/
searchindex.js
1 lines (1 loc) · 79.1 KB
/
searchindex.js
1
Search.setIndex({"alltitles": {"Adding metadata": [[1, "id1"]], "Adding sample and observation metadata to biom files": [[1, "adding-sample-and-observation-metadata-to-biom-files"]], "BIOM 2.0 OTU table in the HDF5 data description langauge (DDL)": [[5, "biom-2-0-otu-table-in-the-hdf5-data-description-langauge-ddl"]], "BIOM 2.1 OTU table in the HDF5 data description language (DDL)": [[6, "biom-2-1-otu-table-in-the-hdf5-data-description-language-ddl"]], "BIOM Documentation": [[107, "biom-documentation"]], "BIOM Table (biom.table)": [[110, "biom-table-biom-table"]], "BIOM version": [[111, "biom-version"]], "Citing the BIOM project": [[111, "citing-the-biom-project"]], "Classes": [[110, "classes"]], "Contents": [[111, "contents"]], "Converting QIIME 1.4.0 and earlier OTU tables to BIOM format": [[2, "converting-qiime-1-4-0-and-earlier-otu-tables-to-biom-format"]], "Converting between file formats": [[2, "converting-between-file-formats"]], "Development team": [[111, "development-team"]], "Efficient handling and storage of very large tables": [[3, "efficient-handling-and-storage-of-very-large-tables"]], "Encapsulation of core study data (OTU table data and sample/OTU metadata) in a single file": [[3, "encapsulation-of-core-study-data-otu-table-data-and-sample-otu-metadata-in-a-single-file"]], "Example biom files": [[4, "example-biom-files"], [5, "example-biom-files"], [6, "example-biom-files"]], "Examples": [[108, "examples"], [110, "examples"]], "Facilitating the use of tables between tools that support this format": [[3, "facilitating-the-use-of-tables-between-tools-that-support-this-format"]], "File extension": [[3, "file-extension"]], "Functions": [[108, "functions"]], "General usage examples": [[2, "general-usage-examples"]], "Installing the biom-format Python package": [[111, "installing-the-biom-format-python-package"]], "Minimal dense OTU table": [[4, "minimal-dense-otu-table"]], "Minimal sparse OTU table": [[4, "minimal-sparse-otu-table"]], "Motivation for the BIOM format": [[3, "motivation-for-the-biom-format"]], "Processing metadata while adding": [[1, "processing-metadata-while-adding"]], "Projects using the BIOM format": [[111, "projects-using-the-biom-format"]], "Quick start": [[108, "quick-start"]], "Renaming (or naming) metadata columns while adding": [[1, "renaming-or-naming-metadata-columns-while-adding"]], "Rich dense OTU table": [[4, "rich-dense-otu-table"]], "Rich sparse OTU table": [[4, "rich-sparse-otu-table"]], "Round-tripping between biom and tsv": [[2, "round-tripping-between-biom-and-tsv"]], "Special case usage examples": [[2, "special-case-usage-examples"]], "Summarizing BIOM tables": [[109, "summarizing-biom-tables"]], "Summarizing sample data": [[109, "summarizing-sample-data"]], "Summarizing sample data qualitatively": [[109, "summarizing-sample-data-qualitatively"]], "The BIOM Format License": [[0, "the-biom-format-license"]], "The Biological Observation Matrix (BIOM) format": [[111, "the-biological-observation-matrix-biom-format"]], "The biom file format": [[3, "the-biom-file-format"]], "The biom file format: Version 1.0": [[4, "the-biom-file-format-version-1-0"]], "The biom file format: Version 2.0": [[5, "the-biom-file-format-version-2-0"]], "The biom file format: Version 2.1": [[6, "the-biom-file-format-version-2-1"]], "Tips and FAQs regarding the BIOM file format": [[3, "tips-and-faqs-regarding-the-biom-file-format"]], "biom.load_table": [[7, "biom-load-table"]], "biom.table.Table": [[8, "biom-table-table"]], "biom.table.Table.__delattr__": [[9, "biom-table-table-delattr"]], "biom.table.Table.__dir__": [[10, "biom-table-table-dir"]], "biom.table.Table.__eq__": [[11, "biom-table-table-eq"]], "biom.table.Table.__format__": [[12, "biom-table-table-format"]], "biom.table.Table.__ge__": [[13, "biom-table-table-ge"]], "biom.table.Table.__getattribute__": [[14, "biom-table-table-getattribute"]], "biom.table.Table.__getitem__": [[15, "biom-table-table-getitem"]], "biom.table.Table.__gt__": [[16, "biom-table-table-gt"]], "biom.table.Table.__init__": [[17, "biom-table-table-init"]], "biom.table.Table.__init_subclass__": [[18, "biom-table-table-init-subclass"]], "biom.table.Table.__iter__": [[19, "biom-table-table-iter"]], "biom.table.Table.__le__": [[20, "biom-table-table-le"]], "biom.table.Table.__lt__": [[21, "biom-table-table-lt"]], "biom.table.Table.__ne__": [[22, "biom-table-table-ne"]], "biom.table.Table.__new__": [[23, "biom-table-table-new"]], "biom.table.Table.__reduce__": [[24, "biom-table-table-reduce"]], "biom.table.Table.__reduce_ex__": [[25, "biom-table-table-reduce-ex"]], "biom.table.Table.__repr__": [[26, "biom-table-table-repr"]], "biom.table.Table.__setattr__": [[27, "biom-table-table-setattr"]], "biom.table.Table.__sizeof__": [[28, "biom-table-table-sizeof"]], "biom.table.Table.__str__": [[29, "biom-table-table-str"]], "biom.table.Table.__subclasshook__": [[30, "biom-table-table-subclasshook"]], "biom.table.Table._axis_to_num": [[31, "biom-table-table-axis-to-num"]], "biom.table.Table._cast_metadata": [[32, "biom-table-table-cast-metadata"]], "biom.table.Table._conv_to_self_type": [[33, "biom-table-table-conv-to-self-type"]], "biom.table.Table._data_equality": [[34, "biom-table-table-data-equality"]], "biom.table.Table._extract_data_from_tsv": [[35, "biom-table-table-extract-data-from-tsv"]], "biom.table.Table._fast_merge": [[36, "biom-table-table-fast-merge"]], "biom.table.Table._get_col": [[37, "biom-table-table-get-col"]], "biom.table.Table._get_row": [[38, "biom-table-table-get-row"]], "biom.table.Table._get_sparse_data": [[39, "biom-table-table-get-sparse-data"]], "biom.table.Table._index": [[40, "biom-table-table-index"]], "biom.table.Table._index_ids": [[41, "biom-table-table-index-ids"]], "biom.table.Table._intersect_id_order": [[42, "biom-table-table-intersect-id-order"]], "biom.table.Table._invert_axis": [[43, "biom-table-table-invert-axis"]], "biom.table.Table._iter_obs": [[44, "biom-table-table-iter-obs"]], "biom.table.Table._iter_samp": [[45, "biom-table-table-iter-samp"]], "biom.table.Table._to_dense": [[46, "biom-table-table-to-dense"]], "biom.table.Table._to_sparse": [[47, "biom-table-table-to-sparse"]], "biom.table.Table._union_id_order": [[48, "biom-table-table-union-id-order"]], "biom.table.Table.add_group_metadata": [[49, "biom-table-table-add-group-metadata"]], "biom.table.Table.add_metadata": [[50, "biom-table-table-add-metadata"]], "biom.table.Table.align_to": [[51, "biom-table-table-align-to"]], "biom.table.Table.align_to_dataframe": [[52, "biom-table-table-align-to-dataframe"]], "biom.table.Table.align_tree": [[53, "biom-table-table-align-tree"]], "biom.table.Table.collapse": [[54, "biom-table-table-collapse"]], "biom.table.Table.concat": [[55, "biom-table-table-concat"]], "biom.table.Table.copy": [[56, "biom-table-table-copy"]], "biom.table.Table.data": [[57, "biom-table-table-data"]], "biom.table.Table.del_metadata": [[58, "biom-table-table-del-metadata"]], "biom.table.Table.delimited_self": [[59, "biom-table-table-delimited-self"]], "biom.table.Table.descriptive_equality": [[60, "biom-table-table-descriptive-equality"]], "biom.table.Table.dtype": [[61, "biom-table-table-dtype"]], "biom.table.Table.exists": [[62, "biom-table-table-exists"]], "biom.table.Table.filter": [[63, "biom-table-table-filter"]], "biom.table.Table.from_adjacency": [[64, "biom-table-table-from-adjacency"]], "biom.table.Table.from_hdf5": [[65, "biom-table-table-from-hdf5"]], "biom.table.Table.from_json": [[66, "biom-table-table-from-json"]], "biom.table.Table.from_tsv": [[67, "biom-table-table-from-tsv"]], "biom.table.Table.get_table_density": [[68, "biom-table-table-get-table-density"]], "biom.table.Table.get_value_by_ids": [[69, "biom-table-table-get-value-by-ids"]], "biom.table.Table.group_metadata": [[70, "biom-table-table-group-metadata"]], "biom.table.Table.head": [[71, "biom-table-table-head"]], "biom.table.Table.ids": [[72, "biom-table-table-ids"]], "biom.table.Table.index": [[73, "biom-table-table-index"]], "biom.table.Table.is_empty": [[74, "biom-table-table-is-empty"]], "biom.table.Table.iter": [[75, "biom-table-table-iter"]], "biom.table.Table.iter_data": [[76, "biom-table-table-iter-data"]], "biom.table.Table.iter_pairwise": [[77, "biom-table-table-iter-pairwise"]], "biom.table.Table.length": [[78, "biom-table-table-length"]], "biom.table.Table.matrix_data": [[79, "biom-table-table-matrix-data"]], "biom.table.Table.max": [[80, "biom-table-table-max"]], "biom.table.Table.merge": [[81, "biom-table-table-merge"]], "biom.table.Table.metadata": [[82, "biom-table-table-metadata"]], "biom.table.Table.metadata_to_dataframe": [[83, "biom-table-table-metadata-to-dataframe"]], "biom.table.Table.min": [[84, "biom-table-table-min"]], "biom.table.Table.nnz": [[85, "biom-table-table-nnz"]], "biom.table.Table.nonzero": [[86, "biom-table-table-nonzero"]], "biom.table.Table.nonzero_counts": [[87, "biom-table-table-nonzero-counts"]], "biom.table.Table.norm": [[88, "biom-table-table-norm"]], "biom.table.Table.pa": [[89, "biom-table-table-pa"]], "biom.table.Table.partition": [[90, "biom-table-table-partition"]], "biom.table.Table.rankdata": [[91, "biom-table-table-rankdata"]], "biom.table.Table.reduce": [[92, "biom-table-table-reduce"]], "biom.table.Table.remove_empty": [[93, "biom-table-table-remove-empty"]], "biom.table.Table.shape": [[94, "biom-table-table-shape"]], "biom.table.Table.sort": [[95, "biom-table-table-sort"]], "biom.table.Table.sort_order": [[96, "biom-table-table-sort-order"]], "biom.table.Table.subsample": [[97, "biom-table-table-subsample"]], "biom.table.Table.sum": [[98, "biom-table-table-sum"]], "biom.table.Table.to_anndata": [[99, "biom-table-table-to-anndata"]], "biom.table.Table.to_dataframe": [[100, "biom-table-table-to-dataframe"]], "biom.table.Table.to_hdf5": [[101, "biom-table-table-to-hdf5"]], "biom.table.Table.to_json": [[102, "biom-table-table-to-json"]], "biom.table.Table.to_tsv": [[103, "biom-table-table-to-tsv"]], "biom.table.Table.transform": [[104, "biom-table-table-transform"]], "biom.table.Table.transpose": [[105, "biom-table-table-transpose"]], "biom.table.Table.update_ids": [[106, "biom-table-table-update-ids"]]}, "docnames": ["BIOM_LICENSE", "documentation/adding_metadata", "documentation/biom_conversion", "documentation/biom_format", "documentation/format_versions/biom-1.0", "documentation/format_versions/biom-2.0", "documentation/format_versions/biom-2.1", "documentation/generated/biom.load_table", "documentation/generated/biom.table.Table", "documentation/generated/biom.table.Table.