workflow_outputs": [] | ||
| }, | ||
| "2": { | ||
| "annotation": "", | ||
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/trim_galore/trim_galore/0.4.2", | ||
| "id": 2, | ||
| "input_connections": { | ||
| "singlePaired|input_singles": { | ||
| "id": 0, | ||
| "output_name": "output" | ||
| } | ||
| }, | ||
| "inputs": [ | ||
| { | ||
| "description": "runtime parameter for tool Trim Galore!", | ||
| "name": "singlePaired" | ||
| } | ||
| ], | ||
| "label": null, | ||
| "name": "Trim Galore!", | ||
| "outputs": [ | ||
| { | ||
| "name": "trimmed_reads_paired_collection", | ||
| "type": "input" | ||
| }, | ||
| { | ||
| "name": "trimmed_reads_unpaired_collection", | ||
| "type": "input" | ||
| }, | ||
| { | ||
| "name": "trimmed_reads_single", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "trimmed_reads_pair1", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "trimmed_reads_pair2", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "unpaired_reads_1", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "unpaired_reads_2", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "report_file", | ||
| "type": "txt" | ||
| } | ||
| ], | ||
| "position": { | ||
| "left": 450, | ||
| "top": 279 | ||
| }, | ||
| "post_job_actions": {}, | ||
| "tool_errors": null, | ||
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/trim_galore/trim_galore/0.4.2", | ||
| "tool_shed_repository": { | ||
| "changeset_revision": "f1e71aeaa923", | ||
| "name": "trim_galore", | ||
| "owner": "bgruening", | ||
| "tool_shed": "toolshed.g2.bx.psu.edu" | ||
| }, | ||
| "tool_state": "{\"__page__\": 0, \"singlePaired\": \"{\\\"three_prime_clip_R1\\\": \\\"\\\", \\\"trimming\\\": {\\\"adapter\\\": \\\"TCGTATGCCGTCTTCTGCTTG\\\", \\\"trimming_select\\\": \\\"user\\\", \\\"__current_case__\\\": 4}, \\\"sPaired\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_singles\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"__rerun_remap_job_id__\": null, \"params\": \"{\\\"settingsType\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"chromInfo\": \"\\\"/galaxy-central/tool-data/shared/ucsc/chrom/?.len\\\"\", \"rrbs\": \"{\\\"settingsType\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", | ||
| "tool_version": "0.4.2", | ||
| "type": "tool", | ||
| "uuid": "01822881-aef7-43b0-9b12-af471d8196f0", | ||
| "workflow_outputs": [] | ||
| }, | ||
| "3": { | ||
| "annotation": "", | ||
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", | ||
| "id": 3, | ||
| "input_connections": { | ||
| "library|input_1": { | ||
| "id": 2, | ||
| "output_name": "trimmed_reads_single" | ||
| }, | ||
| "reference_genome|own_file": { | ||
| "id": 1, | ||
| "output_name": "output" | ||
| } | ||
| }, | ||
| "inputs": [ | ||
| { | ||
| "description": "runtime parameter for tool Bowtie2", | ||
| "name": "library" | ||
| }, | ||
| { | ||
| "description": "runtime parameter for tool Bowtie2", | ||
| "name": "reference_genome" | ||
| } | ||
| ], | ||
| "label": null, | ||
| "name": "Bowtie2", | ||
| "outputs": [ | ||
| { | ||
| "name": "output_unaligned_reads_l", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "output_aligned_reads_l", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "output_aligned_reads_r", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "output_unaligned_reads_r", | ||
| "type": "fastqsanger" | ||
| }, | ||
| { | ||
| "name": "output", | ||
| "type": "bam" | ||
| }, | ||
| { | ||
| "name": "output_sam", | ||
| "type": "sam" | ||
| }, | ||
| { | ||
| "name": "mapping_stats", | ||
| "type": "txt" | ||
| } | ||
| ], | ||
| "position": { | ||
| "left": 923, | ||
| "top": 139 | ||
| }, | ||
| "post_job_actions": {}, | ||
