Skip to content

Actions: chrovis/varity

Actions

All workflows

Actions

Loading...

Showing runs from all workflows
119 workflow runs
119 workflow runs
Event

Filter by event
Status

Filter by status
Branch
Actor

Filter by actor
Failed to convert long deletion including stop codon chr17:80090386 CAGCACGTGCATGAACAACACAGGACACACACAGCACGTGCATGAACAACACAGGACACACACA>C build #258: Pull request #96 synchronize by nokara26
April 12, 2024 06:15 1m 45s fix/fix-protein-indel-condition
fix/fix-protein-indel-condition
April 12, 2024 06:15 1m 45s
fix: add no effect, insertion and deletion condition to protein indel build #257: Commit de3dc8d pushed by nokara26
April 12, 2024 06:15 1m 18s fix/fix-protein-indel-condition
fix/fix-protein-indel-condition
April 12, 2024 06:15 1m 18s
Failed to convert long deletion including stop codon chr17:80090386 CAGCACGTGCATGAACAACACAGGACACACACAGCACGTGCATGAACAACACAGGACACACACA>C build #256: Pull request #96 opened by nokara26
April 12, 2024 02:41 1m 18s fix/fix-protein-indel-condition
fix/fix-protein-indel-condition
April 12, 2024 02:41 1m 18s
fix: add no effect and insertion condition to protein indel build #255: Commit 93dd46f pushed by nokara26
April 12, 2024 02:36 1m 35s fix/fix-protein-indel-condition
fix/fix-protein-indel-condition
April 12, 2024 02:36 1m 35s
Merge pull request #92 from chrovis/fix/fix-exon-intron-overlap-and-i… build #254: Commit d88d5dc pushed by federkasten
February 2, 2024 01:41 1m 30s master
master
February 2, 2024 01:41 1m 30s
pages build and deployment pages-build-deployment #38: by federkasten
February 2, 2024 01:41 53s
February 2, 2024 01:41 53s
Fix exon/intron boundary determine process and frameshift that affects initiation site build #253: Pull request #92 synchronize by nokara26
February 2, 2024 00:22 1m 42s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 2, 2024 00:22 1m 42s
Merge pull request #93 from chrovis/refactor/overlap-exon-intron-boudary build #252: Commit 2adaed8 pushed by nokara26
February 2, 2024 00:22 1m 24s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 2, 2024 00:22 1m 24s
Refactor and generalize overlap-exon-intron-boundary? build #251: Pull request #93 opened by federkasten
February 1, 2024 10:24 1m 14s refactor/overlap-exon-intron-boudary
refactor/overlap-exon-intron-boudary
February 1, 2024 10:24 1m 14s
refactor: refactor and generalize overlap-exon-intron-boundary? using… build #250: Commit 7e227e8 pushed by federkasten
February 1, 2024 10:18 1m 23s refactor/overlap-exon-intron-boudary
refactor/overlap-exon-intron-boudary
February 1, 2024 10:18 1m 23s
Fix exon/intron boundary determine process and frameshift that affects initiation site build #249: Pull request #92 synchronize by nokara26
February 1, 2024 02:26 1m 49s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 1, 2024 02:26 1m 49s
fix: add initiation site variant condition to frameshift and tweak build #248: Commit 0587070 pushed by nokara26
February 1, 2024 02:26 1m 46s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 1, 2024 02:26 1m 46s
Fix exon/intron boundary determine process and frameshift that affects initiation site build #247: Pull request #92 opened by nokara26
February 1, 2024 01:21 1m 31s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 1, 2024 01:21 1m 31s
fix: add initiation site variant condition to frameshift and tweak build #246: Commit df0b6eb pushed by nokara26
February 1, 2024 01:15 1m 31s fix/fix-exon-intron-overlap-and-ini-site-variant
fix/fix-exon-intron-overlap-and-ini-site-variant
February 1, 2024 01:15 1m 31s
Merge pull request #91 from chrovis/chore/prepare-0.11.1-snapshot build #245: Commit c9d44d9 pushed by nokara26
January 22, 2024 23:29 1m 39s master
master
January 22, 2024 23:29 1m 39s
pages build and deployment with artifacts-next pages-build-deployment #37: by nokara26
January 22, 2024 23:29 41s
January 22, 2024 23:29 41s
Prepare for next development iteration (0.11.1-SNAPSHOT) build #244: Pull request #91 opened by totakke
January 22, 2024 10:47 1m 14s chore/prepare-0.11.1-snapshot
chore/prepare-0.11.1-snapshot
January 22, 2024 10:47 1m 14s
Tidy up descriptions of breaking change build #243: Commit b74961f pushed by totakke
January 22, 2024 10:45 1m 15s chore/prepare-0.11.1-snapshot
chore/prepare-0.11.1-snapshot
January 22, 2024 10:45 1m 15s
Merge pull request #90 from chrovis/release/v0.11.0 build #242: Commit 407aa14 pushed by totakke
January 22, 2024 10:30 1m 19s 0.11.0
0.11.0
January 22, 2024 10:30 1m 19s
Merge pull request #90 from chrovis/release/v0.11.0 build #241: Commit 407aa14 pushed by totakke
January 22, 2024 10:27 1m 14s master
master
January 22, 2024 10:27 1m 14s
pages build and deployment with artifacts-next pages-build-deployment #36: by totakke
January 22, 2024 10:27 52s
January 22, 2024 10:27 52s
Release v0.11.0 build #240: Pull request #90 synchronize by nokara26
January 22, 2024 07:40 1m 42s release/v0.11.0
release/v0.11.0
January 22, 2024 07:40 1m 42s
docs: fix README about breaking change and changelog build #239: Commit b7a18db pushed by nokara26
January 22, 2024 07:40 1m 13s release/v0.11.0
release/v0.11.0
January 22, 2024 07:40 1m 13s
Release v0.11.0 build #238: Pull request #90 opened by nokara26
January 22, 2024 05:48 1m 20s release/v0.11.0
release/v0.11.0
January 22, 2024 05:48 1m 20s
chore(release): Release 0.11.0 build #237: Commit aaf465d pushed by nokara26
January 22, 2024 05:46 1m 16s release/v0.11.0
release/v0.11.0
January 22, 2024 05:46 1m 16s