__delattr__", "documentation/generated/biom.table.Table.__dir__", "documentation/generated/biom.table.Table.__eq__", "documentation/generated/biom.table.Table.__format__", "documentation/generated/biom.table.Table.__ge__", "documentation/generated/biom.table.Table.__getattribute__", "documentation/generated/biom.table.Table.__getitem__", "documentation/generated/biom.table.Table.__gt__", "documentation/generated/biom.table.Table.__init__", "documentation/generated/biom.table.Table.__init_subclass__", "documentation/generated/biom.table.Table.__iter__", "documentation/generated/biom.table.Table.__le__", "documentation/generated/biom.table.Table.__lt__", "documentation/generated/biom.table.Table.__ne__", "documentation/generated/biom.table.Table.__new__", "documentation/generated/biom.table.Table.__reduce__", "documentation/generated/biom.table.Table.__reduce_ex__", "documentation/generated/biom.table.Table.__repr__", "documentation/generated/biom.table.Table.__setattr__", "documentation/generated/biom.table.Table.__sizeof__", "documentation/generated/biom.table.Table.__str__", "documentation/generated/biom.table.Table.__subclasshook__", "documentation/generated/biom.table.Table._axis_to_num", "documentation/generated/biom.table.Table._cast_metadata", "documentation/generated/biom.table.Table._conv_to_self_type", "documentation/generated/biom.table.Table._data_equality", "documentation/generated/biom.table.Table._extract_data_from_tsv", "documentation/generated/biom.table.Table._fast_merge", "documentation/generated/biom.table.Table._get_col", "documentation/generated/biom.table.Table._get_row", "documentation/generated/biom.table.Table._get_sparse_data", "documentation/generated/biom.table.Table._index", "documentation/generated/biom.table.Table._index_ids", "documentation/generated/biom.table.Table._intersect_id_order", "documentation/generated/biom.table.Table._invert_axis", "documentation/generated/biom.table.Table._iter_obs", "documentation/generated/biom.table.Table._iter_samp", "documentation/generated/biom.table.Table._to_dense", "documentation/generated/biom.table.Table._to_sparse", "documentation/generated/biom.table.Table._union_id_order", "documentation/generated/biom.table.Table.add_group_metadata", "documentation/generated/biom.table.Table.add_metadata", "documentation/generated/biom.table.Table.align_to", "documentation/generated/biom.table.Table.align_to_dataframe", "documentation/generated/biom.table.Table.align_tree", "documentation/generated/biom.table.Table.collapse", "documentation/generated/biom.table.Table.concat", "documentation/generated/biom.table.Table.copy", "documentation/generated/biom.table.Table.data", "documentation/generated/biom.table.Table.del_metadata", "documentation/generated/biom.table.Table.delimited_self", "documentation/generated/biom.table.Table.descriptive_equality", "documentation/generated/biom.table.Table.dtype", "documentation/generated/biom.table.Table.exists", "documentation/generated/biom.table.Table.filter", "documentation/generated/biom.table.Table.from_adjacency", "documentation/generated/biom.table.Table.from_hdf5", "documentation/generated/biom.table.Table.from_json", "documentation/generated/biom.table.Table.from_tsv", "documentation/generated/biom.table.Table.get_table_density", "documentation/generated/biom.table.Table.get_value_by_ids", "documentation/generated/biom.table.Table.group_metadata", "documentation/generated/biom.table.Table.head", "documentation/generated/biom.table.Table.ids", "documentation/generated/biom.table.Table.index", "documentation/generated/biom.table.Table.is_empty", "documentation/generated/biom.table.Table.iter", "documentation/generated/biom.table.Table.iter_data", "documentation/generated/biom.table.Table.iter_pairwise", "documentation/generated/biom.table.Table.length", "documentation/generated/biom.table.Table.matrix_data", "documentation/generated/biom.table.Table.max", "documentation/generated/biom.table.Table.merge", "documentation/generated/biom.table.Table.metadata", "documentation/generated/biom.table.Table.metadata_to_dataframe", "documentation/generated/biom.table.Table.min", "documentation/generated/biom.table.Table.nnz", "documentation/generated/biom.table.Table.nonzero", "documentation/generated/biom.table.Table.nonzero_counts", "documentation/generated/biom.table.Table.norm", "documentation/generated/biom.table.Table.pa", "documentation/generated/biom.table.Table.partition", "documentation/generated/biom.table.Table.rankdata", "documentation/generated/biom.table.Table.reduce", "documentation/generated/biom.table.Table.remove_empty", "documentation/generated/biom.table.Table.shape", "documentation/generated/biom.table.Table.sort", "documentation/generated/biom.table.Table.sort_order", "documentation/generated/biom.table.Table.subsample", "documentation/generated/biom.table.Table.sum", "documentation/generated/biom.table.Table.to_anndata", "documentation/generated/biom.table.Table.to_dataframe", "documentation/generated/biom.table.Table.to_hdf5", "documentation/generated/biom.table.Table.to_json", "documentation/generated/biom.table.Table.to_tsv", "documentation/generated/biom.table.Table.transform", "documentation/generated/biom.table.Table.transpose", "documentation/generated/biom.table.Table.update_ids", "documentation/index", "documentation/quick_usage_examples", "documentation/summarizing_biom_tables", "documentation/table_objects", "index"], "envversion": {"sphinx": 61, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2}, "filenames": ["BIOM_LICENSE.rst", "documentation/adding_metadata.rst", "documentation/biom_conversion.rst", "documentation/biom_format.rst", "documentation/format_versions/biom-1.0.rst", "documentation/format_versions/biom-2.0.rst", "documentation/format_versions/biom-2.1.rst", "documentation/generated/biom.load_table.rst", "documentation/generated/biom.table.Table.rst", "documentation/generated/biom.table.Table.__delattr__.rst", "documentation/generated/biom.table.Table.__dir__.rst", "documentation/generated/biom.table.Table.__eq__.rst", "documentation/generated/biom.table.Table.__format__.rst", "documentation/generated/biom.table.Table.__ge__.rst", "documentation/generated/biom.table.Table.__getattribute__.rst", "documentation/generated/biom.table.Table.__getitem__.rst", "documentation/generated/biom.table.Table.__gt__.rst", "documentation/generated/biom.table.Table.__init__.rst", "documentation/generated/biom.table.Table.__init_subclass__.rst", "documentation/generated/biom.table.Table.__iter__.rst", "documentation/generated/biom.table.Table.__le__.rst", "documentation/generated/biom.table.Table.__lt__.rst", "documentation/generated/biom.table.Table.__ne__.rst", "documentation/generated/biom.table.Table.__new__.rst", "documentation/generated/biom.table.Table.__reduce__.rst", "documentation/generated/biom.table.Table.__reduce_ex__.rst", "documentation/generated/biom.table.Table.__repr__.rst", "documentation/generated/biom.table.Table.__setattr__.rst", "documentation/generated/biom.table.Table.__sizeof__.rst", "documentation/generated/biom.table.Table.__str__.rst", "documentation/generated/biom.table.Table.__subclasshook__.rst", "documentation/generated/biom.table.Table._axis_to_num.rst", "documentation/generated/biom.table.Table._cast_metadata.rst", "documentation/generated/biom.table.Table._conv_to_self_type.rst", "documentation/generated/biom.table.Table._data_equality.rst", "documentation/generated/biom.table.Table._extract_data_from_tsv.rst", "documentation/generated/biom.table.Table._fast_merge.rst", "documentation/generated/biom.table.Table._get_col.rst", "documentation/generated/biom.table.Table._get_row.rst", "documentation/generated/biom.table.Table._get_sparse_data.rst", "documentation/generated/biom.table.Table._index.rst", "documentation/generated/biom.table.Table._index_ids.rst", "documentation/generated/biom.table.Table._intersect_id_order.rst", "documentation/generated/biom.table.Table._invert_axis.rst", "documentation/generated/biom.table.Table._iter_obs.rst", "documentation/generated/biom.table.Table._iter_samp.rst", "documentation/generated/biom.table.Table._to_dense.rst", "documentation/generated/biom.table.Table._to_sparse.rst", "documentation/generated/biom.table.Table._union_id_order.rst", "documentation/generated/biom.table.Table.add_group_metadata.rst", "documentation/generated/biom.table.Table.add_metadata.rst", "documentation/generated/biom.table.Table.align_to.rst", "documentation/generated/biom.table.Table.align_to_dataframe.rst", "documentation/generated/biom.table.Table.align_tree.rst", "documentation/generated/biom.table.Table.collapse.rst", "documentation/generated/biom.table.Table.concat.rst", "documentation/generated/biom.table.Table.copy.rst", "documentation/generated/biom.table.Table.data.rst", "documentation/generated/biom.table.Table.del_metadata.rst", "documentation/generated/biom.table.Table.delimited_self.rst", "documentation/generated/biom.table.Table.descriptive_equality.rst", "documentation/generated/biom.table.Table.dtype.rst", "documentation/generated/biom.table.Table.exists.rst", "documentation/generated/biom.table.Table.filter.rst", "documentation/generated/biom.table.Table.from_adjacency.rst", "documentation/generated/biom.table.Table.from_hdf5.rst", "documentation/generated/biom.table.Table.from_json.rst", "documentation/generated/biom.table.