| "tool_errors": null, | ||
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", | ||
| "tool_shed_repository": { | ||
| "changeset_revision": "a9d4f71dbfb0", | ||
| "name": "bowtie2", | ||
| "owner": "devteam", | ||
| "tool_shed": "toolshed.g2.bx.psu.edu" | ||
| }, | ||
| "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"aligned_file\\\": \\\"false\\\", \\\"unaligned_file\\\": \\\"false\\\", \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"rg\": \"{\\\"rg_selector\\\": \\\"do_not_set\\\", \\\"__current_case__\\\": 3}\", \"save_mapping_stats\": \"\\\"false\\\"\", \"analysis_type\": \"{\\\"alignment_options\\\": {\\\"__current_case__\\\": 1, \\\"alignment_options_selector\\\": \\\"no\\\"}, \\\"effort_options\\\": {\\\"effort_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"sam_options\\\": {\\\"omit_sec_seq\\\": \\\"false\\\", \\\"sam_options_selector\\\": \\\"yes\\\", \\\"no_unal\\\": \\\"true\\\", \\\"__current_case__\\\": 0}, \\\"other_options\\\": {\\\"other_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"scoring_options\\\": {\\\"scoring_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"reporting_options\\\": {\\\"reporting_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 0}, \\\"__current_case__\\\": 1, \\\"sam_opt\\\": \\\"true\\\", \\\"input_options\\\": {\\\"input_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}}\", \"chromInfo\": \"\\\"/galaxy-central/tool-data/shared/ucsc/chrom/?.len\\\"\"}", | ||
| "tool_version": "2.2.6.2", | ||
| "type": "tool", | ||
| "uuid": "8f21ce85-552d-4751-8798-78dc2931a84c", | ||
| "workflow_outputs": [] | ||
| }, | ||
| "4": { | ||
| "annotation": "", | ||
| "content_id": "toolshed.g2.bx.psu.edu/repos/rnateam/paralyzer/paralyzer/1.5", | ||
| "id": 4, | ||
| "input_connections": { | ||
| "input_sam": { | ||
| "id": 3, | ||
| "output_name": "output_sam" | ||
| }, | ||
| "refGenomeSource|ownFile": { | ||
| "id": 1, | ||
| "output_name": "output" | ||
| } | ||
| }, | ||
| "inputs": [ | ||
| { | ||
| "description": "runtime parameter for tool PARalyzer", | ||
| "name": "input_sam" | ||
| }, | ||
| { | ||
| "description": "runtime parameter for tool PARalyzer", | ||
| "name": "refGenomeSource" | ||
| } | ||
| ], | ||
| "label": null, | ||
| "name": "PARalyzer", | ||
| "outputs": [ | ||
| { | ||
| "name": "distribution", | ||
| "type": "txt" | ||
| }, | ||
| { | ||
| "name": "groups", | ||
| "type": "txt" | ||
| }, | ||
| { | ||
| "name": "clusters", | ||
| "type": "txt" | ||
| } | ||
| ], | ||
| "position": { | ||
| "left": 1142, | ||
| "top": 550 | ||
| }, | ||
| "post_job_actions": {}, | ||
| "tool_errors": null, | ||
| "tool_id": "toolshed.g2.bx.psu.edu/repos/rnateam/paralyzer/paralyzer/1.5", | ||
| "tool_shed_repository": { | ||
| "changeset_revision": "4dbe81be8b81", | ||
| "name": "paralyzer", | ||
| "owner": "rnateam", | ||
| "tool_shed": "toolshed.g2.bx.psu.edu" | ||
| }, | ||
| "tool_state": "{\"input_sam\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"conversion\": \"{\\\"selection\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"collapse\": \"\\\"false\\\"\", \"__page__\": 0, \"chromInfo\": \"\\\"/galaxy-central/tool-data/shared/ucsc/chrom/?.len\\\"\", \"__rerun_remap_job_id__\": null, \"params\": \"{\\\"settingsType\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"methods\": \"{\\\"__current_case__\\\": 0, \\\"choice\\\": \\\"EXTEND_BY_READ\\\"}\"}", | ||
| "tool_version": "1.5", | ||
| "type": "tool", | ||
| "uuid": "d284b376-1733-4b4d-aff7-8cdb63499c16", | ||
| "workflow_outputs": [] | ||
| } | ||
| }, | ||
| "uuid": "334f02d9-f1c1-4b51-a23b-bc9885286ca1" | ||
| } |
Oops, something went wrong.