Skip to content

Latest commit

 

History

History
223 lines (179 loc) · 9.36 KB

18s-rrna-amplification-protocol.md

File metadata and controls

223 lines (179 loc) · 9.36 KB
Raw

Version 4_13

The 18S protocol detailed here is designed to amplify eukaryotes broadly with a focus on microbial eukaryotic lineages. The primers are based on those of Amaral-Zettler et al 2009 and designed to be used with the Illumina platform. As with the 16S EMP Illumina protocol, in order to run 18S libraries on the MISeq and HiSeq please make sure you read the supplementary methods of Caporaso et al 2012 ISME very carefully – you will need to make your sample more complex by adding 30-50% PhiX to your run. The outlines of the protocol are the same as the 16S protocol, but different primers, PCR conditions, and sequencing primers are used. In addition, we have designed a blocking primer that reduces the amplification of vertebrate host DNA to be used on host-associated samples, especially those that have a low eukaryotic biomass. Blocking primer strategy is based on Vestheim et al 2008. Throughout concentrations are listed in µM (micromolar).

  • Amaral-Zettler, LA, EA McCliment, HW Ducklow, SM Huse. 2009. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. PLoS ONE 4:e6372.
  • Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, Owens SM, Betley J, Fraser L, Bauer M, Gormley N, Gilbert JA, Smith G, Knight R. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J.
  • Vestheim, H, SN Jarman. 2008. Blocking primers to enhance PCR amplification of rare sequences in mixed samples - a case study on prey DNA in Antarctic krill stomachs. Frontiers in zoology 5:12.

Download Links

Primer Constructs designed by Laura Wegener Parfrey

The primer sequences in this protocol are always listed in the 5’ -> 3’ orientation. This is the orientation that should be used for ordering. See primer tips and getting started for information on ordering, concentration, and resuspension.

Illumina_Euk_1391f PCR Primer Sequence – Forward primer

Field number (space-delimited), description: 1. 5' Illumina adapter 2. Forward primer pad 3. Forward primer linker 4. Forward primer (1391f) AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTT CG GTACACACCGCCCGTC

Illumina_EukBr PCR primer sequence – Reverse primer, barcoded

Each sequence contains a different barcode

1. Reverse complement of 3' Illumina adapter 2. Golay barcode 3. Reverse primer pad 4. Reverse primer linker 5. Reverse primer (EukBr) CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC  

Mammal_block_I-short_1391f Mammal Blocking Primer Sequence

GCCCGTCGCTACTACCGATTGG/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/TTAGTGAGGCCCT/3SpC3/ Mammal blocking primer is to be used when there is a high probability of picking up host genomic DNA. The C3 spacer (/3SpC3/) is a chemical modification that prevents extension during the PCR. Please note that the use of blocking primer reduces the number of host sequences detected but does not completely eliminate them. Thus remaining host sequences should also be filtered out during the analysis phase. We have found blocking primers to be particularly useful for host-associated samples with a low biomass of eukaryotic DNA. Note: sequence is formatted for ordering from IDT DNA.

PCR Conditions for Illumina_Euk_1391f / Illumina_EukBr (WITHOUT mammal blocking primer):

Complete reagent recipe (master mix) for 1X PCR reaction

PCR Grade H2O (note 1, below) 13.0 µL 5 Primer Hot MM (note 2, below) 10.0 µL Forward primer (10µM) 0.5 µL Reverse primer (10µM) 0.5 µL Template DNA 1.0 µL Total reaction volume 25.0 µL

Notes:

  1. PCR grade water was purchased from MoBio Laboratories (MoBio Labs: Item#17000-11)
  2. Five Prime Hot Master Mix (5 prime: Item# 2200410)
  3. Final primer concentration of mastermix: 0.2 µM

Thermocycler Conditions (WITHOUT mammal blocking primer)

Note: Thermocycler conditions optimized for 96 well cyclers. Step Temperature Time:

  1. 94°C 3 minutes
  2. 94°C 45 seconds
  3. 57°C 60 seconds
  4. 72°C 90 seconds
  5. Repeat steps 2-4 35 times
  6. 72°C 10 minutes
  7. 4°C HOLD

PCR Conditions for Illumina_Euk_1391f / Illumina_EukBr (WITH mammal blocking primer):

Complete reagent recipe (master mix) for 1X PCR reaction:

PCR Grade H2O (note 1, below) 9.0 µL 5 Primer Hot MM (note 2, below) 10.0 µL Forward primer (10µM) 0.5 µL Reverse primer (10µM) 0.5 µL Blocking Primer (10µM) 4.0 µL Template DNA 1.0 µL Total reaction volume 25.0 µL

Notes:

  1. PCR grade water was purchased from MoBio Laboratories (MoBio Labs: Item#17000-11)
  2. Five Prime Hot Master Mix (5 prime: Item# 2200410)
  3. Final forward and reverse primer concentration in mastermix: 0.2 µM
  4. Final concentration of blocking primer in mastermix: 1.6 µMThermocycler Conditions (WITH mammal blocking primer)

Thermocycler conditions

Note: Thermocycler conditions optimized for 96 well cyclers. Step Temperature Time

  1. 94°C 3 minutes
  2. 94°C 45 seconds
  3. 65°C 15 seconds
  4. 57°C 30 seconds
  5. 72°C 90 seconds
  6. Repeat steps 2-5 35 times
  7. 72°C 10 minutes
  8. 4°C HOLD

Protocol:

  1. Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25 µL PCR reactions.
  2. Combine the triplicate PCR reactions for each sample into a single volume. Combination will result in a total of 75 µL of amplicon for each sample. Do NOT combine amplicons from different samples at this point.
  3. Run amplicons (with triplicates pooled) on an agarose gel. Expected band size for 1391f/Eukbr is roughly 200 bp.
  4. Quantify amplicons with Picogreen (see manufacturers protocol; Invitrogen Item #P11496).
  5. Combine an equal amount of amplicon from each sample into a single, sterile tube. Generally 240 ng of DNA per sample are pooled. However, larger amounts can be used if the final pool will be gel isolated or when working with low biomass samples. Note: When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
  6. Clean Amplicon pool using MoBio UltraClean PCR Clean-Up Kit #12500 according to the manufacturer’s instructions. If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined. Optional: if spurious bands were present on gel (in step 3), part of the final pool can be run on a gel and then gel extracted to select only the target bands. It is a good idea to only gel extract part of the pool to prevent against losing the entire pool in the event something goes wrong.
  7. Measure concentration and 260/280 of final pool that has been cleaned. For best results the 260/280 should be between 1.8-2.0.
  8. Send an aliquot for sequencing along with sequencing primers listed below.

IMPORTANT: Sequencing requires use of 18S sequencing primers, constructs below.

Euk_illumina_read1_seq_primer : Read 1 Sequencing Primer

Field, description (space-delimited):

  1. Forward primer pad
  2. Forward primer linker
  3. Forward primer

TATCGCCGTT CG GTACACACCGCCCGTC

Euk_illumina_read2_seq_primer: Read 2 Sequencing Primer

Field, description (space-delimited):

  1. Reverse primer pad
  2. Reverse primer linker
  3. Reverse primer

AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC

Euk_illumina_index_seq_primer: Index Sequencing Primer

Field, description (space-delimited):

  1. Reverse complement of reverse primer
  2. Reverse complement of reverse primer linker
  3. Reverse complement of reverse primer pad

GTAGGTGAACCTGCAGAAGGATCA TG CTGACTGACT