Table.from_tsv.rst", "documentation/generated/biom.table.Table.get_table_density.rst", "documentation/generated/biom.table.Table.get_value_by_ids.rst", "documentation/generated/biom.table.Table.group_metadata.rst", "documentation/generated/biom.table.Table.head.rst", "documentation/generated/biom.table.Table.ids.rst", "documentation/generated/biom.table.Table.index.rst", "documentation/generated/biom.table.Table.is_empty.rst", "documentation/generated/biom.table.Table.iter.rst", "documentation/generated/biom.table.Table.iter_data.rst", "documentation/generated/biom.table.Table.iter_pairwise.rst", "documentation/generated/biom.table.Table.length.rst", "documentation/generated/biom.table.Table.matrix_data.rst", "documentation/generated/biom.table.Table.max.rst", "documentation/generated/biom.table.Table.merge.rst", "documentation/generated/biom.table.Table.metadata.rst", "documentation/generated/biom.table.Table.metadata_to_dataframe.rst", "documentation/generated/biom.table.Table.min.rst", "documentation/generated/biom.table.Table.nnz.rst", "documentation/generated/biom.table.Table.nonzero.rst", "documentation/generated/biom.table.Table.nonzero_counts.rst", "documentation/generated/biom.table.Table.norm.rst", "documentation/generated/biom.table.Table.pa.rst", "documentation/generated/biom.table.Table.partition.rst", "documentation/generated/biom.table.Table.rankdata.rst", "documentation/generated/biom.table.Table.reduce.rst", "documentation/generated/biom.table.Table.remove_empty.rst", "documentation/generated/biom.table.Table.shape.rst", "documentation/generated/biom.table.Table.sort.rst", "documentation/generated/biom.table.Table.sort_order.rst", "documentation/generated/biom.table.Table.subsample.rst", "documentation/generated/biom.table.Table.sum.rst", "documentation/generated/biom.table.Table.to_anndata.rst", "documentation/generated/biom.table.Table.to_dataframe.rst", "documentation/generated/biom.table.Table.to_hdf5.rst", "documentation/generated/biom.table.Table.to_json.rst", "documentation/generated/biom.table.Table.to_tsv.rst", "documentation/generated/biom.table.Table.transform.rst", "documentation/generated/biom.table.Table.transpose.rst", "documentation/generated/biom.table.Table.update_ids.rst", "documentation/index.rst", "documentation/quick_usage_examples.rst", "documentation/summarizing_biom_tables.rst", "documentation/table_objects.rst", "index.rst"], "indexentries": {"__delattr__() (biom.table.table method)": [[9, "biom.table.Table.__delattr__", false]], "__dir__() (biom.table.table method)": [[10, "biom.table.Table.__dir__", false]], "__eq__() (biom.table.table method)": [[11, "biom.table.Table.__eq__", false]], "__format__() (biom.table.table method)": [[12, "biom.table.Table.__format__", false]], "__ge__() (biom.table.table method)": [[13, "biom.table.Table.__ge__", false]], "__getattribute__() (biom.table.table method)": [[14, "biom.table.Table.__getattribute__", false]], "__getitem__() (biom.table.table method)": [[15, "biom.table.Table.__getitem__", false]], "__gt__() (biom.table.table method)": [[16, "biom.table.Table.__gt__", false]], "__init__() (biom.table.table method)": [[17, "biom.table.Table.__init__", false]], "__init_subclass__() (biom.table.table method)": [[18, "biom.table.Table.__init_subclass__", false]], "__iter__() (biom.table.table method)": [[19, "biom.table.Table.__iter__", false]], "__le__() (biom.table.table method)": [[20, "biom.table.Table.__le__", false]], "__lt__() (biom.table.table method)": [[21, "biom.table.Table.__lt__", false]], "__ne__() (biom.table.table method)": [[22, "biom.table.Table.__ne__", false]], "__new__() (biom.table.table method)": [[23, "biom.table.Table.__new__", false]], "__reduce__() (biom.table.table method)": [[24, "biom.table.Table.__reduce__", false]], "__reduce_ex__() (biom.table.table method)": [[25, "biom.table.Table.__reduce_ex__", false]], "__repr__() (biom.table.table method)": [[26, "biom.table.Table.__repr__", false]], "__setattr__() (biom.table.table method)": [[27, "biom.table.Table.__setattr__", false]], "__sizeof__() (biom.table.table method)": [[28, "biom.table.Table.__sizeof__", false]], "__str__() (biom.table.table method)": [[29, "biom.table.Table.__str__", false]], "__subclasshook__() (biom.table.table method)": [[30, "biom.table.Table.__subclasshook__", false]], "_axis_to_num() (biom.table.table method)": [[31, "biom.table.Table._axis_to_num", false]], "_cast_metadata() (biom.table.table method)": [[32, "biom.table.Table._cast_metadata", false]], "_conv_to_self_type() (biom.table.table method)": [[33, "biom.table.Table._conv_to_self_type", false]], "_data_equality() (biom.table.table method)": [[34, "biom.table.Table._data_equality", false]], "_extract_data_from_tsv() (biom.table.table static method)": [[35, "biom.table.Table._extract_data_from_tsv", false]], "_fast_merge() (biom.table.table method)": [[36, "biom.table.Table._fast_merge", false]], "_get_col() (biom.table.table method)": [[37, "biom.table.Table._get_col", false]], "_get_row() (biom.table.table method)": [[38, "biom.table.Table._get_row", false]], "_get_sparse_data() (biom.table.table method)": [[39, "biom.table.Table._get_sparse_data", false]], "_index() (biom.table.table method)": [[40, "biom.table.Table._index", false]], "_index_ids() (biom.table.table method)": [[41, "biom.table.Table._index_ids", false]], "_intersect_id_order() (biom.table.table method)": [[42, "biom.table.Table._intersect_id_order", false]], "_invert_axis() (biom.table.table method)": [[43, "biom.table.Table._invert_axis", false]], "_iter_obs() (biom.table.table method)": [[44, "biom.table.Table._iter_obs", false]], "_iter_samp() (biom.table.table method)": [[45, "biom.table.Table._iter_samp", false]], "_to_dense() (biom.table.table static method)": [[46, "biom.table.Table._to_dense", false]], "_to_sparse() (biom.table.table static method)": [[47, "biom.table.Table._to_sparse", false]], "_union_id_order() (biom.table.table method)": [[48, "biom.table.Table._union_id_order", false]], "add_group_metadata() (biom.table.table method)": [[49, "biom.table.Table.add_group_metadata", false]], "add_metadata() (biom.table.table method)": [[50, "biom.table.Table.add_metadata", false]], "align_to() (biom.table.table method)": [[51, "biom.table.Table.align_to", false]], "align_to_dataframe() (biom.table.table method)": [[52, "biom.table.Table.align_to_dataframe", false]], "align_tree() (biom.table.table method)": [[53, "biom.table.Table.align_tree", false]], "biom": [[108, "module-biom", false]], "biom.table": [[110, "module-biom.table", false]], "collapse() (biom.table.table method)": [[54, "biom.table.Table.collapse", false]], "concat() (biom.table.table method)": [[55, "biom.table.Table.concat", false]], "copy() (biom.table.table method)": [[56, "biom.table.Table.copy", false]], "data() (biom.table.table method)": [[57, "biom.table.Table.data", false]], "del_metadata() (biom.table.table method)": [[58, "biom.table.Table.del_metadata", false]], "delimited_self() (biom.table.table method)": [[59, "biom.table.Table.delimited_self", false]], "descriptive_equality() (biom.table.table method)": [[60, "biom.table.Table.descriptive_equality", false]], "documentation": [[107, "index-0", false]], "dtype (biom.table.table property)": [[61, "biom.table.Table.dtype", false]], "exists() (biom.table.table method)": [[62, "biom.table.Table.exists", false]], "filter() (biom.table.table method)": [[63, "biom.table.Table.filter", false]], "from_adjacency() (biom.table.table static method)": [[64, "biom.table.Table.from_adjacency", false]], "from_hdf5() (biom.table.table class method)": [[65, "biom.table.Table.from_hdf5", false]], "from_json() (biom.table.table class method)": [[66, "biom.table.Table.from_json", false]], "from_tsv() (biom.table.table static method)": [[67, "biom.table.Table.from_tsv", false]], "get_table_density() (biom.table.table method)": [[68, "biom.table.Table.get_table_density", false]], "get_value_by_ids() (biom.table.table method)": [[69, "biom.table.Table.get_value_by_ids", false]], "group_metadata() (biom.table.table method)": [[70, "biom.table.Table.group_metadata", false]], "head() (biom.table.table method)": [[71, "biom.table.Table.head", false]], "ids() (biom.table.table method)": [[72, "biom.table.Table.ids", false]], "index() (biom.table.table method)": [[73, "biom.table.Table.index", false]], "is_empty() (biom.table.table method)": [[74, "biom.table.Table.is_empty", false]], "iter() (biom.table.table method)": [[75, "biom.table.Table.iter", false]], "iter_data() (biom.table.table method)": [[76, "biom.table.Table.iter_data", false]], "iter_pairwise() (biom.table.table method)": [[77, "biom.table.Table.iter_pairwise", false]], "length() (biom.table.table method)": [[78, "biom.table.Table.length", false]], "load_table() (in module biom)": [[7, "biom.load_table", false]], "matrix_data (biom.table.table property)": [[79, "biom.table.Table.matrix_data", false]], "max() (biom.table.table method)": [[80, "biom.table.Table.max", false]], "merge() (biom.table.table method)": [[81, "biom.table.Table.merge", false]], "metadata() (biom.table.table method)": [[82, "biom.table.Table.metadata", false]], "metadata_to_dataframe() (biom.table.table method)": [[83, "biom.table.Table.metadata_to_dataframe", false]], "min() (biom.table.table method)": [[84, "biom.table.Table.min", false]], "module": [[108, "module-biom", false], [110, "module-biom.table", false]], "nnz (biom.table.table property)": [[85, "biom.table.Table.nnz", false]], "nonzero() (biom.table.table method)": [[86, "biom.table.Table.nonzero", false]], "nonzero_counts() (biom.table.table method)": [[87, "biom.table.Table.nonzero_counts", false]], "norm() (biom.table.table method)": [[88, "biom.table.Table.norm", false]], "pa() (biom.table.table method)": [[89, "biom.table.Table.pa", false]], "partition() (biom.table.table method)": [[90, "biom.table.Table.partition", false]], "rankdata() (biom.table.table method)": [[91, "biom.table.Table.rankdata", false]], "reduce() (biom.table.table method)": [[92, "biom.table.Table.reduce", false]], "remove_empty() (biom.table.table method)": [[93, "biom.table.Table.remove_empty", false]], "shape (biom.table.table property)": [[94, "biom.table.Table.shape", false]], "sort() (biom.table.table method)": [[95, "biom.table.Table.sort", false]], "sort_order() (biom.table.table method)": [[96, "biom.table.Table.sort_order", false]], "subsample() (biom.table.table method)": [[97, "biom.table.Table.subsample", false]], "sum() (biom.table.table method)": [[98, "biom.table.Table.sum", false]], "table (class in biom.table)": [[8, "biom.table.Table", false]], "to_anndata() (biom.table.table method)": [[99, "biom.table.Table.to_anndata", false]], "to_dataframe() (biom.table.table method)": [[100, "biom.table.Table.to_dataframe", false]], "to_hdf5() (biom.table.table method)": [[101, "biom.table.Table.to_hdf5", false]], "to_json() (biom.table.table method)": [[102, "biom.table.Table.to_json", false]], "to_tsv() (biom.table.table method)": [[103, "biom.table.Table.to_tsv", false]], "transform() (biom.table.table method)": [[104, "biom.table.Table.transform", false]], "transpose() (biom.table.table method)": [[105, "biom.table.Table.transpose", false]], "update_ids() (biom.table.table method)": [[106, "biom.table.Table.update_ids", false]]}, "objects": {"": [[108, 0, 0, "-", "biom"]], "biom": [[7, 1, 1, "", "load_table"], [110, 0, 0, "-", "table"]], "biom.table": [[8, 2, 1, "", "Table"]], "biom.table.Table": [[9, 3, 1, "", "__delattr__"], [10, 3, 1, "", "__dir__"], [11, 3, 1, "", "__eq__"], [12, 3, 1, "", "__format__"], [13, 3, 1, "", "__ge__"], [14, 3, 1, "", "__getattribute__"], [15, 3, 1, "", "__getitem__"], [16, 3, 1, "", "__gt__"], [17, 3, 1, "", "__init__"], [18, 3, 1, "", "__init_subclass__"], [19, 3, 1, "", "__iter__"], [20, 3, 1, "", "__le__"], [21, 3, 1, "", "__lt__"], [22, 3, 1, "", "__ne__"], [23, 3, 1, "", "__new__"], [24, 3, 1, "", "__reduce__"], [25, 3, 1, "", "__reduce_ex__"], [26, 3, 1, "", "__repr__"], [27, 3, 1, "", "__setattr__"], [28, 3, 1, "", "__sizeof__"], [29, 3, 1, "", "__str__"], [30, 3, 1, "", "__subclasshook__"], [31, 3, 1, "", "_axis_to_num"], [32, 3, 1, "", "_cast_metadata"], [33, 3, 1, "", "_conv_to_self_type"], [34, 3, 1, "", "_data_equality"], [35, 3, 1, "", "_extract_data_from_tsv"], [36, 3, 1, "", "_fast_merge"], [37, 3, 1, "", "_get_col"], [38, 3, 1, "", "_get_row"], [39, 3, 1, "", "_get_sparse_data"], [40, 3, 1, "", "_index"], [41, 3, 1, "", "_index_ids"], [42, 3, 1, "", "_intersect_id_order"], [43, 3, 1, "", "_invert_axis"], [44, 3, 1, "", "_iter_obs"], [45, 3, 1, "", "_iter_samp"], [46, 3, 1, "", "_to_dense"], [47, 3, 1, "", "_to_sparse"], [48, 3, 1, "", "_union_id_order"], [49, 3, 1, "", "add_group_metadata"], [50, 3, 1, "", "add_metadata"], [51, 3, 1, "", "align_to"], [52, 3, 1, "", "align_to_dataframe"], [53, 3, 1, "", "align_tree"], [54, 3, 1, "", "collapse"], [55, 3, 1, "", "concat"], [56, 3, 1, "", "copy"], [57, 3, 1, "", "data"], [58, 3, 1, "", "del_metadata"], [59, 3, 1, "", "delimited_self"], [60, 3, 1, "", "descriptive_equality"], [61, 4, 1, "", "dtype"], [62, 3, 1, "", "exists"], [63, 3, 1, "", "filter"], [64, 3, 1, "", "from_adjacency"], [65, 3, 1, "", "from_hdf5"], [66, 3, 1, "", "from_json"], [67, 3, 1, "", "from_tsv"], [68, 3, 1, "", "get_table_density"], [69, 3, 1, "", "get_value_by_ids"], [70, 3, 1, "", "group_metadata"], [71, 3, 1, "", "head"], [72, 3, 1, "", "ids"], [73, 3, 1, "", "index"], [74, 3, 1, "", "is_empty"], [75, 3, 1, "", "iter"], [76, 3, 1, "", "iter_data"], [77, 3, 1, "", "iter_pairwise"], [78, 3, 1, "", "length"], [79, 4, 1, "", "matrix_data"], [80, 3, 1, "", "max"], [81, 3, 1, "", "merge"], [82, 3, 1, "", "metadata"], [83, 3, 1, "", "metadata_to_dataframe"], [84, 3, 1, "", "min"], [85, 4, 1, "", "nnz"], [86, 3, 1, "", "nonzero"], [87, 3, 1, "", "nonzero_counts"], [88, 3, 1, "", "norm"], [89, 3, 1, "", "pa"], [90, 3, 1, "", "partition"], [91, 3, 1, "", "rankdata"], [92, 3, 1, "", "reduce"], [93, 3, 1, "", "remove_empty"], [94, 4, 1, "", "shape"], [95, 3, 1, "", "sort"], [96, 3, 1, "", "sort_order"], [97, 3, 1, "", "subsample"], [98, 3, 1, "", "sum"], [99, 3, 1, "", "to_anndata"], [100, 3, 1, "", "to_dataframe"], [101, 3, 1, "", "to_hdf5"], [102, 3, 1, "", "to_json"], [103, 3, 1, "", "to_tsv"], [104, 3, 1, "", "transform"], [105, 3, 1, "", "transpose"], [106, 3, 1, "", "update_ids"]]}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "function", "Python function"], "2": ["py", "class", "Python class"], "3": ["py", "method", "Python method"], "4": ["py", "property", "Python property"]}, "objtypes": {"0": "py:module", "1": "py:function", "2": "py:class", "3": "py:method", "4": "py:property"}, "terms": {"": [2, 26, 35, 54, 63, 71, 76, 92, 96, 110], "0": [1, 3, 6, 8, 15, 51, 52, 53, 54, 55, 57, 62, 63, 66, 69, 70, 71, 72, 73, 75, 76, 81, 82, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 101, 103, 104, 106, 107, 108, 109, 110, 111], "00": [1, 4], "000": [1, 109], "01": 110, "0222222222222": 110, "03": 110, "03t14": 66, "0444444444444": 110, "05": [5, 110], "052446": 5, "06": 66, "0666666666667": 110, "07": [6, 110], "0888888888889": 110, "09": 110, "0th": 83, "1": [1, 3, 5, 8, 46, 51, 52, 53, 54, 55, 58, 62, 63, 65, 66, 69, 70, 71, 72, 73, 75, 76, 81, 82, 84, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 101, 103, 104, 106, 107, 108, 109, 110, 111], "10": [15, 51, 54, 55, 59, 76, 81, 110, 111], "100": [71, 97], "10x4": 110, "11": [5, 6, 51, 54, 55, 76, 110], "111111111111": 110, "112": 91, "1186": 111, "11t07": 1, "12": [1, 4, 5, 6, 54, 55, 91, 110], "13": [5, 6, 54, 55, 101, 110], "133333333333": 110, "13t14": 5, "14": [55, 110], "142857142857": 88, "15": [1, 5, 6, 55, 110], "155555555556": 110, "16": [6, 51, 55, 110, 111], "17": [55, 110], "177777777778": 110, "18": 110, "180": 110, "19": [54, 110], "190": 110, "19t19": [1, 4], "2": [1, 3, 4, 8, 51, 52, 53, 54, 55, 58, 59, 63, 65, 66, 71, 78, 80, 81, 84, 88, 91, 97, 99, 100, 101, 104, 106, 107, 108, 109, 110, 111], "20": [71, 110], "200": 110, "20060109": 1, "20060216": 1, "20060805": 1, "20070101": 1, "20070530": 1, "20070716": 1, "2011": [0, 1, 4], "2012": [1, 8, 111], "2014": [0, 5, 6, 66], "2047": 111, "21": [54, 71, 104, 110], "210": 110, "217x": 111, "22": [71, 110], "23": [54, 71, 110], "24": [66, 71, 110], "25": [88, 110], "26": 110, "27": [109, 110], "28": 110, "29": [1, 110], "29t16": 6, "2nd": 75, "2x2": [81, 88], "2x3": [62, 63, 69, 70, 72, 73, 75, 82, 89, 90, 92, 95, 96, 98, 103, 104, 106], "3": [1, 3, 4, 5, 6, 51, 52, 53, 54, 55, 57, 58, 62, 63, 66, 69, 70, 71, 72, 73, 75, 76, 78, 81, 82, 84, 88, 89, 90, 91, 92, 95, 96, 97, 98, 99, 100, 101, 103, 104, 106, 108, 109, 110], "30": [1, 76, 110], "31": 110, "32": [5, 110], "33": 110, "34": 110, "35": 110, "354": 3, "355": 3, "356": 3, "36": [1, 6, 110], "37": 110, "38": 110, "39": 110, "3x2": 81, "4": [1, 3, 4, 5, 6, 51, 52, 53, 55, 58, 59, 66, 70, 71, 81, 91, 95, 96, 100, 101, 108, 109, 110], "40": [66, 71, 110], "41": 71, "42": [62, 63, 69, 70, 71, 72, 73, 75, 82, 89, 90, 91, 92, 98, 103, 104, 106], "43": [71, 92, 98], "44": 71, "46": [75, 92, 98], "467843": 1, "47": 98, "5": [1, 4, 5, 6, 15, 51, 52, 53, 54, 55, 66, 71, 80, 81, 91, 100, 104, 108, 109, 110], "50": [5, 63], "500": 109, "57": 76, "6": [1, 3, 4, 5, 6, 51, 54, 55, 66, 71, 81, 88, 91, 109, 110], "60": 71, "61": 71, "617320": 6, "62": 71, "63": 71, "64": 71, "665": 1, "7": [3, 5, 6, 8, 51, 54, 55, 91, 109, 110, 111], "75": [88, 91], "8": [51, 54, 55, 59, 91, 110], "80": 71, "81": 71, "82": 71, "83": 71, "84": 71, "842": 1, "857142857143": 88, "8601": [4, 5, 6], "870689": 1, "884420": 66, "9": [4, 5, 6, 51, 54, 55, 110], "90": 3, "957": 109, "97": 110, "98": 1, "980": 1, "99": [3, 91], "A": [0, 1, 3, 4, 5, 6, 15, 26, 37, 38, 42, 48, 52, 53, 54, 58, 64, 65, 66, 67, 75, 83, 90, 92, 93, 95, 96, 97, 100, 101, 102, 104, 110], "AND": 0, "AS": 0, "As": [1, 3, 109], "At": [3, 54], "BE": 0, "BUT": 0, "BY": 0, "But": 110, "By": [65, 77], "FOR": 0, "For": [1, 2, 3, 5, 8, 33, 36, 54, 59, 60, 83, 97, 110, 111], "IF": [0, 83], "IN": 0, "If": [1, 2, 5, 7, 15, 30, 36, 40, 49, 51, 54, 55, 57, 58, 59, 63, 64, 65, 66, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 87, 88, 90, 91, 92, 93, 97, 98, 99, 100, 101, 102, 103, 104, 106, 109, 110, 111], "In": [1, 2, 3, 51], "It": [18, 30, 63, 104], "NO": 0, "NOT": 0, "No": [5, 6], "OF": 0, "ON": 0, "OR": 0, "One": 6, "SUCH": 0, "THE": 0, "TO": 0, "The": [1, 2, 7, 8, 15, 18, 34, 35, 39, 49, 50, 51, 52, 53, 54, 55, 58, 61, 62, 64, 65, 67, 68, 69, 70, 71, 72, 75, 77, 78, 79, 80, 81, 82, 83, 84, 87, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 101, 103, 104, 105, 107, 109, 110], "Then": 2, "There": [1, 54, 81], "These": [15, 37, 38, 81, 107], "To": [1, 4, 109, 110, 111], "With": 111, "_": 89, "__subclasscheck__": 30, "_biom_complet": 111, "_data": 41, "_not_": 54, "aactcgtcgatg": 1, "aatt": 54, "abc": 30, "abcmeta": 30, "about": [1, 54, 87, 109, 111], "abov": [0, 1, 110], "absenc": [89, 110], "absolut": 97, "abstract": [30, 110], "abund": [91, 97, 110], "acagaccactca": 1, "accagcgactag": 1, "accept": [4, 5, 6, 110], "accord": [95, 96], "accordingli": [7, 108], "across": 55, "actual": [5, 6], "ad": [54, 81, 107, 111], "adata": 99, "add": [1, 49, 50, 54, 75, 98, 110, 111], "addit": [1, 35], "addition": 96, "adjac": 64, "adopt": 3, "advis": 0, "after": 32, "again": [1, 88, 111], "against": [52, 53], "agcacgagccta": 1, "agcagcacaact": 1, "agcagcacttgt": 1, "aggreg": 36, "al": 8, "algorithm": 30, "align": [51, 52, 53], "all": [0, 1, 32, 36, 54, 55, 58, 63, 98, 106, 109, 110, 111], "allow": [3, 8, 54], "along": [72, 95, 106], "alpha": 3, "alreadi": 3, "also": [0, 1, 3, 59, 65, 77, 110], "although": [4, 55], "alwai": [46, 81], "amount": 3, "amplicon": 51, "amplifi": 1, "an": [1, 2, 3, 4, 5, 6, 8, 15, 36, 40, 43, 49, 50, 51, 57, 58, 62, 63, 64, 65, 70, 72, 73, 75, 78, 80, 81, 82, 84, 87, 88, 98, 101, 104, 105, 106, 108, 109, 110], "analys": 3, "andrea": 111, "ani": [0, 1, 4, 5, 32, 59, 65, 91, 101, 103], "anndata": 99, "anoth": [3, 51], "anyth": 101, "api": [107, 111], "appear": [1, 7, 15], "append": 3, "appli": [58, 81, 88, 91, 97, 104], "applic": [3, 111], "approach": 3, "ar": [0, 1, 2, 3, 4, 5, 6, 8, 15, 34, 35, 37, 38, 54, 55, 58, 60, 65, 71, 81, 83, 93, 95, 96, 97, 99, 100, 101, 106, 108, 109, 110, 111], "arang": [71, 76, 110], "arbitrari": [2, 3, 4, 6, 65, 101, 110], "archiv": 3, "area": 111, "aren": 1, "arg": [15, 23], "argument": 15, "aris": 0, "around": 110, "arrai": [35, 46, 51, 52, 53, 54, 55, 57, 58, 72, 75, 80, 84, 87, 91, 92, 97, 98, 101, 104], "asarrai": [62, 63, 69, 70, 72, 73, 75, 81, 82, 88, 89, 90, 92, 95, 96, 98, 103, 104, 106], "ascii_art": 53, "assign": [3, 6], "associ": [54, 57, 65, 81, 99, 101, 110], "assum": [47, 97], "atgc": 58, "atom": [6, 65, 101], "attempt": [7, 108], "attr": [6, 65, 101], "attribut": [5, 6, 8, 65, 101], "author": 35, "avail": [4, 5, 6, 65, 101, 108], "averag": 91, "awai": 110, "ax": [15, 51, 58, 81], "axi": [5, 6, 15, 31, 39, 40, 43, 49, 50, 51, 52, 53, 54, 55, 57, 58, 62, 63, 65, 70, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 87, 88, 90, 91, 92, 93, 95, 96, 97, 98, 101, 104, 106, 110], "b": [42, 48, 52, 54, 55, 58, 63, 90, 101, 110], "back": 2, "bacteria": [83, 110], "bacteroidet": [83, 110], "banner": 0, "bar": [55, 82, 92, 103, 104], "barcod": [52, 54, 58], "barcodesequ": [1, 4, 5, 6, 109], "base": [3, 4, 5, 6, 8, 54, 63, 97], "bash": 111, "bash_profil": 111, "bashrc": 111, "basi": 109, "basic": [65, 101], "baz": 55, "becaus": 2, "becom": [4, 54, 83], "been": [6, 65, 101, 106], "befor": [5, 6, 34, 54], "began": 3, "being": [3, 54, 101], "belong": 54, "below": [1, 4, 5, 6, 65, 97, 101, 109], "beta": 3, "between": [6, 15, 34, 37, 38, 81, 107, 111], "bin": [54, 90], "bin_f": 54, "binari": [0, 5, 6, 87], "bioconductor": 111, "biolog": [1, 3, 4, 8, 66], "biom": 108, "biom_format": 8, "biom_open": [65, 101], "biomformat": 111, "bit": 110, "biz": 55, "body_sit": [4, 5, 6, 109], "bool": [54, 57, 62, 63, 65, 66, 74, 75, 76, 77, 87, 88, 89, 90, 91, 93, 99, 100, 101, 104, 106], "boolean": [63, 97], "both": [1, 3, 4, 15, 34, 51, 54, 58, 65, 81, 97, 101], "broad": 111, "bsd": [0, 35], "bt": 76, "build": 102, "built": [4, 5, 6], "busi": 0, "by_id": 97, "byte": 28, "c": [0, 52, 54, 55, 111], "c__clostridia": [1, 4, 5, 6], "c__gammaproteobacteria": [4, 5, 6], "c__methanomicrobia": [4, 5, 6], "c__nostocophycidea": [4, 5, 6], "cach": 30, "calcul": [80, 84, 97], "call": [1, 6, 18, 32, 41, 63, 109], "caller": 105, "can": [1, 2, 3, 4, 5, 6, 15, 30, 37, 38, 51, 55, 65, 77, 81, 91, 101, 104, 109, 110, 111], "canon": [8, 111], "caporaso": 111, "case": [1, 3, 107, 111], "cast": [32, 82], "cataccagtagc": [4, 5, 6], "categor": 1, "categori": [3, 6, 49, 54, 101, 109], "catgctgcctcccgtaggagt": [4, 5, 6], "caus": 0, "ceil": 97, "certain": 1, "cgcttatcgaga": [4, 5, 6], "chanc": 97, "chang": [2, 104], "charact": [65, 101], "check": [34, 62, 74], "class": [8, 18, 26, 30, 35, 47, 59, 63, 88, 103, 107, 111], "classic": [2, 35], "classifi": 111, "classmethod": [65, 66], "clement": 111, "cli": 111, "close": 35, "code": [0, 97], "col": [29, 46, 47, 59, 75, 103], "col_idx": 37, "collaps": [6, 110], "collapse_f": [54, 110], "collapsed_id": [6, 54, 65, 101], "collect": 1, "collpas": 110, "colon": 1, "column": [2, 3, 4, 5, 6, 15, 35, 37, 38, 52, 54, 59, 65, 66, 71, 75, 76, 77, 83, 92, 93, 99, 100, 101, 103, 107, 111], "com": 0, "combin": [1, 77], "comma": 1, "command": [1, 2, 109, 111], "comment": [1, 2, 4], "common": [52, 53], "commonli": 2, "compar": [1, 111], "comparison": 34, "compat": 33, "compil": 109, "complet": 111, "complex": [1, 6], "compon": 111, "compress": [5, 6, 65, 75, 76, 77, 101], "concaten": 55, "conceiv": 111, "condit": [0, 97], "confid": 1, "consensu": 2, "consensuslineag": 2, "consequenti": 0, "consist": [3, 46, 111], "consortium": 111, "construct": [51, 52, 53, 54, 55, 71, 81, 88, 90, 91, 95, 96, 103, 104, 108, 110], "constructor": 41, "consumpt": 54, "contain": [3, 4, 5, 6, 54, 65, 66, 97, 101, 111], "conting": [3, 8, 61, 85, 94, 105, 111], "contract": 0, "contrast": 3, "contributor": 0, "control": [4, 5, 6, 52, 63, 81], "conveni": [2, 3], "convers": [2, 81], "convert": [31, 33, 34, 46, 83, 89, 91, 99, 100, 107, 110, 111], "copi": [0, 105], "copyright": 0, "correct": 39, "correspond": [1, 3, 4, 5, 6, 54, 59, 65, 67, 69, 70, 82, 83, 101, 103, 104, 110, 111], "could": [1, 3, 96, 110], "count": [3, 4, 54, 69, 87, 91, 97, 109, 110, 111], "creat": [8, 54, 62, 63, 69, 70, 72, 73, 75, 81, 82, 88, 89, 90, 92, 95, 96, 98, 103, 104, 106, 110], "create_d": [8, 17], "creation": [5, 6, 65, 101, 102], "creation_d": [101, 102], "csc": [15, 37, 38, 39, 101], "csc_matrix": 101, "cset": [5, 6], "csr": [15, 34, 37, 38, 39, 101], "csr_matrix": 101, "ctaactaccaat": [4, 5, 6], "ctctcggcctgt": [4, 5, 6], "ctctctaccaat": [4, 5, 6], "ctctctacctgt": [4, 5, 6], "ctype": [5, 6], "current": [4, 5, 6, 65, 101], "custom": [30, 65, 95, 101], "d": [1, 7, 8, 46, 55, 71, 72, 93, 108, 110], "d_a": 81, "d_b": 81, "damag": 0, "daniel": 111, "data": [0, 1, 4, 7, 8, 11, 15, 17, 29, 34, 35, 37, 38, 39, 44, 45, 49, 51, 54, 59, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 82, 86, 88, 89, 90, 91, 92, 95, 96, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 111], "data_fh": 64, "data_pump": 66, "data_typ": [6, 65, 101], "datafram": [52, 83, 100], "dataset": [5, 6, 65, 101], "dataspac": [5, 6], "datatyp": [5, 6], "date": [1, 4, 5, 6, 65, 66, 101, 102], "dateofbirth": 1, "datetim": [4, 5, 6, 101, 102], "ddl": [65, 101], "deal": 3, "decid": 4, "decim": 1, "deeper": 110, "default": [10, 12, 18, 29, 32, 39, 40, 54, 59, 63, 65, 70, 72, 75, 76, 77, 80, 81, 84, 87, 88, 89, 90, 91, 95, 97, 101, 102, 103, 104, 106], "defaultdict": [32, 82], "defin": [6, 47, 63, 65, 81, 90, 101, 106, 110], "definit": [65, 101, 111], "delattr": 9, "delim": [35, 59], "delimet": 35, "delimit": [1, 2, 59, 64, 67, 103], "delimt": 35, "dens": [2, 3, 46, 54, 57, 63, 66, 75, 76, 77, 88, 99, 100, 110], "densiti": [26, 104, 109], "depend": 65, "deriv": 0, "describ": [4, 5, 54, 60, 65, 101, 102], "descript": [4, 101, 109], "design": [3, 111], "desir": [83, 96], "detail": [1, 4, 5, 6, 26, 109, 111], "detect": 51, "determin": [7, 11, 42, 48, 54, 108, 110], "dev": [2, 3, 4, 109], "develop": [0, 3], "df": 100, "diag": 77, "diagon": 77, "dict": [40, 49, 50, 65, 66, 67, 70, 81, 82, 90, 101, 106], "dict_of_metadata": 50, "dictionari": 63, "differ": [3, 104], "dig": 110, "dimension": 92, "dir": 10, "direct": 0, "direct_io": [59, 102, 103], "directli": [102, 103], "directori": [1, 109], "discard": 63, "disclaim": 0, "diseas": 52, "disjoint": 55, "disjointiderror": [51, 55], "distribut": [0, 97], "divers": 3, "divid": 54, "dna": 1, "do": [1, 2, 15, 63, 88, 97, 110], "dob": 1, "doc": 101, "doctest": 65, "document": [0, 3, 4, 8, 65, 101, 111], "doe": [7, 18, 34, 58, 82, 83, 101], "doi": 111, "done": [15, 37, 38], "doug": 111, "drop": 63, "dt_rich": 54, "dtype": [8, 33, 34, 35, 47, 80, 84, 99], "dure": [81, 102, 103], "e": [1, 3, 5, 6, 55, 59, 65, 83, 97, 101, 109], "each": [1, 4, 5, 6, 54, 63, 65, 76, 83, 86, 98, 101, 104, 110, 111], "earli": 30, "earth": 111, "easi": 2, "ebi": 111, "ec": 1, "ecoli": 51, "either": [1, 7, 52, 53, 81, 90, 98, 108], "elem": [65, 101], "element": [4, 5, 6, 8, 15, 65, 68, 85, 86, 101], "els": [63, 89, 104], "empti": [15, 74, 90, 92, 93], "enabl": [101, 111], "encapsul": 110, "end": 3, "endors": 0, "ensur": 97, "entir": [15, 101, 105], "entiti": [7, 101], "entri": [1, 2, 26, 59, 63, 87, 88, 103, 104, 110], "env": 58, "env_a": 110, "env_tabl": 110, "environ": [99, 110], "environment": 1, "equal": [11, 34, 60, 110], "error": 106, "especi": 3, "et": 8, "etc": [1, 83], "eval": 111, "even": 0, "event": 0, "everi": [4, 110], "exampl": [1, 3, 7, 51, 52, 53, 54, 55, 57, 58, 59, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 88, 89, 90, 91, 92, 95, 96, 97, 98, 99, 100, 101, 103, 104, 106, 107, 109, 111], "example_t": [57, 77, 78, 80, 83, 84, 99, 100, 108], "excel": 2, "except": 35, "exclud": 1, "exemplari": 0, "exemplifi": 3, "exist": [1, 7, 58, 65, 71, 109], "expand": 83, "expect": [3, 6, 35, 54, 64, 65, 81, 101], "expens": [15, 34, 37, 38], "explain": 4, "explor": 110, "export": 3, "expos": 65, "express": 0, "extend": 18, "extens": [107, 111], "extra": 1, "f": [7, 53, 54, 65, 90, 92, 101, 103, 104, 108], "f__": 1, "f__enterobacteriacea": [4, 5, 6], "f__halanaerobiacea": [4, 5, 6], "f__lachnospiracea": 1, "f__methanosarcinacea": [4, 5, 6], "f__nostocacea": [4, 5, 6], "fals": [30, 33, 47, 54, 62, 63, 66, 74, 75, 76, 77, 87, 88, 90, 93, 97, 99, 100, 101, 104, 106, 110], "fanci": 110, "faq": [4, 107, 111], "far": 3, "fast": 81, "faster": 36, "featur": 97, "feel": 4, "fetch": 97, "few": [2, 65, 101], "fhe": 7, "field": [1, 3, 4, 5, 6, 35, 65, 101], "file": [0, 7, 8, 35, 51, 52, 53, 54, 55, 59, 64, 65, 67, 71, 81, 88, 90, 91, 95, 96, 101, 102, 103, 104, 107, 108, 109, 110, 111], "filter": [52, 53, 97, 110], "filter_f": 110, "filter_fn": 63, "final": [34, 54, 102, 103, 110], "find": [1, 76], "fine": 104, "firmicut": [83, 110], "first": [1, 2, 3, 59, 71, 103, 110], "fit": 0, "float": [1, 4, 6, 15, 35, 47, 65, 66, 68, 69, 81, 98, 101], "float32": 99, "float64": [5, 6, 65, 101], "folker": 111, "follow": [0, 1, 2, 3, 5, 34, 109, 110, 111], "foo": [15, 54, 55, 65, 66, 82, 92, 101, 103, 104], "foobar": 55, "footprint": 3, "form": [0, 49, 50, 59, 64, 103], "format": [1, 8, 34, 35, 37, 38, 59, 64, 65, 66, 67, 99, 101, 102, 103, 107, 109, 110], "format_f": 101, "format_spec": 12, "format_url": [1, 4, 66], "format_vers": [4, 8, 65, 101], "formatt": 12, "forum": 111, "found": [3, 65, 101, 109, 111], "fp": 1, "fraction": [68, 109], "free": 4, "frequent": [1, 3, 15, 37, 38], "from": [0, 1, 2, 3, 7, 35, 51, 52, 53, 54, 55, 57, 58, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 88, 89, 90, 91, 92, 93, 95, 96, 97, 98, 99, 100, 101, 103, 104, 106, 108, 110], "from_biom": 2, "from_biom_w_consensuslineag": 2, "from_biom_w_taxonomi": 2, "from_hdf5": 101, "from_txt": 2, "from_txt_hdf5": 2, "from_txt_json": 2, "full": [0, 15, 54, 77, 111], "full_genome_avail": [63, 90], "fun": 110, "func": [67, 92], "function": [3, 4, 5, 6, 8, 35, 54, 59, 63, 65, 67, 81, 90, 92, 95, 101, 102, 103, 104, 107, 110, 111], "funtion": 35, "futur": 3, "g": [1, 3, 5, 6, 65, 83, 97, 101], "g__dolichospermum": [4, 5, 6], "g__escherichia": [4, 5, 6], "g__halanaerobium": [4, 5, 6], "g__methanosarcina": [4, 5, 6], "gcmodel": 111, "gene": [1, 4, 5, 6, 8, 111], "genea": 51, "geneb": 51, "gener": [3, 4, 5, 6, 65, 75, 76, 86, 90, 101, 107, 109, 111], "generated_bi": [1, 4, 8, 17, 66, 101, 102], "generatortyp": [75, 77, 90], "genom": 111, "get": [1, 40, 63, 70, 71, 72, 73, 80, 82, 84, 87, 88, 106, 109, 110], "get_value_by_id": 57, "getattr": 14, "gg_otu_0": 1, "gg_otu_1": [1, 4, 5, 6, 65, 66], "gg_otu_2": [1, 4, 5, 6, 66], "gg_otu_3": [1, 4, 5, 6, 66], "gg_otu_4": [1, 4, 5, 6, 66], "gg_otu_5": [1, 4, 5, 6, 66], "ggtt": 58, "gigasci": [8, 111], "github": [5, 6], "give": 8, "given": [3, 5, 6, 40, 70, 72, 81, 90, 106, 110], "gmail": 0, "go": [2, 97, 110], "goal": 3, "good": 0, "gpl": 35, "greater": [3, 71], "gregcaporaso": 0, "gregori": 111, "group": [3, 5, 6, 49, 65, 70, 90, 101, 111], "group_md": 49, "group_observation_md": 70, "gut": [4, 5, 6], "gzip": [7, 101, 108, 109], "h": [1, 109], "h5grp": [65, 101], "h5py": [65, 101, 111], "h5t_c_s1": [5, 6], "h5t_cset_ascii": [5, 6], "h5t_cset_utf8": 6, "h5t_ieee_f64l": [5, 6], "h5t_std_i32l": [5, 6], "h5t_std_i64l": [5, 6], "h5t_str_nullterm": [5, 6], "h5t_string": [5, 6], "h5t_variabl": [5, 6], "ha": [3, 54, 63, 81, 108, 110], "handl": [15, 54, 81, 91], "hasn": 104, "have": [1, 6, 63, 65, 81, 82, 83, 97, 101, 106, 109, 110, 111], "hdf5": [2, 3, 7, 8, 65, 101, 108], "header": [1, 2, 59, 64], "header_kei": [59, 103], "header_valu": [59, 103], "held": 97, "help": [1, 109], "helper": [24, 25, 110], "here": [1, 2, 3, 65, 101, 110, 111], "hierarch": 1, "hierarchi": [1, 54], "high": [26, 110], "highli": 3, "highlight": 110, "hit": 3, "hold": 98, "holder": 0, "home": 111, "how": [6, 8, 35, 60, 81, 111], "howev": [0, 15, 104, 110], "html": [4, 8, 65, 101], "http": [1, 4, 5, 6, 8, 35, 65, 66, 101], "hufnagl": 111, "human": [4, 5, 6], "hundr": 3, "huse": 111, "i": [0, 1, 2, 3, 4, 5, 6, 7, 8, 11, 15, 18, 29, 30, 35, 36, 37, 38, 51, 54, 55, 58, 59, 62, 63, 64, 65, 71, 74, 75, 76, 77, 81, 82, 83, 90, 91, 92, 93, 97, 98, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111], "id": [1, 2, 3, 4, 5, 6, 11, 29, 39, 40, 41, 42, 48, 50, 51, 52, 53, 54, 55, 57, 58, 59, 62, 63, 64, 65, 66, 69, 71, 73, 75, 81, 82, 83, 88, 90, 91, 95, 96, 97, 100, 101, 103, 104, 105, 106, 108, 110], "id_": [54, 63, 90, 104, 110], "id_i": 77, "id_j": 77, "id_map": 106, "identifi": [4, 73, 82, 106], "ids_to_keep": 63, "ie": 110, "iff": 34, "ignor": [1, 90, 101], "ignore_non": 90, "immedi": 108, "implement": [9, 10, 18, 27, 102, 103], "impli": 0, "implicit": 81, "import": [7, 51, 52, 53, 54, 55, 57, 58, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 88, 89, 90, 91, 92, 95, 96, 97, 98, 99, 100, 101, 103, 104, 108, 110], "improv": 3, "incident": 0, "includ": [0, 1, 2, 54, 59, 99, 100, 105, 109, 111], "include_collapsed_metadata": 54, "inclus": 3, "incorrectli": 64, "increas": [3, 54, 104], "independ": [3, 81, 111], "index": [5, 6, 15, 40, 41, 52, 54, 65, 82, 83, 87, 100, 101, 110], "indexerror": [15, 71], "indic": [0, 3, 5, 6, 65, 101, 110], "indirect": 0, "individu": [15, 110], "indptr": [5, 6, 65, 101], "ineffici": [15, 37, 38], "inform": [1, 3, 4, 5, 6, 8, 54, 107, 109, 111], "inherit": 55, "inplac": [63, 88, 89, 91, 93, 104, 106, 110], "input": [64, 109], "input_is_dens": [47, 66], "instanc": [5, 51, 55, 83], "instead": [99, 100, 110], "int": [1, 4, 5, 6, 54, 65, 71, 73, 97, 101], "int32": [5, 6, 65, 101], "int64": [65, 101], "integ": [1, 3, 4], "integr": 3, "intend": 35, "interact": 110, "interfac": 111, "intern": 39, "interoper": 111, "interpret": [6, 66], "interrupt": 0, "intersect": 81, "invalid": 8, "invert": [43, 63], "invok": 30, "involv": 3, "io": [64, 67], "ioerror": 7, "isn": 83, "iso": [4, 5, 6, 65, 101], "issubclass": 30, "item": [34, 58, 97], "iter": [19, 36, 46, 54, 55, 63, 64, 65, 76, 77, 81, 90, 96, 104, 110], "iter_": 77, "its": [0, 63], "itself": [63, 89, 104], "j": [77, 111], "jag": 83, "jai": 111, "jess": 111, "john": 111, "join": [55, 110], "jose": 111, "json": [2, 3, 4, 5, 7, 8, 66, 102, 108], "json_obj": 66, "json_tabl": 66, "just": [4, 29, 59, 77, 81, 103, 110], "justin": 111, "k__a": 54, "k__archaea": [4, 5, 6], "k__bacteria": [1, 4, 5, 6], "keep": [35, 52, 53, 63, 75, 81, 110], "kegg": 6, "kegg_pathwai": [6, 65, 83, 101], "kei": [2, 4, 54, 58, 83, 106], "keyerror": 83, "knight": 111, "known": 0, "kuczynski": 111, "kwarg": [8, 17, 23, 67], "label": 90, "lambda": [54, 63, 67, 90, 92, 95, 104, 110], "languag": [4, 5, 111], "larg": 65, "largest": [76, 91], "last": [1, 2, 34, 35, 110], "later": 2, "latest": 111, "latter": 3, "learn": [8, 111], "leav": [63, 88], "legaci": 2, "length": [5, 6, 65, 101], "less": [54, 97], "let": [76, 110], "level": [1, 4, 5, 6, 26, 108, 110], "liabil": 0, "liabl": 0, "licens": [35, 111], "like": [1, 4, 7, 35, 59, 64, 67, 71, 102, 103, 110, 111], "limit": [0, 3], "line": [1, 35, 64, 67, 111], "lineag": 2, "link": 111, "linkerprimersequ": [4, 5, 6, 109], "linux": [71, 111], "list": [0, 1, 2, 4, 5, 6, 35, 42, 48, 54, 58, 63, 64, 65, 67, 76, 83, 90, 95, 96, 101, 111], "ll": [1, 2, 3, 110], "load": [7, 65, 108], "load_tabl": 108, "locat": [5, 6, 86], "look": [1, 59], "lookup": [40, 41], "loss": 0, "love": [8, 111], "low": 97, "m": [5, 6, 65, 71, 101, 110], "mac": 111, "made": [3, 54], "mai": [0, 3, 18, 54, 111], "major": [3, 6, 65, 101], "make": 2, "mani": [3, 4, 5, 6, 54], "manipul": 65, "map": [1, 3, 5, 6, 54, 90, 106], "marker": 111, "materi": 0, "matric": 34, "matrix": [1, 3, 4, 5, 6, 8, 11, 15, 34, 37, 38, 39, 44, 45, 47, 54, 61, 65, 66, 69, 79, 85, 86, 92, 94, 97, 99, 100, 101, 110], "matrix_data": 8, "matrix_element_typ": [1, 4, 66], "matrix_typ": [1, 4], "max": [47, 76, 109], "max_sample_count": 76, "maxima": 80, "maximum": 80, "mcdonald": [8, 111], "md": [50, 58, 63, 90, 104, 110], "md_i": 77, "md_j": 77, "md_name": 35, "md_pars": 35, "mean": [65, 101, 109], "median": 109, "megan": 111, "memori": [3, 8, 28], "merchant": 0, "merg": [36, 42, 48], "merged_t": 81, "met": 0, "metabolit": [4, 5, 6, 8], "metadata": [2, 4, 5, 6, 11, 32, 35, 49, 50, 52, 53, 54, 58, 59, 63, 65, 66, 67, 70, 75, 81, 83, 90, 99, 100, 101, 103, 104, 105, 107, 109, 110, 111], "metadata_f": 54, "metadata_field": [65, 101], "metadata_formatt": [59, 103], "metadata_i": 77, "metadata_j": 77, "metag": 51, "metagenom": [3, 51, 111], "metagenomeseq": 111, "metaphlan": 111, "metdata": [35, 81], "method": [8, 18, 91, 101, 108, 110], "meyer": 111, "mg": [3, 111], "mia": 111, "micro": 3, "microbiom": 111, "might": [1, 2, 4, 111], "min": 109, "min_group_s": 54, "min_sparse_otu_t": 1, "minima": 84, "minimum": [4, 54, 84], "minor": [3, 6, 65, 101], "mode": 54, "modif": [0, 32], "modifi": [0, 41, 63, 104], "modulu": 110, "more": [1, 3, 8, 34, 54, 71, 110, 111], "mothur": 111, "motiv": [107, 111], "mult_of_thre": 110, "multinomi": 97, "multipl": [1, 54, 110, 111], "must": [0, 1, 2, 4, 54, 63, 64, 71, 81, 90, 102, 103, 104, 110], "n": [1, 5, 6, 65, 71, 97, 101], "n1": 67, "n4": 67, "n_ob": 99, "n_var": 99, "na": 64, "name": [0, 2, 4, 5, 6, 9, 14, 27, 35, 54, 59, 100, 103, 107, 110, 111], "nativ": [4, 5, 6], "natsort": 95, "natur": 95, "nd": 64, "ndarrai": [57, 99], "necessari": 34, "need": [34, 65, 110], "neglig": 0, "neither": [0, 92], "nest": [83, 99], "new": [0, 3, 4, 63, 88, 89, 91, 93, 96, 104, 105, 106, 109], "new_otu_t": 2, "new_tabl": [63, 88, 95], "newick": [6, 65, 70, 101], "next": 110, "nnz": [5, 6, 8, 34, 65, 101, 110], "non": [4, 5, 6, 8, 35, 65, 81, 85, 101, 104, 109, 110], "none": [8, 17, 33, 35, 47, 54, 58, 59, 65, 66, 67, 70, 75, 81, 82, 90, 92, 97, 101, 102, 103, 104], "nonzero": [26, 63, 68, 80, 84, 87, 88, 104, 110], "noqa": 65, "nor": [0, 92], "norm": [54, 110], "normal": [30, 54, 88, 110], "note": [2, 8, 15, 35, 37, 38, 47, 54, 55, 64, 65, 71, 81, 83, 97, 99, 100, 101, 110], "noth": 18, "notic": [0, 1], "notimpl": 30, "now": [1, 3, 104, 110], "np": [51, 52, 53, 54, 55, 57, 58, 62, 63, 69, 70, 71, 72, 73, 75, 76, 80, 81, 82, 84, 88, 89, 90, 91, 92, 95, 96, 97, 98, 99, 103, 104, 106, 110], "null": [1, 4, 5, 6, 104], "num": 109, "number": [1, 2, 3, 4, 5, 6, 8, 26, 54, 65, 69, 71, 85, 87, 97, 101, 109, 110, 111], "numer": [31, 35], "numpi": [46, 51, 52, 53, 54, 55, 58, 62, 63, 69, 70, 71, 72, 73, 75, 76, 81, 82, 87, 88, 89, 90, 91, 92, 95, 96, 97, 98, 101, 103, 104, 110, 111], "o": [1, 2, 71, 109, 110, 111], "o0": 110, "o1": [52, 53, 55, 58, 62, 63, 69, 70, 71, 72, 73, 75, 76, 81, 82, 83, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 103, 104, 106, 108, 110], "o2": [52, 53, 55, 58, 62, 63, 69, 70, 71, 72, 73, 75, 76, 81, 82, 83, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 103, 104, 106, 108, 110], "o3": [52, 53, 55, 62, 71, 76, 81, 91, 110], "o4": [52, 53, 55, 71, 91, 110], "o5": [55, 71, 110], "o6": 110, "o7": 110, "o8": 110, "o9": 110, "o__clostridial": 1, "o__enterobacterial": [4, 5, 6], "o__halanaerobial": [4, 5, 6], "o__methanosarcinal": [4, 5, 6], "o__nostocal": [4, 5, 6], "ob": [2, 99], "obesrvation_metadata_f": 81, "obj": 4, "object": [3, 4, 5, 6, 7, 8, 12, 15, 28, 35, 53, 61, 64, 65, 66, 67, 79, 93, 99, 101, 102, 103, 106, 107, 108, 110], "obs_id": [35, 69, 71, 76], "obs_map": 67, "obs_md": 1, "obs_phi": 54, "observ": [2, 3, 4, 5, 6, 8, 32, 39, 40, 44, 47, 49, 50, 51, 52, 53, 54, 55, 57, 58, 59, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 87, 88, 89, 90, 91, 92, 93, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 109, 110], "observ_id": 110, "observ_metadata": 110, "observation_column_nam": [59, 103], "observation_group_metadata": [8, 17, 70], "observation_id": [8, 17, 35, 76, 86, 91], "observation_index": [8, 17, 41], "observation_metadata": [8, 17], "observation_metadata_f": 81, "obtain": 35, "offici": 111, "offset": [5, 6], "old": 106, "om": [8, 111], "omic": 111, "omit": 97, "one": [1, 3, 51, 54, 81, 92, 110], "one_to_mani": 54, "one_to_many_md_kei": 54, "one_to_many_mod": 54, "ones": 81, "onli": [1, 2, 3, 4, 41, 52, 53, 54, 63, 65, 77, 104, 110], "open": [2, 65, 103, 108], "oper": [5, 6, 36, 49, 50, 52, 53, 54, 58, 65, 78, 83, 92, 93, 95, 96, 97, 98, 101, 104, 110], "oppos": 1, "option": [1, 3, 4, 5, 39, 40, 49, 50, 51, 54, 55, 57, 58, 62, 63, 65, 70, 71, 72, 75, 76, 77, 78, 80, 81, 84, 87, 88, 89, 90, 91, 93, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 106], "order": [1, 4, 5, 6, 42, 48, 65, 87, 95, 96, 101], "ordin": 3, "org": [1, 4, 5, 6, 8, 35, 65, 66, 101], "orient": [5, 6, 65, 101], "origin": [6, 54, 63, 88, 104, 110], "ortholog": [4, 5, 6, 8], "other": [0, 3, 11, 22, 34, 36, 51, 55, 60, 76, 81], "otherwis": [0, 15, 30, 57, 62, 74, 81, 88, 91, 110], "otu": [1, 8, 35, 51, 52, 53, 54, 55, 59, 64, 65, 66, 71, 76, 81, 88, 90, 91, 95, 96, 101, 103, 104, 108, 110, 111], "otu0": 3, "otu1": [3, 59], "otu2": [3, 59], "otu3": 3, "otu_t": 2, "otuid": 1, "our": [2, 110, 111], "out": [0, 63, 97], "outcom": 30, "output": [2, 29, 54, 59, 102, 103], "over": [15, 46, 51, 54, 55, 75, 76, 77, 80, 83, 84, 90, 92, 97, 104, 110], "overal": [4, 5, 6, 8], "overhead": 65, "overlap": 81, "overrid": [1, 30], "overridden": 18, "p": 97, "p__b": 54, "p__c": 54, "p__cyanobacteria": [4, 5, 6], "p__euryarchaeota": [4, 5, 6], "p__firmicut": [1, 4, 5, 6], "p__proteobacteria": [4, 5, 6], "pa": 110, "packag": [1, 3, 4, 5, 6, 108], "page": [3, 107], "pair": 4, "pairwis": [54, 77], "panda": [36, 52, 83, 100], "paramet": [1, 7, 15, 35, 36, 39, 40, 49, 50, 51, 52, 53, 54, 55, 57, 58, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 87, 88, 89, 90, 91, 92, 93, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 106, 109], "pars": [7, 35, 64, 65, 66, 67, 108], "parse_biom_t": 65, "parse_classic_otu_t": 35, "parse_f": 65, "parse_t": 108, "parser": [4, 5, 6], "part": [90, 110], "part_f": 110, "partial": 15, "particular": 0, "partit": [54, 110], "pass": [1, 3, 76, 91, 110], "path": [7, 54, 108], "pathwai": [4, 5, 6, 8, 54], "pc": 3, "pcr": 1, "pd": [52, 83, 100], "per": [98, 109, 110], "perform": [2, 15, 34, 37, 38, 54, 88, 91, 97, 110], "permiss": [0, 35], "permit": 0, "ph": 1, "phinch": 111, "phylogenet": 6, "phylogeni": 6, "phyloseq": 111, "phylotoast": 111, "phylum": 110, "phylum_idx": 110, "pickl": [24, 25], "picrust": 111, "pip": 111, "place": [63, 88, 91, 101, 104], "plai": 110, "pleas": [110, 111], "plot": 3, "point": [1, 4], "poke": 110, "popul": 47, "port": 35, "posit": [15, 69, 83, 110], "possibl": 0, "post": 111, "power": 8, "practic": 3, "prefer_self": 81, "presenc": [89, 110], "present": [1, 54, 64, 65, 106], "previou": 3, "previous": 35, "primari": 111, "primarili": 3, "primer": 1, "print": [51, 52, 53, 54, 55, 58, 63, 69, 71, 72, 76, 77, 78, 80, 81, 84, 88, 89, 90, 91, 95, 96, 97, 103, 104, 106, 108, 109, 110], "prior": [0, 97], "process": [2, 102, 103, 107, 111], "process_func": 67, "procur": 0, "product": 0, "profit": 0, "program": [2, 4, 5, 6, 111], "programm": 110, "project": [0, 2, 3, 35, 110], "promot": 0, "pronounc": [8, 111], "properti": [26, 61, 79, 85, 94], "proteobacteria": 110, "protocol": 25, "provid": [0, 1, 4, 5, 6, 8, 40, 49, 57, 59, 63, 65, 70, 72, 73, 78, 80, 82, 84, 90, 91, 97, 101, 102, 104, 106, 107, 109, 110, 111], "publish": 3, "pull": 111, "purpos": 0, "qiim": [3, 4, 35, 111], "qualit": [107, 111], "question": 111, "quick": [107, 111], "quot": 1, "r": [53, 111], "rais": [7, 8, 15, 40, 49, 51, 55, 57, 58, 63, 64, 65, 70, 71, 72, 73, 76, 77, 78, 80, 82, 83, 84, 91, 92, 93, 97, 104, 106], "ram": 111, "random": 97, "randomli": 97, "rang": [71, 76, 97, 110], "rank": 91, "rarefact": [3, 97], "rast": [3, 111], "rather": 109, "rdp": 111, "re": [1, 51, 97, 110], "read": [53, 108], "real": 1, "reason": [2, 65], "recogn": [83, 93, 111], "recommend": 3, "redistribut": 0, "reduc": 54, "refer": [2, 3, 8, 65, 101], "regard": [4, 107, 111], "rel": 110, "relat": [65, 101], "relationship": [6, 54], "releas": [3, 111], "relev": [4, 6, 54, 65, 101], "reli": 110, "remaind": 54, "remov": [58, 90, 93], "remove_empti": 90, "renam": [2, 107, 111], "replac": [97, 104], "repositori": [5, 6], "repres": [2, 3, 5, 6, 15, 54, 66, 92, 98, 102, 111], "represent": [3, 4, 5, 8, 15, 37, 38, 39, 54, 65, 103], "reproduc": 0, "request": [51, 58, 71, 83, 111], "requir": [2, 4, 5, 6, 15, 37, 38, 54, 64], "res_metadata": 52, "res_tabl": [52, 53], "res_tre": 53, "resampl": 97, "reserv": 0, "reshap": [71, 76, 110], "respect": [1, 5, 52, 53, 75, 76, 77, 98, 111], "rest": 111, "restrict": 4, "result": [1, 3, 54, 55, 77, 81, 90, 97, 101, 103], "retain": [0, 54, 97, 106, 110], "retriev": [65, 69, 71], "return": [7, 13, 14, 15, 16, 20, 21, 22, 26, 30, 34, 35, 37, 38, 39, 40, 44, 45, 46, 47, 52, 53, 54, 56, 57, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 80, 81, 82, 83, 84, 86, 87, 88, 89, 90, 91, 92, 93, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 110], "revers": 95, "revis": [0, 4, 5, 6], "rich": [5, 6, 110], "rich_sparse_otu_t": 109, "rich_sparse_otu_table_hdf5": [5, 6, 65], "rich_sparse_otu_table_qual_summari": 109, "rich_sparse_otu_table_summari": 109, "rideout": 111, "right": 0, "rob": 111, "root": 1, "row": [1, 3, 4, 5, 6, 15, 29, 37, 38, 46, 47, 59, 65, 66, 71, 75, 76, 77, 92, 93, 101, 103], "row_idx": 38, "run": [1, 109, 111], "s0": 110, "s1": [51, 52, 53, 55, 57, 58, 62, 63, 69, 70, 71, 72, 73, 75, 77, 81, 82, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 103, 104, 106, 108, 110], "s2": [51, 52, 53, 55, 58, 62, 63, 69, 70, 71, 72, 73, 75, 77, 81, 82, 88, 89, 90, 91, 92, 95, 96, 97, 98, 100, 103, 104, 106, 108, 110], "s3": [51, 52, 53, 55, 62, 63, 70, 71, 72, 73, 77, 81, 82, 89, 90, 91, 92, 95, 96, 97, 98, 100, 103, 104, 106, 108, 110], "s4": [52, 53, 55, 62, 71], "s5": [55, 71], "s6": 55, "s7": 55, "s8": 55, "s9": 55, "s__": [4, 5, 6], "s__halanaerobiumsaccharolyticum": [4, 5, 6], "sam_id": 76, "sam_md": 1, "same": [15, 34, 54, 63, 88, 104], "samp_id": [69, 71], "sampl": [2, 4, 5, 6, 32, 39, 40, 45, 49, 50, 51, 52, 53, 54, 55, 57, 58, 62, 63, 64, 65, 67, 69, 70, 71, 72, 73, 75, 76, 77, 78, 80, 81, 82, 83, 84, 87, 88, 90, 91, 92, 93, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 111], "sample1": [1, 4, 5, 6, 59, 66, 109], "sample2": [1, 4, 5, 6, 59, 66, 109], "sample3": [1, 4, 5, 6, 66, 109], "sample4": [1, 4, 5, 6, 66, 109], "sample5": [1, 4, 5, 6, 66, 109], "sample6": [1, 4, 5, 6, 66, 109], "sample_gen": 76, "sample_group_metadata": [8, 17], "sample_id": [8, 17, 35, 76, 86, 91, 110], "sample_index": [8, 17, 41], "sample_map": 67, "sample_metadata": [8, 17, 58, 110], "sample_metadata_f": 81, "sample_typ": [63, 90], "sampleid": [1, 64], "sc": 1, "scalar": [5, 6, 80, 84], "scipi": [37, 38, 47, 57, 91, 101], "score": 3, "search": [39, 57, 70, 73, 82, 106], "second": 3, "secondari": 66, "section": 4, "sed": 2, "see": [2, 4, 8, 19, 81, 109, 110, 111], "seed": [97, 111], "select": [1, 97], "self": [9, 13, 14, 16, 20, 21, 22, 27, 29, 33, 34, 51, 55, 59, 71, 77, 80, 81, 84, 93, 97, 103, 106], "semi": 1, "semicolon": 1, "separ": [1, 64, 67], "servic": 0, "set": [41, 54, 55, 63, 97, 99, 110, 111], "setattr": 27, "setup": 110, "sever": [2, 3], "shall": 0, "shape": [1, 4, 5, 6, 8, 26, 34, 47, 65, 66, 101], "share": [3, 4], "should": [0, 2, 4, 6, 30, 32, 41, 49, 50, 59, 97, 103, 106, 110], "signatur": [54, 65, 101], "silent": 71, "similar": 3, "similarli": 111, "simpl": [5, 6, 36], "sinc": 110, "singl": [1, 2, 4, 6, 54, 55, 65, 81], "site": 111, "size": [28, 34, 47, 54, 65, 101], "skbio": 53, "skin": [4, 5, 6], "skip": 65, "slice": [15, 37, 38], "smaller": 3, "smallest": 91, "so": [1, 2, 3, 34, 99, 109], "softwar": [0, 1, 3, 102, 111], "some": [1, 2, 110], "someth": 59, "sort": [54, 96, 97], "sort_f": 95, "sorted_t": 96, "sourc": [0, 66, 111], "space": 54, "span": 54, "spars": [1, 2, 3, 5, 6, 8, 15, 34, 37, 38, 39, 47, 57, 65, 75, 76, 77, 79, 99, 101, 110], "sparse_vector": 54, "sparsedatafram": 100, "special": [0, 6, 65, 101, 107, 111], "specif": [0, 2, 3, 5, 6, 15, 54, 65, 101, 107], "specifi": [2, 4, 5, 6, 15, 51, 54, 65, 69, 71, 93, 101, 109, 110], "spmatrix": [15, 57], "ss": 97, "stage": 3, "standard": 111, "staphylococcu": 51, "start": [75, 107, 111], "stat": 91, "state": 41, "static": [4, 5, 6, 35, 46, 47, 64, 67], "std": 109, "step": 2, "still": 2, "stombaugh": 111, "stop": [8, 111], "storag": 99, "store": [3, 4, 6, 54, 65, 101], "str": [6, 7, 26, 29, 31, 51, 54, 57, 58, 59, 62, 64, 65, 69, 73, 82, 91, 99, 101, 102, 103], "strict": [0, 54, 106], "string": [1, 2, 3, 4, 5, 6, 26, 35, 59, 63, 91, 102, 103, 106], "stringifi": 29, "stringio": [64, 67], "strpad": [5, 6], "strsize": [5, 6], "structur": [3, 4, 5, 6, 8, 54, 65, 101], "subclass": 18, "subject": 1, "submit": 111, "subset": [65, 71, 97], "subset_with_metadata": 65, "substitut": 0, "subsystem": 111, "suitabl": 3, "sum": [75, 76, 81, 87, 97, 109, 110], "summar": [107, 111], "summari": [26, 87, 109], "suppli": 54, "support": [2, 4, 5, 6, 15, 32, 54, 83, 110, 111], "survei": 111, "susan": 111, "switch": [15, 37, 38], "system": 71, "t": [1, 35, 51, 59, 65, 66, 83, 91, 101, 104], "t1": 64, "t2": [64, 67], "t3": [64, 67], "t5": 67, "t6": 67, "t_a": 81, "t_b": 81, "tab": [2, 58, 64, 67, 103, 111], "tabl": [1, 7, 107, 108, 111], "table2": 104, "table3": 104, "table_id": [8, 17, 110], "tableexcept": [8, 92, 106], "take": [1, 49, 50, 59, 81, 95, 103, 104, 109, 110], "taxon": [4, 5, 6, 8, 110], "taxonom": 3, "taxonomi": [1, 2, 4, 5, 6, 54, 55, 65, 83, 101, 109, 110], "taxonomy_0": [83, 99], "taxonomy_1": [83, 99], "tb": [64, 67], "tc": [64, 67], "team": 0, "technic": 1, "teh": 8, "tell": 1, "temporari": 54, "tend": 3, "term": 0, "test": 60, "test_tabl": [64, 67], "text": 4, "tform": 110, "than": [3, 71, 76, 97, 109], "thei": [1, 3, 6, 55, 65, 101], "them": [1, 111], "theori": 0, "thi": [0, 1, 2, 4, 18, 30, 35, 41, 51, 54, 55, 63, 65, 71, 81, 88, 91, 97, 101, 102, 106, 109, 110, 111], "third": 3, "those": 75, "though": 77, "thousand": 3, "three": [3, 5, 54, 55, 104, 110], "through": 2, "ti": 91, "time": [15, 54, 88, 97, 111], "timestamp": 101, "tip": [4, 107, 111], "to_hdf5": 65, "togeth": [54, 81], "toi": 110, "too": 51, "tool": 2, "top": [4, 5, 6], "tort": 0, "total": [5, 6, 54, 109], "tranform": 104, "tranpos": 99, "transfer": 3, "transform": [15, 37, 38, 67, 91, 110], "transform_f": 110, "transpos": [33, 47, 99], "treatment": 52, "tree": [6, 53, 70], "treenod": 53, "treesummarizedexperi": 111, "tri": 77, "triangl": 77, "true": [8, 17, 30, 34, 54, 57, 62, 63, 65, 66, 74, 75, 76, 77, 82, 87, 88, 89, 90, 91, 93, 95, 97, 99, 100, 101, 104, 106, 110], "try": 47, "tsv": [7, 67, 103, 108], "tsv_fh": 67, "ttgg": 54, "tupl": [6, 15, 49, 54, 65, 66, 83, 97, 101], "two": [3, 34, 51, 54, 65, 81, 101, 108], "txt": [0, 1, 2, 109], "type": [1, 2, 3, 4, 5, 6, 8, 17, 33, 35, 49, 55, 61, 65, 66, 81, 101], "typeerror": [7, 83], "u": 53, "under": [0, 6, 35, 54], "underli": [8, 61, 85, 94], "unicod": 4, "union": [55, 81], "uniqu": [4, 54, 83, 109, 110], "unknown": 91, "unknownaxiserror": [40, 49, 51, 57, 58, 63, 70, 72, 73, 76, 77, 78, 80, 82, 83, 84, 92, 93, 104, 106], "unknowniderror": [73, 82], "unrecogn": [40, 49, 51, 57, 63, 70, 72, 73, 78, 80, 82, 84, 104, 106], "untouch": [63, 88], "unzip": 90, "up": [3, 54, 110], "updat": 106, "updated_t": 106, "upper": 77, "url": [4, 5, 6, 65, 101], "us": [0, 1, 2, 4, 5, 6, 30, 35, 36, 54, 59, 60, 63, 88, 91, 92, 95, 96, 99, 101, 102, 109, 110], "usag": [107, 111], "usearch": 111, "user": [3, 6], "util": [3, 65, 81, 90, 95, 101], "v": 110, "val": [33, 63], "val_i": 77, "val_j": 77, "valid": [8, 17, 65, 91, 101], "valu": [1, 3, 4, 5, 6, 13, 16, 20, 21, 22, 27, 29, 32, 47, 49, 54, 63, 64, 65, 69, 75, 76, 80, 84, 87, 88, 91, 95, 97, 98, 104, 106, 109, 110], "valueerror": [64, 65, 91, 97], "vamp": [3, 111], "var": 99, "variabl": [5, 6, 110], "variat": 1, "vec": 46, "vector": [15, 33, 37, 38, 44, 45, 46, 54, 90, 93, 97, 104, 110], "veri": 65, "versa": 88, "version": [3, 8, 59, 63, 65, 88, 97, 101, 103, 107], "via": [3, 54, 97], "vice": 88, "view": [2, 5, 6, 90], "vlen": [65, 101], "vocabulari": [4, 5, 6], "w": [101, 103], "w_md": 1, "w_omd": 1, "w_smd": 1, "wa": [1, 3, 4, 5, 6, 111], "wai": [0, 1, 3, 6, 54, 65, 101], "want": [1, 2, 109, 110], "warranti": 0, "we": [2, 3, 35, 51, 65, 97, 110], "well": 65, "wendel": 111, "what": [3, 51, 54, 65, 90, 101, 110], "when": [2, 3, 8, 18, 54, 65, 97], "where": [1, 3, 4, 5, 6, 63, 65, 83, 96, 101, 106, 109, 110], "whether": [0, 62, 63, 65, 74, 101, 104], "which": [2, 3, 4, 6, 52, 53, 54, 55, 59, 63, 80, 83, 84, 87, 92, 93, 98, 101, 103, 111], "while": [2, 8, 15, 37, 38, 107, 110, 111], "whole": [58, 80, 84, 87, 93, 98], "whose": [57, 73, 82, 95], "wide": [4, 5, 6], "wilk": 111, "wise": [5, 6], "with_replac": 97, "within": [4, 5, 6, 54, 86, 110], "without": [0, 1, 59, 77, 97, 103], "work": [3, 71, 81, 111], "worri": [8, 111], "would": [3, 111], "write": [101, 102, 103], "written": [0, 59, 102, 103, 109], "www": 35, "x": [3, 54, 63, 67, 76, 82, 88, 92, 95, 99, 101, 103, 104, 110, 111], "y": [82, 92, 101, 103, 104], "yield": [75, 76, 77, 86, 90], "you": [1, 2, 3, 4, 96, 109, 111], "your": [1, 2, 111], "z": 75, "z3": [69, 75], "zero": [3, 4, 5, 6, 8, 65, 85, 93, 97, 101, 104, 109, 110], "zip": 58}, "titles": ["The BIOM Format License", "Adding sample and observation metadata to biom files", "Converting between file formats", "The biom file format", "The biom file format: Version 1.0", "The biom file format: Version 2.0", "The biom file format: Version 2.1", "biom.load_table", "biom.table.Table", "biom.table.Table.__delattr__", "biom.table.Table.__dir__", "biom.table.Table.__eq__", "biom.table.Table.__format__", "biom.table.Table.__ge__", "biom.table.Table.__getattribute__", "biom.table.Table.__getitem__", "biom.table.Table.__gt__", "biom.table.Table.__init__", "biom.table.Table.__init_subclass__", "biom.table.Table.__iter__", "biom.table.Table.__le__", "biom.table.Table.__lt__", "biom.table.Table.__ne__", "biom.table.Table.__new__", "biom.table.Table.__reduce__", "biom.table.Table.__reduce_ex__", "biom.table.Table.__repr__", "biom.table.Table.__setattr__", "biom.table.Table.__sizeof__", "biom.table.Table.__str__", "biom.table.Table.__subclasshook__", "biom.table.Table._axis_to_num", "biom.table.Table._cast_metadata", "biom.table.Table._conv_to_self_type", "biom.table.Table._data_equality", "biom.table.Table._extract_data_from_tsv", "biom.table.Table._fast_merge", "biom.table.Table._get_col", "biom.table.Table._get_row", "biom.table.Table._get_sparse_data", "biom.table.Table._index", "biom.table.Table._index_ids", "biom.table.Table._intersect_id_order", "biom.table.Table._invert_axis", "biom.table.Table._iter_obs", "biom.table.Table._iter_samp", "biom.table.Table._to_dense", "biom.table.Table._to_sparse", "biom.table.Table._union_id_order", "biom.table.Table.add_group_metadata", "biom.table.Table.add_metadata", "biom.table.Table.align_to", "biom.table.Table.align_to_dataframe", "biom.table.Table.align_tree", "biom.table.Table.collapse", "biom.table.Table.concat", "biom.table.Table.copy", "biom.table.Table.data", "biom.table.Table.del_metadata", "biom.table.Table.delimited_self", "biom.table.Table.descriptive_equality", "biom.table.Table.dtype", "biom.table.Table.exists", "biom.table.Table.filter", "biom.table.Table.from_adjacency", "biom.table.Table.from_hdf5", "biom.table.Table.from_json", "biom.table.Table.from_tsv", "biom.table.Table.get_table_density", "biom.table.Table.get_value_by_ids", "biom.table.Table.group_metadata", "biom.table.Table.head", "biom.table.Table.ids", "biom.table.Table.index", "biom.table.Table.is_empty", "biom.table.Table.iter", "biom.table.Table.iter_data", "biom.table.Table.iter_pairwise", "biom.table.Table.length", "biom.table.Table.matrix_data", "biom.table.Table.max", "biom.table.Table.merge", "biom.table.Table.metadata", "biom.table.Table.metadata_to_dataframe", "biom.table.Table.min", "biom.table.Table.nnz", "biom.table.Table.nonzero", "biom.table.Table.nonzero_counts", "biom.table.Table.norm", "biom.table.Table.pa", "biom.table.Table.partition", "biom.table.Table.rankdata", "biom.table.Table.reduce", "biom.table.Table.remove_empty", "biom.table.Table.shape", "biom.table.Table.sort", "biom.table.Table.sort_order", "biom.table.Table.subsample", "biom.table.Table.sum", "biom.table.Table.to_anndata", "biom.table.Table.to_dataframe", "biom.table.Table.to_hdf5", "biom.table.Table.to_json", "biom.table.Table.to_tsv", "biom.table.Table.transform", "biom.table.Table.transpose", "biom.table.Table.update_ids", "BIOM Documentation", "Quick start", "Summarizing BIOM tables", "BIOM Table (<code class=\"xref py py-mod docutils literal notranslate\"><span class=\"pre\">biom.table</span></code>)", "The Biological Observation Matrix (BIOM) format"], "titleterms": {"0": [2, 4, 5], "1": [2, 4, 6], "2": [5, 6], "4": 2, "The": [0, 3, 4, 5, 6, 111], "__delattr__": 9, "__dir__": 10, "__eq__": 11, "__format__": 12, "__ge__": 13, "__getattribute__": 14, "__getitem__": 15, "__gt__": 16, "__init__": 17, "__init_subclass__": 18, "__iter__": 19, "__le__": 20, "__lt__": 21, "__ne__": 22, "__new__": 23, "__reduce__": 24, "__reduce_ex__": 25, "__repr__": 26, "__setattr__": 27, "__sizeof__": 28, "__str__": 29, "__subclasshook__": 30, "_axis_to_num": 31, "_cast_metadata": 32, "_conv_to_self_typ": 33, "_data_equ": 34, "_extract_data_from_tsv": 35, "_fast_merg": 36, "_get_col": 37, "_get_row": 38, "_get_sparse_data": 39, "_index": 40, "_index_id": 41, "_intersect_id_ord": 42, "_invert_axi": 43, "_iter_ob": 44, "_iter_samp": 45, "_to_dens": 46, "_to_spars": 47, "_union_id_ord": 48, "ad": 1, "add_group_metadata": 49, "add_metadata": 50, "align_to": 51, "align_to_datafram": 52, "align_tre": 53, "between": [2, 3], "biolog": 111, "biom": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 109, 110, 111], "case": 2, "cite": 111, "class": 110, "collaps": 54, "column": 1, "concat": 55, "content": 111, "convert": 2, "copi": 56, "core": 3, "data": [3, 5, 6, 57, 109], "ddl": [5, 6], "del_metadata": 58, "delimited_self": 59, "dens": 4, "descript": [5, 6], "descriptive_equ": 60, "develop": 111, "document": 107, "dtype": 61, "earlier": 2, "effici": 3, "encapsul": 3, "exampl": [2, 4, 5, 6, 108, 110], "exist": 62, "extens": 3, "facilit": 3, "faq": 3, "file": [1, 2, 3, 4, 5, 6], "filter": 63, "format": [0, 2, 3, 4, 5, 6, 111], "from_adjac": 64, "from_hdf5": 65, "from_json": 66, "from_tsv": 67, "function": 108, "gener": 2, "get_table_dens": 68, "get_value_by_id": 69, "group_metadata": 70, "handl": 3, "hdf5": [5, 6], "head": 71, "id": 72, "index": 73, "instal": 111, "is_empti": 74, "iter": 75, "iter_data": 76, "iter_pairwis": 77, "langaug": 5, "languag": 6, "larg": 3, "length": 78, "licens": 0, "load_tabl": 7, "matrix": 111, "matrix_data": 79, "max": 80, "merg": 81, "metadata": [1, 3, 82], "metadata_to_datafram": 83, "min": 84, "minim": 4, "motiv": 3, "name": 1, "nnz": 85, "nonzero": 86, "nonzero_count": 87, "norm": 88, "observ": [1, 111], "otu": [2, 3, 4, 5, 6], "pa": 89, "packag": 111, "partit": 90, "process": 1, "project": 111, "python": 111, "qiim": 2, "qualit": 109, "quick": 108, "rankdata": 91, "reduc": 92, "regard": 3, "remove_empti": 93, "renam": 1, "rich": 4, "round": 2, "sampl": [1, 3, 109], "shape": 94, "singl": 3, "sort": 95, "sort_ord": 96, "spars": 4, "special": 2, "start": 108, "storag": 3, "studi": 3, "subsampl": 97, "sum": 98, "summar": 109, "support": 3, "tabl": [2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 109, 110], "team": 111, "thi": 3, "tip": 3, "to_anndata": 99, "to_datafram": 100, "to_hdf5": 101, "to_json": 102, "to_tsv": 103, "tool": 3, "transform": 104, "transpos": 105, "trip": 2, "tsv": 2, "update_id": 106, "us": [3, 111], "usag": 2, "veri": 3, "version": [4, 5, 6, 111], "while": 1}})